1. Art and Diseño

From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
Elliptocytogenic
Spectrin Sfax Lacks Nine Amino Acids in Helix 3
of Repeat 4. Evidence for the Activation of a Cryptic 5’-Splice Site in Exon 8
of Spectrin a-Gene
By F. Baklouti, J. Marechal, R. Wilmotte, N. Alloisio, L. Morle, M.T. Ducluzeau, L. Denoroy, A. Mrad,
M.H. Ben Aribia, R. Kastally, and J. Delaunay
ElliptocytogenicdiS spectrin Sfax is a new variant found in a
Tunisian family. The
allele yielded a clinically manifest
picture only when occurring in trans to a recently identified,
low expression level polymorphism referred to as the av/41
allele. Spectrin dimers were slightly increased in 4°C extracts. On peptide maps, the ad domain split into two
abnormal fragments of 36 and 33 Kd. The mutated a-chain
and
represented 20% and 44% of total a-chain in
aV/41/d136
heterozygotes, respectively. Peptide sequencing
showed that the 36-Kd fragment started at Ala 357 and
displayed a deletion extending from amino acids 363 to 371.
The corresponding 27-nucleotide deletion was found in
a-spectrin mRNA. However, exon 8 of spectrin a-gene failed
to disclose this deletion. Instead, an A to G substitution
appeared in position 3 of codon 362, leading to the occurrence of the critical GU dinucleotide within a cryptic 5’-splice
site surrounding codon 362. This event would account for the
splicing out of codons 363 to 371. The reading frame was
preserved and even amino acid 362 (AGG, Arg) remained
unaltered. As in most spectrin a-chain elliptocytogenic variants, the change involved a helix 3. This is the first elliptocytogenic mutation recorded in repeat 4.
0 1992 by The American Society of Hematology.
H
a small segment upstream of repeat a1 that is referred to as
repeat al’).
More than 10 elliptocytogenic mutations have been
described in the a1 domain (repeats a1 to 05 and part of
repeat a6). They yield a smaller number of protein phenotypes as defined according to the recommendations of
Palek and Lux.I3 Many mutations affect helix 3 of repeats
al,14-21a2,10,22,23
a3 and 05.10,22
Other mutations involve
helices 2. They are thought to act through a secondary
change in the spatially adjacent helix 3, referring to the
model proposed by Speicher and Marchesi7 and Tse et a1,12
respectively. A mutation at position 207 concerns helix 2 of
repeat aLZ4Various modifications affect helix 2 (and
sometimes also helix 1) of repeat P17.12,25-28
spectrin Sfax, the first
In this report, we describe
elliptocytogenic variant found to affect helix 3 of repeat a4.
Amino acids 363 to 371 were skipped, as deduced from
peptide and cDNA sequencing. A point mutation (A + G)
was evidenced in codon 362 at the gene level. As a result,
the surrounding sequence highly matched a 5’-splice site
and, most probably, caused the 3‘-end of exon 8 (codons
363 to 371) to be spliced out.
EREDITARY elliptocytosis (HE) designates a group
of conditions in which the red blood cells (RBCs) are
elliptical in shape. Studies at the level of proteins and
nucleic acids have shown that HE is highly heterogeneous
on a molecular
Most of the mutations described
thus far affect spectrin, the major RBC skeleton component. Spectrin is a fibrillar heterodimer composed of an
a-chain and a P-chain associated in an antiparallel manner.
Tryptic peptide mapping has allowed the dissection of
spectrin chains into domains, namely a1 to aV and PI to
PIV.5 Partial amino acid sequencing provided the basis for
the classical n ~ m b e r i n g . ~Later
, ~ on, cDNA sequencing
showed that the a- and p-chains contain 2429 and 2137
amino acids, r e s p e c t i ~ e l y The
. ~ ~ ~exon-intron junctions in
spectrin a-gene have been established.lOJ1According to the
assumption of Speicher and Marchesi? most parts of a-and
P-chains are comprised of 106 amino acid repeats (22 and
17 repeats, respectively). Each repeat has three helical
segments designated 3, 1, and 2 (N- to C-terminus of a
repeat). At the self-association site, it has been hypothesized that repeat P17 of the P-chain (helices 1 and 2) and
repeat a1 of the a-chain (helix 3) combine to form a
package of three helices.12(In addition, a-chain contributes
CASE REPORTS
From CNRS URA 11 71, Facultk de Mkdecine Grange-Blanche;
lnstitut Pasteur de Lyon; Service Central d ’Analyse, CNRS, Vemaison,
France; and Service d’Himatologie Biologique, Hdpital Habib
Thameur, Tunis, Tunisia.
Submitted July 25, 1991; accepted January 13, 1992.
Supported by the “Universitk Claude-Bemard Lyon-I, ” the “Institut
Pasteur de Lyon, ” the Tentre National de la Recherche Scientifique”
(URA 1171), the ‘Ynstitut National de la Santk et de la Recherche
Mkdicale” (489 NS 3) and the “Caisse Nationale d’Assurance
Maladie des Travailleurs Salariks” (Grant 89 69 002).
