1. Healthcare

From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
The Factor V B-Domain Provides Two Functions to Facilitate Thrombin
Cleavage and Release of the Light Chain
By Kimberly A. Marquette, Debra D. Pittman, and Randal J. Kaufman
Blood coagulation factors V and Vlll are homologous proteins thathave the domain organization Al-A2-B-A3-Cl-C2.
Upon thrombin activation, the B-domains of both molecules
are released. Previous studies on factor Vlll showed that the
B-domain was not required for thrombincleavage or activity.
In contrast, deletion of thefactor V B-domain (residues 709
t o 1545) yielded a molecule with sevenfold reduced procoagulant activity thatwas not cleaved by thrombin. However,
this factor V B-domain deletion molecule was activated by
factor Xa, although the fold-activation was 85% that of wildtype factor V. Thrombin cleavage of factor V occurs initially
after residue 709 and subsequently after residues 1018 and
1545. The requirement for thrombincleavage within the Bdomain at residue 1018 was evaluated by mutagenesis of
ArglOl8 to Ile. In the resultant R10181 mutant, the rate of
thrombin activation andappearance of maximal cofactor activity was delayed and wasconsistent with delayed cleavage
of the light chain at residue 1545. In contrast, the rate of
factor Xa activation in the R10181 mutant was not altered.
This finding suggests that thrombin cleavage at 1018 facilitates subsequent thrombin cleavage at 1545. Further mutagenesis was used t o study the requirement for sequences
within the factor V B-domain for thrombin cleavage at resi-
due 1545. Whereas the factor V deletion molecule removing
residues 709 t o 1545 was not cleaved by thrombin, a smaller
B-domain deletion molecule (residues 709 t o 1476) containing an acidic amino acid-rich region (residues 1490 t o
1520) was effectively cleaved by thrombin. These results
show that residues 1476 t o 1545, which contain an acidic
amino acid-rich region, were requiredfor thrombincleavage
of the light chain. Introduction of an acidic amino acid-rich
region from factor Vlll (residues 337 t o 372) into the factor
V 709 t o 1545 deletion also restored thrombin cleavage of
the light chain. In contrast, similar replacement with the
acidic region from thefactor Vlll light chain (residues 1649 t o
1689) was significantlyless effective in promoting thrombin
cleavage of the light chain. This finding suggests that the
different acidic regions in factors V and Vlll are not functionally equivalent in their interactionwith thrombin. The results
show that the factor V B-domain provides two functions
for thrombin activation that are not required for factor Xa
thrombin cleavage at 1018 potentiates cleavactivation: (l)
age at 1545 and (2) residues 1476 t o 1545 facilitate cleavage
at 1545, possibly through an acidic region by interacting with
an anion-binding exosite on thrombin.
0 1995 b y The American Society of Hematology.
B
homologous to phospholipid binding proteins such as milk
fat globule protein, suggesting a role in phospholipid interaction.KWhereas the A and C domains are 40% identical between factors V and VIII, there is only limited homology
between the B domains.’ However, both B-domains do contain a large number of asparagine-linked oligosaccharides.
Within the genome, the factor VI11 and factor V B-domains
reside on unusually large single exons,’o3”suggesting that
the B-domains evolved from a single exon and may function
in similar roles in regulating the expression and/or activity
of factors V and VIII.
The mechanisms that regulate facator V activation and
inactivation are presently being intensely investigated because of the high prevalence of a single amino acid substitution in factor V (R506Q) that renders it resistant to inactivation by activated protein C and is a primary predisposing
cause of hereditary thrombo~is.l~-’~
Both factor V and factor
VI11 require proteolytic cleavage to elicit full procoagulant
activity. Plasma factor V is a single-chain polypeptide of
330 kDl5.Ihthat is cleaved by thrombin first after arginine
709 and then after arginine 1018 and 1545, generating the
activated heterodimer consisting of the 94-kD (also referred
to as a 105-kD polypeptide”) heavy chain fragment and
the 74-kD light chain fragment.’8-22
Factor VI11 circulates in
plasma as a heterodimer comprised primarily of a 200-kD
heavy chain (residues 1 to 1313) in a metal-ion association
with an 80-kD light chain (residues 1649 to2332). Thrombin
activation of factor VI11 results in cleavage initially after
residues 740 and 1689 and subsequently after residue 372.23
Thrombin-activated factor VI11 consists of a heterotrimer of
a 50-kD Al-domain derived polypeptide, a 43-kD A2-domain derived polypeptide, and a 73-kD-derived light chain
fragme~~t.’~-’~
Upon thrombin activation, the B-domains of both factors
LOOD COAGULATION is controlled by the regulated
activation of serine proteases in the coagulation cascade. Factor VI11 and factor V are homologous glycoproteins
that function as essential cofactors for proteolytic activation
of factor X and prothrombin, respectively. Both proteins
circulate in plasma as inactive precursors that are activated
through limited proteolysis by either thrombin or activated
factor X (Xa). After activation, factor VIIIa and factor Va
assemble with their respective substrates (factor X and prothrombin) and enzymes (factor IXa and factor Xa) on a
negatively charged phospholipid surface in the presence of
calcium ions.’,’ Both cofactors act to increase the Vmax of
substrate activation by four orders of magnitude. Elucidation
of the primary structure of factors V ” , 4 and VIIIs.6 showed
that they share amino acid identity and have a conserved
domain organization of Al-A2-B-A3-Cl-C2.The A domains of factors V and VI11 are homologous to the A domains of ceruloplasmin: a copper-binding plasma protein,
suggesting a role in metal-ion binding. The C domains are
From the Genetics Institute, Cambridge, MA; and the Howard
Hughes Medical Institute, Department of Biological Chemistry, University of Michigan Medical Center, Ann Arbor, MI.