Address reprint requests to J. Delaunay, MD, CNRS URA 1171,
Facultk de Mkdecine Grange-Blanche,69373 Lyon C e d a 08, France.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
@ 1992 by The American Society of Hematology.
0006-4971/92/7909-0026$3.00/0
2464
The affected family is Tunisian family BY living near the city of
Sfax. Member 11.1(Table 1) is a boy born in 1980. In the first years
of his life, anemia, icterus, and splenomegaly were recorded.
Anemia fluctuated between 50 and 100 g hemoglobin (Hb)/L (iron
deficiency possibly accounted for such large variations). Elliptocytosis (100%) was recognized in 1984. Presently, the spleen is
palpable 6 cm below the costal margin. Routine laboratory parameters are as follows: RBCs, 3.4 x 101*/L;Hb, 107 giL; packed cell
volume (PCV), 20%; mean corpuscular volume (MCV), 83 km3;
reticulocytes, 10.2 x 109/L(3%); bilirubin, 20 Fmol/L. There is a
100% elliptocytosis with some tendency to bud (Fig 1).The father
(1.1) has a moderate spleen enlargement (RBCs, 3.6 X 1012/L;Hb,
115 g/L; PCV, 30%; MCV, 84 pm3; nearly 100% elliptocytosis). It
is not known whether the father had a more pronounced anemia in
childhood. The mother (1.2) is clinically normal (RBCs, 4.7 x lo’*/
L; Hb, 102 g/L; PCV, 35%; MCV, 74 pm3; anisocytosis with some
elliptocytes possibly reflecting iron deficiencyor a mild thalassemia).
The subject’s brother (11.2) (Fig 1) and sister (11.3) (not shown) are
clinically asymptomatic, have normal RBC indices, and display a
Blood, Vol79, No 9 (May I ) , 1992: pp 2464-2470
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
SPLICE SITE ACTIVATION IN ELLIPTOCMOSIS
2465
Table 1. Functionaland Structural Parameters of&- Spectrln Sfax
Family
Members
1.1
1.2
11.1
11.2
11.3
Controls
Year of
Birth
1952
1960
1980
1983
1984
Diplotypes
aV/41/a1'Jb
avl4l/a
av/41/d'a
a/a'/Jb
ala1'=
a/3
%
PI3
%
Spectrin Dimers
in Crude
Spectrin Extracts,
%
39.5t
43.5
41.6t
42.4
43.7
46.2 f 2.1
(n = 5)
38.6
41.0
40.0
39.8
41.8
41.1 f 1.7
(n = 5)
13.2
4.5
13.9
12.7
13.1
6.9 2 1.6
(n = 24)
K.
Spectrin Sfax
(36+ 33)/a1*
1@Llmol
%
1.9
4.1
1.7
2.1
2.2
4 . n f 0.68
(n = 43)
42
45
19
21
aV 41-Kd
Fragment
%
1.5
1.7
1.5
0.8
0.9
The modes of determination of the parameters are given or referred to under Materialsand Methods.
"al:Sum of the 80-, 7s. 74-.36-, and 33-Kd fragments.
tReduction, significantatP < .01 (t-test).
less pronounced elliptocytosis as compared with 1.1 and 11.1. The
4.la/4.lb ratio is sharply reduced in 1.1 and 11.1, and moderately
decreased in 11.2 and 11.3 (not shown). It is normal in 1.2. Among
other family members, a sister (bom in 1941) of the father (who is
the genuine proband) has displayed the same symptomatology as
11.1 and undergone splenectomy in 1976. She was not investigated
in the present study.
MATERIALS AND METHODS
h t e i n analysis. Protein studies were performed in general as
previously described or referred to.15.29" Specifically, the electrophoresis of proteins on polyacrylamide gel in the presence of
sodium dodecyl sulfate (SDS-PAGE) was performed according to
Laemmli3I or Fairbanks et al?* with some modifications.29 The
amounts of spectrin a- and pchains were exprcssed with respect to
band 3 as the a13 and the 813 percentages, respectively, eg, the
ratios (x 100) of optical densities (570 nm) of the corresponding
peaks on scanning of the entire gels (3.5% to 17% exponential
gradient of acrylamide concentration) according to Fairbanks et
al.32The determination of the spectrin dimer percentage in crude
extract (4OC) and of the tetramer association constant (K& the
one- and two-dimensional maps of spectrin partial digests were
also performed with some modifications.*ID Quantification of
abnormal bands was done by scanning one-dimensional gels at 570
nm. This method proved to be highly accurate and reliable because
spectrin digestion was performed under strictly constant conditions. The aVI4l polymorphism, encoded by the newly identified,
low-expression-level aVl4'polymorphism, was quantitated as the
ratio of the aV 41-Kd band to all a- and p-chain peptides in
I .l
Flg 1. Blood smears. 1.1 and 11.1,1W% elliptoqtosir (withsome tendency to bud in 11.1). 1.2, anisocytosis and some elliptocytm (the latter were not related
to any detectable mutation). 11.2, moderate elllptocytosir. 11.3 (not shown) is the same as 11.2.
n .1
spectrin partial digests (one-dimensional maps)." Low (0.75 f 0.16
[n = 20]), intermediate (1.52 f 0.28 [n = 18]), and high values
(3.45 2 0.21 [n = 21) corresponded to the following diplotypes.
respectively: a/a, a/av14',and av/41/av/4'.'3 Western blots were
performed as reported,I9a following one- and two-dimensional
electrophoresis and using anti a1 domain polyclonal antibodies
prepared by ourselvesm or kindly provided by Drs J. Palek and J.
Lawler. Amino acid sequencing of the 33- and 36-Kd aI bands was
performed as previously described.I9 The numbering system is
based on the translated amino acid sequence of a-spectrin CDNA,~
which includes six additional amino acid residues compared with
previous reports that numbered residues from the first amino acid
of the a1 80-Kd domain? Statistical results were expressed as m f
standard deviation (SD). The r-test used m f 2SD.
cDNA sequencing. Reticulocyte RNA was prepared from peripheral blood as polysomal precipitates and extracted with phenolchloroform-isoamyl alcohol." Reverse transcription (RT) was
performed essentially according to Kawasaki3' and Frohman et
al,% with some modifications. Two micrograms of RNA was
incubated at 42°C for 45 minutes in a mixture (final volume: 20 kL)
containing 20 mmol1L Tris HCI (pH 8.4), 50 mmol/L KCI, 2.5
mmol/L MgC12.250 pmollL dNTF', 100 pmol hemmers serving as
primers. Fifty units of RNasin and 200 U of Moloney murine
leukemia virus reverse transcriptase (GIBCOBRL,Gaithersburg,
MD) were used.
To perform the polymerase chain reaction (PCR), the mixture
was brought to 100 p L so as to contain 20 mmollL Tris HCI (pH
8.4). 50 mmol/L KCI, 2.5 mmollL MgCI2,50 pmol/LdNTP, 0.01%
gelatin. Fifty picomoles of primers A and B (Table 2) and 2.5 U of
, 1.2
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
BAKLOUTl ET AL
2466
Table 2. Oligonucleotides Used as M m e n or ASOI
A
B
C
D
CA(GAATTCIGGTGAAGAGlTATGTGCTA*
CA(GAAlTC)ATGClTATGCTGCTGATGCt
TCCTTCAGATGCACCTCt
S'ga(gaattc)atcccaaagGTGAAGGAGT3'*
E
5'gc(gaattc)gataggtagagcaataaagg3't
F
5'l-lllTCATATCTGCTGGTG3't
Normal
anticodon 362
5'l-lllTCATACCXCTGGTG3't
Mutated
anticodon 362
G
C
=
Lower case letterscorrespondto intronic sequences. (10) In Parentheses, linker EcoRl site. D,capital letters represent the 5'-end of exon 8.
*Sense.
tAntisense.
Taq polymerase (Perkin Elmer Cetus, Nonvalk, CT) were added.
The mixture was submitted to 30 cycles of amplification: denaturation (92"C, 60 seconds), annealing (55°C. 30 seconds), and
extension (72OC, 60seconds). The first cycle started with a 5 minute
denaturation step. After the last cycle, the mixture was incubated
at 72°C for 5 minutes. PCR-amplified DNA fragments were
controlled using electrophoresis in 4% Nu sieve GTG agarose
(FMC Bioproducts, Rockland, ME) and ethidium bromide staining. Thereafter, another set of 30 cycles (same cycles as above) was
performed with a 100 to 1 excess of primer B with respect to primer
A so as to generate an excess of the antisense strand. Unincorporated PCR primers were removed using the Prep-A-gene-DNA
purification kit (Biorad, Richmond, CA). The single-strand PCR
product was sequenced3' using primer C (Table 2), according to
the Sequenase kit specifications.
Genomic DNA sequencing. A genomic DNA segment containing a-spectrin exon 8 was PCR-amplified using oligonucleotides D
and E (denaturation: 92"C, 60 seconds; annealing: 53T, 90-second
extension: 72"C, 90 seconds). The 215-bp amplified fragment
(proband) was cloned as EcoRI inserts in phage M13mpl8 as
described earlierz1and sequenced (see above).
Dof-b!ot analysis. PCR products were analyzed by dot blot
using allele specific oligonucleotides (ASO) F and G (Table 2).