Submitted September 21, 1994; accepted June 21, 1995.
Supported in part by National Institutes of Health Grants NO.
HL.52173 and HL5377 (to R.J.K.).
Address reprint requests to Randal J. Kaufman, PhD, Howard
Hughes Medical Institute, Department of Biological Chemistry, University of Michigan Medical Center, Ann Arbor, MI 48105.
The publication costsof this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
OOO6-4971/95/8608-0031$3.00/0
3026
Blood, Vol 86,No 8 (October 15). 1995: pp 3026-3034
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
ROLE OF FACTOR V B-DOMAIN IN THROMBIN CLEAVAGE
V and VI11 are released. Except for thefactor V 1018 thrombin cleavage site, the amino-terminal sides of all the thrombin cleavage sites within factors V and VIII are rich in acidic
amino acids and contain the posttranslationally modified
amino acid, tyrosine sulfate. Previous studies have examined
the functional role of the B-domain by generating B-domain
deletion molecules. Studies with factor VI11 B-domain deletion molecules have shown that the proteins are functional
in in vitro coagulation assay^,^"^^ are expressed more efficiently due to an increased secretion effi~iency:'.~' and can
correct the cuticle bleeding time upon infusion into a hemophilic dog.3' Deletion of the entire factor VI11 B-domain
extending from the thrombin cleavage site at residue 740 to
the thrombin cleavage site at residue 1689 generates a molecule with a specific activity similar to wild-type factor VIII.32
In contrast to factor VIII, deletion of the factor V B-domain
influences cofactor function. Whereas residues 81 1-1441
within the B-domain were dispensible for factor V activity
in
further deletion of residues between the thrombin
cleavage sites at 709 and 1545 yielded a molecule with
reduced procoagulant activity that was resistant to thrombin
activation and cleavage.MHowever, the 709 to 1545 deletion
molecule was cleaved and activated by factor Xa.34In the
studies described here, we examined the amino acids within
the B-domain that are required for factor V cleavage by
thrombin. The results show that both the acidic amino acidrich region upstream from residue 1545 and a thrombin
cleavage site at residue 1018 facilitate cleavage at 1545 to
liberate the factor V light chain.
MATERIALS AND METHODS
Materials. Rabbit antifactor V polyclonal antibody was purchased from Dako Corp (Carpinteria, CA). Factor V-deficient plasma
and normal pooled human plasma were obtained from George B.
King Biomedical Inc (Overland Park, KS). Thromboplastin, soybean
trypsin inhibitor, phenylmethylsulfonyl fluoride, and aprotinin were
purchased from Sigma Corp (St Louis, MO). Factor V monoclonal
antibody (MoAb) HFV-9 (E-9) directed against the factor V light
chain," human a-thrombin, and human factor Xa were obtained
from Hematological Technology (Burlington, VT). [35S]-methionine
(>1,OOO Wmmol) was obtained from Amersham Corp (Arlington
Heights, IL).
Derivation of the factor V expression vector and mutagenesis.
The full-length factor V cDNA contained on a Sal I fragment was
cloned into the Sal I site of the expression vector pMT235 and was
designated pMT2-V. Oligonucleotide site-directed mutagenesis was
performed by the heteroduplex proced~re'~
to change the arginine
at residue 1018 to an isoleucine using the following mutagenic
oligonucleotide: 5'-CACCATGCTCCTTTATCTCCGATCACClTTCACCCTCTAAGAAG-3'. The R10181 mutant was made by oligonucleotide-directed gapped-heteroduplex mutagenesis in pBluV
(Bluescript V"). The Sal VEstEII fragment from pBluRlOl8I was
used in a triple ligation with the Est IVHpa I fragment from pMT2and the Hpa VSalI fragment from pMTZ21.The resultant mutant
factor V expression plasmid was designated pR1018I.
Site-directed oligonucleotide-mediated mutagenesis was performed by the heteroduplex procedure to introduce unique Mlu I
restriction sites at proteolytic cleavage sites at residues 709 and 1545
within the factor V cDNA in pMT2-V. Mlu I encodes the amino
acids Thr-Arg of which the Arg is in the P1 position with respect
to the thrombin cleavage site. The unique Mlu I sites facilitate
insertion of different acidic regions. The oligonucleotides used for
3027
mutagenesis were as follows: factor V (residue with mutagenic oligonucleotide in italics), 709 5'-GGCTGCAGCATTAGGAACGCGTTCAlTCCGAAACTCATCATTG-3'; 1545 5"CAlTGCAGCATGGTACACGCGTAGCAACAATGGAAACAGAAG-3'.The factor
V B-domain deletion molecule was constructed by MZu I restriction
endonuclease digestion and ligation to delete residues 710 to 1545
and was designated pVw4.
Polymerase chain reaction (PCR) was used to isolate a DNA
fragment encoding the acidic region upstream of the factor V 74kD cleavage site that had introduced Mlu I restriction sites at amino
acid residues 1476 to 1477 and 1544 to 1545. The 5' oligonucleotide
(CTTTTCTAACGCGTGAATAATCC; nucleotides 4592 to
4616) changes the serine at 1476 to threonine and lysine 1477 to an
arginine. The 3' oligonucleotide (G'ITTCCATTGTTGCTACGCGTGTACCATGC; nucleotides 4795 to 4824) changes the leucine at
1544 to threonine. The reaction contained 100 pm01 of each primer,
50 ng of template, 2 U Vent polymerase (Promega Corp, Madison,
W)and was performed for 25 cycles. The PCR product was digested
with MZu I and the 204-bp restriction fragment was isolated by
electrophoresis on a 1% low melt agarose gel. The DNA fragment
was extracted and ligated to Mlu I-digested pVw4. The resultant
factor V expression plasmid with amino acid residues 710 to 1476
deleted was designated pV709.1476.
The three acidic amino acid-rich regions in factor VIII were amplified with specific primers to introduce Mlu I sites flanking residues
336 to 372, 700 to 740, and 1648 to 1689. Amplified DNA was
digested with MZu I and the fragments were isolated by agarose gel
electrophoresis. The DNA fragments were ligated to Mlu I-digested
pVW4 to derive the following plasmids: pVw4+336-372, pVg4
,,+700-740, and pVw4+1648-1689. All mutations were confirmed
by DNA sequencing17 and extensive mapping with restriction enzymes.
DNA transfection andanalysis. Plasmid DNA was transfected
into COS-l cells using the diethyl aminoethyl-dextran pr0cedure.3~
Conditioned medium was harvested 60 hours after transfection in
the presence of 10% heat-inactivated fetal bovine serum for factor
V assay. Protein secretion was monitored at 60 hours after transfection by metabolically labeling cells with [35S]-methionine(167 pCi/
mL for 2 hours) and then chase was performed for 4 hours in medium
containing excess unlabeled methionine as described?6 Factor V was
immunoprecipitated with either MoAb HFV-9 specific to the factor
V light chain" or a rabbit polyclonal antibody coupled to Affigel
(BioRad, Richmond, CA). The immunoprecipitates were washed
as de~cribed.~'
Immunoprecipitated proteins from the conditioned
medium were resuspended in 50 mmol/LTris-HC1,pH7.5,
150
mmol/L NaCI, 2.5 mmol/L CaCl2, and 5% glycerol (buffer A) and
subjected to digestion with increasing amounts of thrombin (60 minutes at 37°C) before electrophoresis on an sodium dodecyl sulfate
(SDS)-low bis-8% polyacrylamide
Proteins were visualized
by autoradiography after fluorography by treatment with En'Hance
(Dupont-New England Nuclear Corp. Boston, MA).
The thrombin cleavage of factor V was evaluated by diluting
conditioned medium into 20 mmoK imidazole, pH 7.4, 0.15 mol/
L NaCI, and 5% glycerol and adding thrombin (1 U/mL) at room
temperature (RT) for increasing periods of time. &Mercaptoethanol
(2.5%) and SDS (1%) were added and the samples were analyzed
by SDS-polyacIylamide gel electrophoresis (SDS-PAGE) and immunoblotting using either rabbit polyclonal anti-factor V antibody with
a donkey antirabbit antibody coupled to horseradish peroxidase for
detection or MoAb HFV-9 with sheep antimouse IgG coupled to
horseradish peroxidase for detection. The polypeptides reacting with
the antibody complex were detected by the enhanced chemiluminescence (ECL) method (Amersham Corp).
Factor V activityassay. Factor V activity was measured in a
factor V clotting assay using factor V-deficient plasma." Standard
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
3028
Table 1. Functional Activity of Wild-Type, B-Domain Deletion, and
Factor Vlll Acidic Region Insertion Molecules
MARQUETTE, PITTMAN. AND KAUFMAN
thrombin cleavage of wild-type factor V, theB-domain deletion mutant V94174,and the mutant R10181 were compared
after transfection of respective expression vectors into c o s Fold Activation
Basal
1 cells. The secretion of factor V protein into theconditioned
Mutant
(mU/mL)
Ita
Xa
medium wasmonitored by metabolically labeling transfected
WtV
(55)*
215
4.2 (0.22)
4.4 (0.69) cells with [75S]-methionine and analyzing the secreted prov9474
73 (32)"
1.1 (0.11)
3.8 (0.32) tein by immunoprecipitation with a factor V-specific anti57 (12)
1.9 (0.16)
v709-1478
4.1 (0.6)
body. Wild-type factor V was detected in the conditioned
V97pd i
336-372
3.4t
235 (40)
1.5 (0.04)
medium predominantly as a single-chain polypeptide of 330
Vswr + 700-740
2.9t
76 (30)
1.3 (0.14)
kD
(Fig1,lane
l). Incubationoftheimmunoprecipitated
V94
,
+ 1648-1689
2.8t
222 (60)
1.3 (0.1)
protein with increasing amounts
of thrombin before reducing
Plasmid DNA was transfected into COS-l cells and, after 40 hours,
SDS-PAGE generated the light chain of 74 k D , a heterogecells were fed fresh complete medium. After 20 hours, conditioned
neous 94-kD heavy-chain-derived fragment, and a 150-kD
media samples were collected for factor V activity assay. The basal
fragment derived from the B-domain representing residues
activities and fold activationsare the results averaged from either six
1019to1545
(Fig 1, lanes 2 through S ) . The71-kD Bor four (*) independent transfection experiments.The fold activation
domain fragment (residues 710 to 1018) is not detected due
by thrombin (Ila) and factor Xa was determined a s in Materials and
Methods and are the average of four independent experiments. The
to the low methionine content (3 methionine residues comstandard deviations are given in parentheses.
pared with 16 in the 74-kD light chain) and sizeheterogenet These factor Xa values represent one transfection experiment.
ity due to extensive N-linked glycosylation. The B-domain
migrated as a single chain at 140
deletion molecule V94174
kD (Fig 1, lane 6). Upon treatment of the V94n4immunoprecurveswereprepared by dilution of poolednormalplasmain
20
cipitate withincreasing amounts of thrombin, there wasminmmoVL imidazole, pH 7.4, and 0.15 moVLNaCl (buffer B). Total
imal cleavage to yield the heavy chain and light chain polyfactor V was determined by measuring the peak activity after treatpeptides characteristic of wild-type factor V (Fig 1, lanes 7
ment with thrombin. Factor V conditioned medium was incubated
through IO). At 100 U/mL thrombin, there were still signifiat RT with 1 U/nL thrombin. At timed intervals,aliquotswere
cant amounts of uncleaved V94/74(Fig 1, lane10).