The AS0 were radioactively labeledz1or labeled using dUTP-I 1digoxigenin and subsequently revealed as referred to elsewhere.%
RESULTS
Protein unulysk. Membrane protein SDS-PAGEwas
normal (not shown). No truncated achain could be detected. Spectrin a-chain tended to be decreased (Table l);
however, the reduction was significant ( < m - 2SD;
P < .01) only in 1.1 and 11.1. A limited increase of spectrin
dimers was noted in crude extracts (4°C) (Table 1) in all
carriers. The spectrin tetramer association constant was
more conspicuously altered, especially in 1.1 and 11.1 (Table
1). One-dimensional peptide maps showed two abnormal
bands of 36 and 33 Kd (Fig 2). The new bands developed at
the reciprocal expense of the a1 80- and 74-Kd bands. This
suggested that they derive from the a1 domain, hence the
designation of the variant.13 The two bands were
quantitated as the (36 + 33)/(80 + 78 + 74 + 36 + 33) percentage, eg, the (36 + 33)/aI percentage (Table 1).Both of
them were more conspicuous in 1.1 and 11.1 than in 11.2 and
11.3 (Table l), because of the presence of the aVI4l allele33
in trunr of the ~ ~ 1allele
%
in the two former persons
Fig 2. One-dimensionai peptide maps of d'm spectrln Sfax. The d
3&Kd and al 33-Kd fragments (designated by arrowheads) chamcterize spectrin Sfax. They are more pronounced in 1.1 and 11.1 (W than in
11.2 and 11.3 (D). The a"'" polymorphism (in the heterozygous state) is
indicated by an arrow in 1.1,1.2 and 11.1. C, control.
(intermediate amount of the aV 41-Kd fragment). In
11.3, the a'/% chains accounted
for -20% of total a-chains. In av/41/a1/36
individuals 1.1
chains accounted for -44% of total
and 11.1, the
a-chains.
Two-dimensional peptide maps (Fig 3) showed horizontal triplication of the 36-Kd spot (PI: 4.75 to 4.90) and
duplication of the 33-Kd spot (PI: 5.30 to 5.40), respectively.
These changes strikingly resembled the triplication of the
a1 50-Kd spot in a1150a
spectrin and the duplication of the a1
50-Kd spot in
spectrin.' The heterogeneity of p1 may
reflect alternative cleavages after arginyl and/or lysyl residues that would be close to one another. However, amino
acid sequencing of the 33- and 36-Kd bands following
one-dimensional electrophoresis indicated that the corresponding N-terminal regions are homogeneous (see below).
After one- and two-dimensional electrophoresis, tryptic
peptides of spectrin were transferred to Immobilon filters
(Millipore, Bedford, MA) and blotted with polyclonal
antibodies generated to aI-domain. In addition to the
expected (a1 80 - a1 78) and a1 74-Kd peptides, the 36-Kd
a/a11%
individuals 11.2 and
=89
-30
Fig 3. Two-dimensional peptide maps, and one- and two-dimensional immunobiots. 1.1 was investigated. Left, squares Indicate the
36- and 33-Kd spots. Right, the ai 36-Kd fragment(s), but not the d
33-Kd fragment(s), reactedwith anti-rd-domain polyclonal antibodies.
Under the conditions used, the al 78-Kd fragmentwas fused with its d
80-Kd parent fragment. In two-dimensional immunoblots, several al
domain additional spots developed; however, their precise locationin
the al domain was not identified.
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2467
SPLICE SITE ACTIVATION IN ELLIPTOCYTOSIS
Heteroduplexes
1 296 bp
-
\
269 bP
Flg 4. Electmphomtlc analyrls of cr.pschin mRNA RT-PCR product. Member 1.1 was investigated. Three major bands are evidenced:
lower band (269 nt); intennediay band (296 nt); higher bands (that
represent heteroduplexes of the precedingfragments).
peptide gave a positive reaction with antibodies prepared
by ourselves (not shown) or kindly provided by Drs J. Palek
and J. Lawler (St Elizabeth’s Hospital, Boston, MA) (Fig
3). On the other hand, the 33-Kd fragments failed to react
with any of the two antiserums used. Because the 36- and
33-Kd band intensities behaved in a parallel manner, we
considered that the 33-Kd fragment derived also from the
a1 domain. For some reason, this fragment would be poorly
immunogenic. Partial N-terminal amino acid sequencing
ascertained the a1 domain origin of the 36-Kd fragment
(see below). It also indicated that the N-terminal sequence
of the 33-Kd fragment is: E-WESS-P (amino acids 7 to 15
G
A
T
of spectrin a-chain; -: unidentified residues). The sum of
the molecular weights of both 36- and 33-Kd fragments did
not equal 80 Kd. This may arise from uncertainties in
molecular weight estimation after SDS-PAGE. On the
other hand, we cannot rule out that some peptide(s) was
(were) further degraded and disappeared. Because of
numerous bands in this region, Coomassie blue staining did
not show 27-Kd peptide that would be to the 33-Kd peptide
what the 74-Kd peptide is to the 80-Kd peptide.