The
removed and assayed. The fold activationwas determined by dividR10181 mutant was expressed andsecreted at a level similar
ing the thrombin-activated activityby the nonactivated activity. One
to that of wild-type factor V (Fig 1, lane 11). The R10181
unitof factor V is that amount in 1 mL of normal pooled human
mutant was partially cleaved by 10 U/mL thrombin and complasma before activation with thrombin. Factor Xa activation was
SO U/mL thrombin (Fig 1, lanes 12
pletelydigestedat
performed by incubation with 1 p g h L factor Xa atRT in 20 mmol/L
through 15). This result shows that the R10181 mutant can
imidazole,pH 7.4, and 0.15 mol/L NaCl containing the phospholipid
inosithin at 100 pg/mL and assayed at timed intervals.
be cleaved to generate 94- and 74-kD
polypeptides, although
less efficiently than wild-type factor V. The appearance of
RESULTS
a polypeptide migrating just above the 150-kDpolypeptide
from the wild-type factorV B domain suggests that an alterCleavage at1018 within the factor V B-domain facilitates
nate cleavage around residue1018 occurred underthese conthrombin activation and cleavage to release the light chain.
ditions of excess thrombindigestion. The comparison beTo study the functional significance of the factor V B-dotweenwild-type and R10181 mutant factor V wasmore
main, a deletion molecule was constructed that had deleted
closely evaluated by measuring the time courseof thrombin
residues fromthe thrombin cleavage siteat 709 to thethrombin cleavage site at residue 1545 and was designated V94174. activation of procoagulant activity and Western immunoblot
analysis. Conditioned medium was prepared and assayed for
Transfection of COS-l monkey cells with VWn4yielded a
clotting activity before and after the addition of thrombin or
secreted molecule that had
a sevenfold reduced specific acivfactor Xa. Before the addition of thrombin or factor Xa, the
ity compared with wild-type factor V. The specific activity
amount of factor V procoagulant activity in the conditioned
of COS-l cell-derived wild-type factor V was 410 U/mg, as
medium from cells transfected with the B-domain deletion
determined from the peakof cofactor activity after thrombin
molecule V94/74wasreduced by approximately 50% comactivation measured in a clotting assay using factor V-defipared with conditioned medium from cells transfected with
cient plasma and Western blot analysis to quantitate factor
either wild-type or the R10181 mutant (Fig 2). The addition
V antigen using a dilution series of purified human plasmaof thrombin towild-type factor V increased the activity more
derived factor V as a standard. The V94n4deletion molecule
than fourfoldto800mU/mL,whereasthe
activity of the
was not activatable by thrombin, but was
effectively actideletion
mutant
V94n4
was
only
slightly
increased.
Although
vated by factor Xa (Table
l).34
To study the structural
properwild-type factor V was maximally activated after 1 minute
ties of the B-domain that are required for thrombin cleavage
1.5
uponthrombintreatment,theR10181mutantrequired
and activation of factor V, we evaluated the role
of cleavage
minutes to reach peak thrombin activation (Fig 2A). In conat residue 1018 within the B-domain and the role
of the
trast, there was no detectable difference in the kinetics of
acidic amino acid-rich region on the NH,-terminal side of
factor Xa activation between the wild-type and R10181 muthe thrombin cleavage site at residue 1545.
tant (Fig 2B). Aliquots of thrombin-treated conditioned meThe role of thrombin cleavage at residue 1018 within the
dium samples were also analyzedby SDS-PAGE and WestB-domain was studied by mutagenesis of the Arg residue at
ern immunoblot analysis using an antibody that reacts with
1018 to Ile (R1018I). The expression and susceptibility to
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
V
ROLE OF FACTOR
B-DOMAIN IN THROMBIN CLEAVAGE
V
3029
94/74
R 10181
Mock
"
"
- 330
kDa
-
200 -
- l50
-94 (HC)
-74 ( L C )
69 I 2 3 4 5 6
7 8 9 IO II 12 13 14 1516 17 18 19 20
Fig l. Thrombin cleavage of wild-type, V
,,,
and R10181factor V. [%]-methionine radiolabeledfactor V was preparedfrom cells transfected
with theindicated expression vectors encoding
wild-type factor V (V, lanes 1 through 5). V
,,,
(lanes 6 through 101, or R10181 (lanes
11 through
151. After immunoprecipitationwith the anti-factor V MoAb, precipitated protein was resuspended and subjected to thrombin digestion with
increasing amounts of thrombin (Ila). Samples were then analyzed by SDS-PAGE. The 330-kD single chain, 150-kD activation peptide, the 94kD heaw chain lHC1.
.
. are indicated. Molecular weight markers are shown on the left. Mock samples did not
.
.. and the 7dkD liaht chain (LC1
receive DNA (lanes 16 through 201.
the factor V heavy chain. After I minute, wild-type factor
V was completely digested to its mature products, whereas
after 4 hours there were significant amounts of an intermediate 220-kD polypeptide accumulated for mutant RIO1 81 (Fig
3A). The size of this 220-kD polypeptide was consistent
with itrepresenting the B-domain offactor V extending from
residue 709 to 1545. Cleavage to generate the 94-kD heavychain fragment was complete after 1 minute for both wildtype and the R10181 mutant factor V. A parallel blot of the
same samples probed with a factor V light-chain-specific
antibody showed that the 74-kD light chain was cleaved
after 1 minute for wild-type factor V, whereas the R10181
mutant exhibited a delayed appearance of the 74-kD light
chain (Fig 3B). These results show that mutation of ArglOl8
to Ile within the B-domain delayed thrombin cleavage of the
light chain and was consistent with the delayed functional
activation by thrombin.
A specific acidic aminoacid-richregion restores thrombin
cleavageatresidue 1545. Residues on the NH2-terminal
side of the thrombin cleavage at 1545 are enriched in acidic
amino acids. We examined the requirement for these residues
by deleting a smaller region of the B-domain (residues 709
to 1476) to obtain v709.1476 that retained the acidic amino
acid-rich region (residues 1490 to 1520). The factor V basal
activity in conditioned medium from COS- 1 cells transfected
with the v709.1476 expression vector was similar to cells
transfected with the Vwn4expression vector (Table 1).
Whereas Vwn4was not activated by thrombin, the activity
of v709.1476 was slightly activated (1 .Pfold) by thrombin. In
contrast, both deletion molecules were activated approximately fourfold by factor Xa (Table 1). The susceptibility
to thrombin cleavage was monitored by labeling transfected
cells with p5S]-methionine and immunoprecipitation of the
factor V polypeptides from the conditioned medium. Immunoprecipitated proteins were treated with increasing amounts
of thrombin and analyzed by SDS-PAGE. Wild-type factor
V migrated as a 330-kD polypeptide that was absent from
mock-transfected cells (Fig 4, lanes 1 through 5 and31
through 35). The 330-kD polypeptide was completely
cleaved by 10 U/mL of thrombin (Fig 4, lane 2).
and
V709.1476 both
migrated as single-chain polypeptides with molecular weights expected for their respective deletions (Fig
4, lanes 6 and 1 l ) . The amounts of secreted Vwn4 and
V709.1476
were approximately similar to that of wild-type factor V. Whereas the majority of Vwn4was resistant to thrombin cleavage (Fig 4, lanes 7 through IO), the majority of
V709.1476 was susceptible to thrombin cleavage to yield the
74-kD light chain (Fig 4, lanes 12 through 15) that comigrated with the light chain of wild-type factor V. However,
the heavy chain of the v70.1476 migrated withslower mobility
than the 94-kD heavy chain of wild-type factor V. The increased molecular weight of the heavy-chain fragment is
consistent with the presence of 69 extra amino acids, residues
1476 to 1545, present on the heavy chain as a consequence
of resistance to thrombin cleavage at residue 709. These
results show that introduction of residues 1476 to 1545 of
the factor V Bdomain into the B-domaiddeleted factor Vw4
restored the ability for thrombin to cleave at residue 1545.
The sequence 1476 to 1545 is rich in acidic amino acids
(residues 1490 to 1520) and has three potential sites for
tyrosine sulfation?' Factor VI11 also has three similar acidic
amino acid-rich regions containing tyrosine sulfate that are
adjacent to thrombin cleavage sites?2 The ability of these
regions in factor VI11 to restore susceptibility to thrombin
cleavage and to release the factor V light chain was evaluated. PCR was used to introduce Mlu I restriction sites flanking the factor VI11 acidic regions between residues 336 and
372,700 and 740, and 1648 and 1689. The DNA fragments
encoding these regions were introduced into the factor V Bdomain deletion molecule V94n4.Expression vectors encod-
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
3030
MARQUETTE, PITMAN, AND KAUFMAN
-
o~~""'""''"""""''
0
100
150
Min
50
200
250
1400 F
1200
1000
400
200
0
5
Min
10
wild-type factor V heavy chain. The increase in molecular
weight of the heavy chain is consistent with the presence of
an extra 36 amino acids due to resistance to thrombin cleavage at residue 709. The efficiency of thrombin cleavage of
the light chain of the V9,/,,+336-372 mutant was similar to
that of the v709.1476 mutant. Insertion of factor VI11 residues
700 to 740 also restored thrombin cleavage, although slightly
less efficiently, whereas 25 U/mL of thrombin was required
to cleave the factor V mutant (Fig 4, lanes 22 through 25).
In contrast, insertion of residues 1648 to1689 restored cleavage, but significantly less effectively when 100 U/mL of
thrombin was required to cleave the majority of the factor
V mutant (Fig 4, lanes 27 through 30). In addition, the
cleaved light chain didnot comigrate withthe wild-type
factor V light chain, indicating an alternate site of cleavage.
For all of these acidic amino acid insertion molecules, the
heavy chain migrated with slower mobilitythanthewildtype factor V 94-kD heavy chain, indicating resistance to
cleavage at residue 709.
The activity of the factor VI11 acidic amino acid region
insertion mutants was studied before and after treatment
with factor Xa or thrombin (Table 1). The V70.1476and
Vy,,4+700-740 mutants showed fourfold to sevenfold less
basal activity than was wild-type factor V and had activities
similar to Vgdn4.However, the basal activities for the acidic
amino acid insertion mutants
V,,,,+336-372
and
V4,/
74+ 1648-1689 were consistently higher than those for wildtype factor V (from at least 4 different transfection experiments in which numerous clotting assays were performed).
Thrombin treatment minimally activated these molecules,
whereas treatment with factor Xa activated all these molecules by three to fourfold, close to values obtained with
wild-type factor V.