Partial N-terminal amino acid sequencingof the a1 36-Kd
fragment showed that an abnormal cleavage, not normally
seen, occurred after Arg 356 (helix 3, repeat 4). A few
amino acids downstream, a nine-residue sequence was
missing. This sequence could correspond either to amino
acids 363 to 371 (YEKLQATYW) or those extending from
positions 364 to 372 (EKLQATYWY). Further studies
showed that the first possibility is correct (see below).
cDNA sequencing. After RT and the first set of PCR
cycles, DNA fragments were analyzed (Fig 4). Three bands
were visible. Sequencing, performed after a subsequent set
of asymetrical PCR (see Materials and Methods), showed
the following. The lower band (269 nt) disclosed a 27-nt
deletion that corresponded to one (YEKLQATYW) of the
two amino acid sequences considered above (Fig 5). Therefore, the lacking portion definitely represented the 3’
region of exon 8. The intermediary band (296 nt) had a
normal sequence (not shown). It is noteworthy that we
found no detectable amount of G at position 3 of codon 362
(see below). The upper band, that was duplicated, represented heteroduplexes between strands of the lower and
intermediary bands. The sequence of the upper band was
normal down to position 2 (included) of codon 362. Further, it became duplicated, combining the normal sequence
(3’ region of exon 8) and the sequence following the
deletion (5’ region of exon 9 ) (not shown). A Pst I site
encompassing codons 366 and 367 was abolished in the
intermediary band, but not in the upper or lower bands.
Genomic DNA sequencing. Genomic DNA of the
proband was PCR amplified into a 215-bp band (primers D
and E). Sequencing did not show the expected deletion
within exon 8. Instead, we noted the A to G substitution
(three clones out of five) at position 3 of codon 362
(AGA --* AGG) (Fig 5). Dot-blot hybridization experi-
C
A
J
A
A
T
B
C
7
g - e n t
Fig 5. DNA sequencing. 11.1
was Investigated. Left: cDNA; direct sequencing of the lower
band seen in Fig 4-0 27-ntdeletion Is visible. Right, sequencing
of exon 8 after cloning in phage
M13.
A
A
G
T
A
A
C
C
T
G
E-AA
C
C
G
G
A
C
A
]
362
AGA 4 AGG
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
BAKLOUTI ET AL
2468
I .1
n
.2
.1
.2
N
.3
:
M
Fig 6. Dot-blot analysh of PCR-amplifiedaxon 8. N, normal ASO:
M, mutated ASO. 1.1, 11.1, 11.2, and 11.3 carry the d's allele. The A S 0
were labeled with ll-digoxlgenln dUTP.
ments supported the view of the association of this change
to ailx spectrin (Fig 6). The point mutation generates the
following sequence surroundingcodon 362 CAGGUAUGA
(in the mRNA), which is close to the 5'-splice site consensus sequence; 5&G/gu;aguP9 The A + G change creates
the highly invariant dinucleotide/gu. We inferred that it
resulted most likely in the activation of a cryptic 5'-splice
site at codon 362 and in the splicing out of the downstream
sequence of exon 8.
The mRNA deletion preserved the reading frame downstream as nt 1 of exon 9 became nt 3 of new codon 362.
Furthermore, the latter still encoded Arg (AGA + AGG).
Figure 7 summarizes the mechanism by which the 9 amino
acid deletion would stem from the point mutation.
Dot-blot analysis of total RT-PCR product using radioactively labeled oligonucleotide G failed to show any substantial amount of a cDNA species that would carry the A + G
substitution seen at the gene level, but would have escaped
abnormal splicing (not shown).
DISCUSSION
Elliptocytogenic mutations of the a1 domain have been
found previously in repeats 1, 2, 3, and 5, respectively. To
our knowledge, al'% spectrin Sfax is the first a-chain
elliptocytogenicvariant to be recognized in repeat a4. As
with most variants, the present one involves a helix 3,
refemng to the model of Speicher and Marchesi.7 The
small but significant reduction of spectrin a-chain in 1.1 and
11.1 has an uncertain meaning. Under our experimental
conditions, we observed a comparable decrease in other
&MA
ACC KG
TAT O M
Intron 0
Exon 9
371
362 363
A M Cn; C f f i
CCT A C T TAT E-6
TAC CAT
HE cases (reference 15, and manuscript in preparation).
Given the molecular weights and the pl of the abnormal
fragments, spectrin Sfax is different from the variant
described by Lambert and ZaiL4)The present family is one
in which the clinical, morphological, and biochemical manifestations of HE, associated with an a-spectrin variant, are
enhanced by the presence, in trans, of the low expression
level aVl4'allele?3 Concerning dimer self-association,spectrin Sfax resembles
spectrin.4' On the other hand, the
percentages of spectrin Sfax (approximately 20% and 44%,
depending on the absence or the presence of the aVl4'
polymorphism in trans, respectively) were lower than those
of
spectrin under the same conditions (44% and 62%,
respectively)!'
The 9 amino acid deletion was accounted for by a 27-nt
deletion in a-spectrin cDNA. This deletion corresponds to
the 3' region of exon 8. Sequencing of genomic DNA
disclosed, instead of the deletion, a silent single substitution
within codon 362. The latter was assumed to be responsible
for the activation of a surrounding cryptic 5'-splice site, on
the basis of the following. (1) It has been demonstrated that
the consensus sequence is complementaryto the 5' first 9 nt
of U1 small nuclear RNA (snRNA) and that base pairing of
these two RNAs is required for pre-mRNA splicing:* the
most invariant positions being the nearly universal GU
dinucleotide at the cleavage site and the guanosine at
position +5?9 Spectrin Sfax mutation precisely generates
the GU dinucleotide within the new 5'-splice site. (2) It is
known that mutations which increase the complementarity
of a site to U1 snRNA lead to a corresponding increase in
the activity of the site for ~plicing,4~-"the splice site
selection becoming a spliceosome competition process."
(3) The authentic 5'-splice site at the exon 8-intron 8
boundary in the a-spectrin gene displays a poor homology
with the consensus sequence as it deviates at four positions,
whereas the vast majority of natural 5'-splice sites deviate
at two or three positions, if any?9*45.46
On the other hand,
the cryptic site at the mutated codon 362 deviates only at
two positions.
Remarkably, the abnormally spliced mRNA generates a
sufficient amount of a pathological, yet viable, protein
product. We were unable to evidence any mRNA carrying
no deletion, but having G instead of A at position 3 of
codon 362. We infer that splicing takes place with a high
efficiency at the activated site so that the latter competes
favorablywith the normal site.
In this report, we have described ailM spectrin Sfax. The
molecular lesion is the deletion of amino acids 362 to 371. It
stems from the activation of a 5'-splice site, due to the A to
G substitution in position 3 of codon 362 of spectrin a-chain
cDNA.
ACKNOWLEDGMENT
Fig7. Schemdc mpresentatlonofthe a h r e d splklng of exon 8 In
spectrln Sfax. Underlined (full line) sequence, normally used 5'-splice
site. Underlined (dotted line) sequence, cryptic 5'-splice site. 1, base
substitution.
We thank family BY for their kind cooperation, Drs J. Palek and
J. Lawler for their generous gift of an antial domain antiserum,
Drs A. and H. Hafsia for their help, Dr F. MorIC for critical advice,
and C. Aragon for preparing the manuscript.
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2469
SPLICE SITE ACTIVATION IN ELLIPTOCYTOSIS
REFERENCES
1. Marchesi SL: The erythrocyte cytoskeleton in hereditary
elliptocytosis and spherocytosis, in Agre P, Parker JC (eds): Red
Blood Cell Membranes. New York, NY,Dekker, 1988, p 77
2. Delaunay J, Alloisio N, Mor16 L, Pothier B: The red cell
skeleton and its genetic disorders. Mol Aspects Med 11:161,1990
3. Palek J, Lambert S: Genetics of the red cell membrane
skeleton. Semin Hematol27:290,1990
4. Gallagher PG, Tse WT, Forget BG: Clinical and molecular
aspects of disorders of the erythrocyte membrane skeleton. Semin
Perinatol14:351,1990
5. Speicher DW, Morrow JS, Knowles WJ, Marchesi VT: A
structural model of human erythrocyte spectrin: Alignment of
chemical and functional domains. J Biol Chem 2579093,1982
6. Speicher DW, Davies G, Marchesi VT: Structure of human
erythrocyte spectrin. 11. The sequence of the a1 domain. J Biol
Chem 258:14938,1983
7. Speicher DW, Marchesi V T Erythrocyte spectrin is comprised of many homologous triple helical segments. Nature 311:
177,1984
8. Sahr KE, Laurilla P, Kotula L, Scarpa AL, Coupal E, Leto
TL, Linnenbach AJ, Winkelmann JC, Speicher DW, Marchesi VT,
Curtis PJ, Forget BG: The complete cDNA and polypeptide
sequences of human erythroid a-spectrin. J Biol Chem 2654434,
1990
9. Winkelmann JC, Chang JG, Tse WT, Scarpa AL, Marchesi
VT, Forget BG: Full length sequence of the cDNA for human
erythroid P-spectrin. J Biol Chem 265:11827,1990
10. Sahr KE, Tobe T, Scarpa A, Laughinghouse K, Marchesi SL,
Agre P, Linnenbach AJ, Marchesi VT, Forget B: Sequence and
exon-intron organization of the DNA encoding the a1 domain of
human spectrin. Application to the study of mutations causing