15
DISCUSSION
Factor V and factor VI11 are homologous proteins that
Fig 2. Time course ofthrombin activation for
wild-type, Vs,,,,, and
both contain a large B-domain that is cleaved away from the
R10181 factor V. COS-l cells were transfected with wild-type (01,
V
,,,
(01, or R10181mutant (m) factor V expression vectors. After 60
molecule on activation. Factor V is secreted as a single-chain
hours, condfiioned medium was harvested for factor
V activity assay
molecule, whereas factor VI11 is proteolytically processed
usingaclottingassay.Beforeassay,samplesweretreated
with
intracellularly at two sites within the B-domain to yield a
thrombin (1 UlmL; A) or factor Xa
(1 pglml; B) at RTfor the indicated
heter~dimer.~'
Previous studies on B-domaiddeleted factor
periods of time. The inset shows an independent experiment analyzing the earlier time points after thrombin activation.
VI11 molecules indicated that juxtaposition of the arginine
ing these molecules were transfected into COS-l cells. The
cells were labeled with [35S]-methonine,and the conditioned
medium was immunoprecipitated with anti-factor V antibody. Immunoprecipitates were digested with increasing
amounts of thrombin and analyzed by SDS-PAGE and autoradiography. In the absence of thrombin treatment, all acidic
region insertion mutants were efficiently expressed and secreted into the conditioned medium as single-chain polypeptides of the expected molecular weight (Fig 4, lanes 16, 21,
and 26). Treatment of the V,,,+336-372
mutant with 10
U/mL thrombin generated the 74-kD light chain that comigrated with the wild-type factor V light chain, indicating
that insertion of this region restored efficient thrombin cleavage at residue 1545 (Fig 4, lanes 17 through 20). However,
the heavy chain migrated with slower mobility than did the
at the 740 thrombin cleavage site to the arginine at the 1689
thrombin cleavage site reconstituted a functional thrombin
cleavage site and yielded a functional molecule.32The results
reported here show that the analogous deletion in factor V
(residues 709 to 1545 in VYdn4)is not cleaved by thrombin
and has significantly reduced activity. However, the V M J ~
deletion molecule was efficiently activated by factor Xa,
although the total amount of activity generated after correcting for the amount of factor V protein was sevenfold less
than obtained for wild-type factor V. These results indicate
the B-domain is required for thrombin cleavage and activation, but not for factor Xa activation. The results also show
that a single-chain molecule that has juxtaposed the 709 and
the 1545 cleavage sites has low factor V activity. Cleavage
by factor Xato separate the heavyand light chains may
permit a conformational change necessary to activate the
molecule. In this report, the structural elements of the B-
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
V
ROLE OF FACTOR
B-DOMAIN IN THROMBIN CLEAVAGE
3031
R10181
V
A
I
I
II
I' 15'3O'Ih2h 4h 0 I' 15'30' Ih 2h 4h
0
-
kDa
- 330
k Da
.280
200-
. l50
- HC
69
2
I
3
4 5
7
6
8
9 IO
I1
12 1314
R10181
V
..
-
0 I' 15'30' Ih 2h 4 h 0 I' 15' 30' Ih 2h 4 h
m--
'
-
-
'
kDo
Fig 3. Time course of thrombin cleavage for wildtype and R10181 mutant factor V. Samples of conditioned medium from transfected COS-l cells were
treated with thrombin (1 UlmLl for increasing periods of time and aliquots were taken for factor V
assay (Fig2) and analysis by SDS-PAGE and Western
blot analysis usingthe anti-factor V polyclonal antibody reactive with the heavy chain (A). In parallel,
samples were assayed by Western blot analysis with
an anti-factor V light chain MoAb (B). Singlethain
factor V in lane 1 in the bottompanel did not transfer
well in this experiment. The migration of thrombincleaved heavy chain (HC) and light chain (LC) are
indicated.
200
-
69
-
-
kDa
-330
m
- 280
F----"-
-150
- LC
I
domain that may be important for thrombin cleavage at residue 1545 were studied.
Kane et a133described a factor V B-domain deletion molecule that retained susceptibility to thrombin cleavage and
activation. This mutant contained an additional 168 amino
acids within the B-domain that were lacking in the VW4
deletion mutant described here. Because the additional
amino acids included an acidic amino acid-rich region between residues 1490 and 1520, we constructed a deletion
that retained residues 1476 to 1545 (deletion v709.1476). The
V709.1476 molecule displayed basal activity similar to the deletion VW4 but was cleaved by thrombin at residue 1545
and the activity was increased approximately twofold. We
attribute the reduced fold activation of v709-1476 compared
with the wild-type factor V to resistance to cleavage at residue 709. The 1476 to 1545 region contains an acidic amino
acid-rich cluster that has three potential sites of tyrosine
sulfation at residues 1494, 1510, and 15154' that we propose
are important for interaction with thrombin. Factor VIII con-
2
3
4 5
6
7
8
9 1011 12 1314
tains three acidic regions with sulfated tyrosine residues that
occur on the amino-terminal side of each thrombin cleavage
site. Inhibition of tyrosine sulfation by treatment of factor
V4' or factor VII14' expressing cells with sodium chlorate
produced factor V and factor VI11 molecules that had a
slower rate of activation and cleavage by thrombin, whereas
factor Xa activation was not altered. The differences in susceptibility to thrombin and factor Xa activation of nonsulfated factors VI11 and V42"3were similar to the differences
in susceptibility to thrombin and factor Xa activation of
the B-domain deletion molecule Vwn4 described here.In
addition, mutation of these individual tyrosine residues to
phenylalanine residues in factor VI11 reduced the efficiency
of thrombin cleavage at the adjacent site without affecting
cleavage at other thrombin cleavage sites within the factor
VI11 molecule." To evaluate whether the acidic region was
important for cleavage of factor V at residue 1545, we studied the effect of introducing the three acidic regions from
factor VI11 into the B-domain-deleted factor VW4 to deter-
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
3032
KAUFMAN
MARQUElTE, PITMAN, AND
9269
-
-74(lc.)