hereditary elliptocytosis. J Clin Invest 84:1243,1989
11. Kotula L, Laury-Kleintrop LD, Showe L, Sahr K, Linnenbach AJ, Forget B, Curtis PJ: The exon-intron organization of the
human erythrocyte a-spectrin gene. Genomics 9:131,1991
12. Tse WT, Lecomte MC, Costa FF, Garbarz M, Feo C, Boivin
P, Dhermy D, Forget BG: Point mutation in the p-spectrin gene
associated with aI/74 hereditary elliptocytosis. Implications for the
mechanism of spectrin dimer self-association. J Clin Invest 86:909,
1990
13. Palek J, Lux S: Red cell membrane skeletal defects in
hereditary and acquired hemolytic anemias. Semin Hematol 20:
189,1983
14. Garbarz M, Lecomte MC, Fbo C, Devaux I, Picat C,
Lefebvre C, Galibert F, Gautero H, Bournier 0, Galand C, Forget
BG, Boivin P, Dhermy D: Hereditary pyropoikilocytosis and
elliptocytosis in a white French family with
variant related
to a CGT to CAT codon change (Arg to His) at position 22 of the
spectrin a1 domain. Blood 751691, 1990
15. Baklouti F, MarCchal J, Mor16 L, Alloisio N, Wilmotte R,
Pothier B, Ducluzeau MT, Kastally R, Delaunay J: Occurrence of
the a1 22 Arg His (CGT CAT) spectrin mutation in Tunisia:
Potential association with severe ellipto-poikilocytosis.Br J Haemato1 78:108, 1991
16. Coetzer TL, Sahr K, Prchal J, Blacklock H, Peterson L,
Koler R, Doyle J, Manaster J, Palek J: Four different mutations in
codon 28 of a spectrin are associated with structurally and
functionally abnormal spectrin aI/74 in hereditary elliptocytosis. J
Clin Invest 88:743,1991
17. Floyd BP, Gallagher PG, Valentino LA, Davis M, Marchesi
SL, Forget BG: Heterogeneity in the molecular basis of hereditary
pyropoikilocytosis associated with increased levels of the spectrin
aI/74-kilodalton tryptic peptide. Blood 78:1364,1991
-
18. Mor16 L, Alloisio N, Ducluzeau MT, Pothier B, Blibech R,
Kastally R, Delaunay J: Spectrin Tunis (a1i78):
A new a1 variant
that causes asymptomatic hereditary elliptocytosis in the heterozygous state. Blood 71:508,1988
19. Mor16 L, Mor16 F, Row AF, Godet J, Forget BG, Denoroy
L, Garbarz M, Dhermy D, Kastally R, Delaunay J: Spectrin Tunis
(S~a’/~8),
an elliptocytogenic variant, is due to the CGG + TGG
codon change (Arg + Trp) at position 35 of the a1 domain. Blood
742328,1989
20. Lecomte MC, Garbarz M, Grandchamp B, FCo C, Gautero
H, Devaux I, Bournier 0, Galand C, d’Auriol L, Galibert F, Sahr
KE, Forget BG, Boivin P, Dhermy D:
A mutation of the a1
spectrin domain in a white kindred with H E and HPP phenotypes.
Blood 74:1126,1989
21. MorlC L, Row AF, Alloisio N, Pothier B, Starck J, Denoroy
L, Mor16 F, Rudigoz RC, Forget BG, Delaunay J, Godet J: Two
elliptocytogenic a1/74
variants of the spectrin a1 domain. Spectrin
Culoz (GGT- GTT; a1 40 Gly+Val) and spectrin Lyon
(CM -+ TTT; a1 43 Leu --* Phe). J Clin Invest 86548,1990
22. Marchesi SL, Letsinger JT, Speicher DW, Marchesi VT,
Agre P, Hyun B, Gulati G: Mutant forms of spectrin a-subunits in
hereditary elliptocytosis. J Clin Invest 80:191,1987
23. R o w AF, Mor16 F, Guetarni D, Colonna P, Sahr K, Forget
hereditary
BG, Delaunay J, Godet J: Molecular basis of Sp a1/65
elliptocytosis in North Africa: Insertion of a ‘ITG triplet between
codons 147 and 149 in the a-spectrin gene from five unrelated
families. Blood 73:2196,1989
24. Gallagher PG, Tse WT, Coetzer T, Lawler J, Zarkowsky HS,
Lecomte MC, Dhermy D, Baruchel A, Marchesi SL, Garbarz M,
Palek J, Forget BG: A common mutation in aI/46-50a kD
hereditary elliptocytosis (HE) and hereditary pyropoikilocytosis
(HPP) distant from the associated spectrin proteolytic cleavage
site. Blood 76:7a, 1990 (abstr, suppl)
25. Garbarz M, Tse WT, Gallagher PG, Picat C, Lecomte MC,
Galibert F, Dhermy D, Forget BG: Spectrin Rouen (P220-218),a
novel shortened P-chain variant in a kindred with hereditary
elliptocytosis. 11. Characterization of the molecular defect as exon
skipping due to a splice site mutation. J Clin Invest 88:76,1991
26. Tse WT, Gallagher PG, Pothier B, Costa FF, Scarpa A,
Delaunay J, Forget BG: An insertional frameshift mutation of the
P-spectrin gene associated with elliptocytosis in spectrin Nice
(P220/216).Blood 78:517, 1991
27. Yoon SH, Yu H, Eber S, Prchal J T Molecular defect of
truncated P-spectrin associated with hereditary elliptocytosis.