I 2 3 4 5 6 7 8 9 IO I1 12 13 14 l5 16 11
87
19 20 21 22 23 24 25 2627 2829 30 31 32 33 3435
Fig 4. Expression of wild-type and mutant factor V molecules in COS-l cells. Plasmid DNA expression vectora encoding the indicated
molecules were transfected into COS-lcells. 1%-methionine-labeled conditioned medium was prepared from transfected COS-lcells at 60
hours posltransfection as described in the Materials and Methods. Factor V polypeptides were quantitatively immunoprecipitated using
polyclonal anti-factorV antibody. Immunoprecipitated proteins were resolved by reducing
SDS-PAGE. Before electrophoresis, portions ofthe
immunoprecipitates were treated with increasing amounts of thrombin (Ila), as indicated. Mock representscells that did not receive plasmid
DNA. Molecular weight markers are shownthe
onleft.The migrationof the 330-, 150-,94- (heavy chain), and
the 74- (lightchain) kD polypeptides
are indicated on the right.
can inhibit the activation of factor VIII and factor
mine whether they could restore thrombin cleavageat 1545.
suggest that the anion-binding exosite 2 is responsible for
Insertion of factor VIII residues 336 to 372 efficiently reinteraction with the acidic regions within factors
VI11and
VIII
stored thrombin cleavage. In contrast, insertion of factor
V.
acidic residues 1648 to 1689 was less effective in restoring
Analysis of the cleavage intermediates upon factor Xa
thrombin cleavage, whereas insertion of the factor VIII 700
at
was sufficient
to 740 acidic
region was intermediate in the ability to restore activation suggested that cleavage ArglOl8
to activate factor V?“’’ We have shown by mutagenesis of
thrombincleavage.Theresultsshowthatdifferentacidic
regions can restore thrombin cleavage at 1545. However, the ArglOl8 to Ile that cleavage atArglOl8 is not required for
thrombin activation of factor V. However, thrombin activadifferent acidic regions act with different efficiencies in
the
tion and cleavage at kg1545 was delayed in this mutant.
context of the factor V B-domain deletion molecule. AlThus, it appearsthatcleavageat ArglOl8 withintheBthoughatpresentwecannotruleoutthepossibilitythat
amino acids outside the acidic region affect thrombin cleav- domain is required to enhance cleavage at residue 1545, a
finding that correlates with functional activation. Our studies
age, the results are consistent with a requirement for a speshow that there is a preferred sequential cleavageby thromcific acidic amino acid-rich region for thrombin cleavage at
bin in factor V occuring in the order 709, 1018, and 1545
1545. In addition, at present we do not know if the tyrosine
and that functional peak activation correlates with cleavage
residues in these chimeric proteins were posttranslationally
at Arg1545. Although at presentit is not possible to rule out
sulfated. It is interesting that the deletion molecule
VW4
that the ArglOl8 to ne mutation altered the conformation
was not cleaved by thrombin, although this deletion does
of the 1545 cleavage site, we think it more likely that cleavjuxtapose an acidic region with two potential sites of tyrosine
sulfation (between residues 670 and 709) to the 1545 cleav- age at 1018 either alters the conformation of the 1545 cleavage site to make it a more efficient substrate for thrombin
age site. This finding suggests that simple juxtaposition of
or induces a structural change to bring thrombin to the vicinarginine 1545 to an acidic region is not sufficient to direct
thrombin cleavage at 1545 and that structural features of the ity of residue 1545 to facilitate cleavage.
Previous deletion studies concluded that theBdomain of
sequence may also play a role in thrombin recognition and
In
factor VIII did not affect the activation of the molecule?’
cleavage.
V B-domain is not
We propose that the acidic region containing tyrosine sul-this report, we showed that the factor
fate is important for interaction with an anion-binding exo- required for activation by factor Xa. In contrast, the B-domain of factor V was required for thrombin cleavage of the
site onthrombin. The crystal structure
of thrombin identified
light chain. At present we do not know if the differences in
two anion binding ex0sites.4~Anion binding exosite 1 binds
the B-domain requirements for factor Xa and thrombin result
the leech inhibitor hirudin.& Intact hirudin inhibits the activafrom differences in protein-protein interactions or from diftion of factor V by cu-thr0mbin.4~ In contrast, the hirudin
carboxy-terminal dodecapeptide, hirugen, binds anion-bind- ferences in the reaction conditions used (eg, in contrast to
ing exosite 1 but does not inhibit the thrombin activation of thrombin, factor Xa cleavage requires negatively charged
phospholipid that was usedin our assays). The studies indifactorAnion-bindingexosite248interactswithheparin
and chondroitin ~ u l f a t e . 4The
~ ~observations
~
that heparin
cate that the factor B-domain
V
promotes thrombin-mediated
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
ROLE OF FACTOR V B-DOMAININTHROMBIN
CLEAVAGE
cleavage of the light chain through two mechanisms. First,
the B-domain provides an intermediate cleavage site at residue 1018 that facilitates subsequent cleavage at 1545. Second, an acidic amino acid-rich region that likely contains
sulfated tyrosine residues is required for thrombin cleavage
of the light chain. Further studies are required to elucidate
the functional significance
of the factorV B-domain on regulating thrombin activation of factor V in vivo.
ACKNOWLEDGMENT
We gratefully thank Alnawaz Rehemtulla for valuable discussion
and comments on the manuscript.
REFERENCES
1. Davie EW, Fujikawa K, Kisiel W: The coagulation cascade:
Initiation, maintenance, and regulation. Biochemistry 30:10363,
1991
2. Mann KG, Jenny RJ, Krishnaswamy S : Cofactor proteins in
the assembly and expression of blood clotting enzyme complexes.