P-Spectrin Gottingen. J Biol Chem 26623490,1991
28. Gallagher PG, Tse WT, Costa F, Scarpa A, Boivin P,
Delaunay J, Forget BG: A splice site mutation of the P-spectrin
gene causing exon skipping in hereditary elliptocytosis associated
with a truncated p-spectrin chain. J Biol Chem 266:15154,1991
29. Alloisio N, Mode L, Pothier B, Roux AF, Martchal J,
Ducluzeau MT, Benhadji-Zouaoui Z, Delaunay J: Spectrin Oran
( ( I I I / ~ ~ ) , a new spectrin variant concerning the a11 domain and
causing severe elliptocytosis in the homozygous state. Blood
71:1039,1988
30. Pothier B, Alloisio N, MarCchal J, Mor16 L, Ducluzeau MT,
Caldani C, Philippe N, Delaunay J: Assignment of
hereditary elliptocytosis to the a- or the P-chain of spectrin through in
vitro dimer reconstitution. Blood 75:2061, 1990
31. Laemmli U K Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227:680,1970
32. Fairbanks G, Steck TL, Wallach DFH: Electrophoretic
analysis of the major polypeptides of the human erythrocyte
membrane. Biochemistry 10:2606,1971
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2470
33. Alloisio N, Mor16 L, MarCchal J, Roux AF, Ducluzeau MT,
Guetarni D, Pothier B, Baklouti F, Ghanem A, Kastally R,
Delaunay J: S P ~ ~ ’ ~
A ’ common
:
spectrin polymorphism at the
aIV-aV domain junction. Relevance to the expression level of
hereditary elliptocytosis due to a-spectrin variants located in trans.
J Clin Invest 87:2169,1991
34. Kan YW, Holand JP, Dozy AM, Varmus H Demonstration
of non-functional Po-thalassemia. Proc Natl Acad Sci USA 72:5140,
1974
35. Kawasaki ES: Sample preparation from blood, cells, and
other fluids, in Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds):
PCR Protocols. A Guide to Methods and Applications. San Diego,
CA, Academic, 1990, p 21
36. Frohman MA, Dush MK, Martin GR: Rapid production of
full-length cDNAs from rare transcripts: Amplification using a
single gene-specific oligonucleotide primer. Proc Natl Acad Sci
USA 8523998,1988
37. Sanger F, Nicklen S, Coulson AR: DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463,
1977
38. Miraglia del Giudice E, Ducluzeau MT, Alloisio N, Wilmotte R, Delaunay J, Perrotta S, Cutillo S, Iolascon A
Hereditary elliptocytosis in Southern Italy. Evidence for an African
origin. Hum Genet (in press)
BAKLOUTI ET AL
39. Mount SM: A catalogue of splice junction sequences. Nucleic Acids Res 10459,1982
40. Lambert S, Zail S: A new variant of the a subunit of spectrin
in hereditary elliptocytosis. Blood 69:473, 1987
41. Alloisio N, Guetarni D, Mor16 L, Pothier B, Ducluzeau MT,
Soun A, Colonna P, Clerc M, Philippe N, Delaunay J:
hereditary elliptocytosis in North Africa. Am J Hematol 23:113,
1986
42. Zhuang Y, Weiner AM: Compensatory base change in U1
snRNA suppresses a 5’ splice site mutation. Cell 46:827,1986
43. Aebi M, Hornig H, Weissmann C: 5’ Cleavage site in
eukaryotic pre-mRNA splicing is determined by the overall 5’
splice region, not by the conserved 5’GU. Cell 50:237,1987
44. Nelson KK, Green MR: Mechanism for cryptic splice site
activation during pre-mRNA splicing. Proc Natl Acad Sci USA
87:6253,1990
45. Ohshima Y, Gotoh Y: Signals for the selection of a splice
site in pre-mRNA. Computer analysis of splice junction sequences
and like sequences. J Mol Biol195:247,1987
46. Shapiro MB, Senapathy P: RNA splice junctions of different
classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res 15:7155, 1987
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
1992 79: 2464-2470
Elliptocytogenic alpha I/36 spectrin Sfax lacks nine amino acids in
helix 3 of repeat 4. Evidence for the activation of a cryptic 5'-splice site
in exon 8 of spectrin alpha-gene
F Baklouti, J Marechal, R Wilmotte, N Alloisio, L Morle, MT Ducluzeau, L Denoroy, A Mrad, MH
Ben Aribia and R Kastally
Updated information and services can be found at:
http://www.bloodjournal.org/content/79/9/2464.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.