Ann Rev Biochem 57:915, 1988
3. Kane W, Davie EW: Cloning of a cDNA coding for human
factor V, a blood coagulation factor homologous to factor VIlI and
ceruloplasmin. Proc Natl Acad Sci USA 83:6800, 1986
4. Jenny RJ, Pittman DD, Toole JJ, Kriz RW, Aldape RA, Hewick
RM, Kaufman RJ, Mann KG: Complete cDNA and derived amino
acid sequence of human factor V. Proc Natl Acad Sci USA 844846,
1987
5. Toole JJ, Knopf JL, Wozney JM, Sultzman LA, Buecker J,
Pittman DD, Kaufman RJ, Brown E, Shoemaker C, Orr EC,
Amphlett GW, Foster WB, Coe ML, Knutson GJ, Fass DN, Hewick
RM: Molecular cloning of a cDNA encoding human antihaemophilic
factor. Nature 312:342, 1984
6. Vehar GA, Keyt B, Eaton D, Rodriguez H, O'Brien DPO,
Rotblat F, Oppermann H, Keck R, Wood WI, Harkins RW, Tuddenham EGD, Lawn RM, Capon DJ: Structure of human factor VIII.
Nature 312:337, 1984
7. Ortel TL, Takahashi N. Putnamm Fw: Structural model of
human ceruloplasmin based on internal triplication, hydrophilic/hydrophobic character, and secondary structure of domains. Proc Natl
Acad Sci USA 81:4761, 1984
8. Stubbs JD, Lekutis C, Singer KL, Bui A, Yuzuki D, Srinivasan
U, Parry G: cDNA cloning of a mouse mammary epithelial cell
surface protein reveals the existence of epidermal growth factor-like
domains linked to factor VIII-like sequences. Proc Natl Acad Sci
USA 87:8417, 1990
9. Guinto ER, Esmon CT, Mann KG, MacGillivray RTA: The
complete cDNA sequence of bovine coagulation factor V.JBiol
Chem 267:2971, 1992
10. Cripe LD, Moore KD, Kane WH: Structure of the gene for
human coagulation factor V. Biochemistry 31:3777, 1992
11. Gitschier J, Wood WI, Goralka TM, Wion KL, Chen EY,
Eaton DH, Vehar GA, Capon DJ, Lawn RM: Characterization of
the human factor VIII gene. Nature 312:326, 1984
12. Dahlback B, Hildebrand B: Inherited resistance to activated
protein C is corrected by anticoagulant cofactor activity found to be
a property of factor V. R o c Natl Acad Sci USA 91:1396, 1994
13. Bertina RM, Koeleman BPC, Koster T, Rosendaal FR, Dirven
RJ, de Ronde H, van der Velden PA, Reitsma PH: Mutation in blood
coagulation factor V associated with resistance to activated protein
C. Nature 369x54, 1994
14. Sun X, Evatt B, Griffin JH: Blood coagulation factor Va
abnormality associated with resistance to activated protein C in venous thrombophilia. Blood 83:3120, 1994
3033
15. Dahlback B: Human coagluation factor V purification and
thrombin-catalyzed activation. J Clin Invest 66583, 1980
16. Kane WH, Majerus PW: Purification and characterization of
human coagulation factor V. J Biol Chem 256:1002, 1981
17. Esmon CT: The subunit structure of thrombin-activated factor
V. Isolation of activated factor V, separation of subunits, and reconstitution of biological activity. J Biol Chem 254964, 1979
18. Nesheim ME, Myrmel KH, Hibbard L, Mann K G Isolation
and characterization of single chain bovine factor V. J Biol Chem
254508, 1979
19. Katzmann JA, Nesheim M E , Hibbard LS,Mann KG: Isolation
of functional human coagulation factor Vby using a hybridoma
antibody. hoc Natl Acad Sci USA 78:162, 1981
20. Monkovic DD, Tracy PB: Activation of human factor V by
factor Xa and thrombin. Biochemistry 29: 1118, 1990
21. Krishnaswamy S , Russell GD, Mann KG: The reassociation
of factor Va from its isolated subunits. J Biol Chem 264:3160, 1989
22. Laue TM, Lu R, Krieg UC, Esmon CT, Johnson AE: Ca2'dependent structural changes in bovine blood coagulation factor Va
and its subunits. Biochemistry 28:4762, 1989
23. Eaton DL, Rodriguez HR, Vehar GA: Proteolytic processing
of human factor VIII. Correlation of specific cleavages by thrombin,
factor Xa, and activated protein C with activation and inactivation
of factor VnI coagulant activity. Biochemistry 25505, 1986
24. Lollar P, Parker CG. pH-dependent denaturation of thrombinactivated porcine factor VIII. J Biol Chem 265:1688, 1990
25. Fay PJ, Haidaris PJ, Smudzin TM: Human factor VIIIa subunit structure. Reconstruction of factor VIIIa from the isolated Al/
A3-Cl-C2 dimer and A2 subunit. J Biol Chem 2668957, 1991
26. Pittman DD, Millenson M, Marquette K, Bauer K, Kaufman
RJ: The A2 domain of human recombinant derived factor VI11 is
required for procoagulant activity butnot for thrombin cleavage.
Blood 79:389, 1992
27. Toole JJ, Pittman DD, Orr EC, Murtha P, Wasley LC, Kaufman RI: A large region (-95 kDA) of human factor VnI isdispensable for in vitro activity. Proc Natl Acad Sci USA 83:5939, 1986
28. Eaton DL, Wood WI, Eaton D, Hass PE, Hollingshead P,
Wion K, Mather J, Lawn RM, Vehar GA, Gorman C: Consbruction
and characterization of an active factor VIII variant lacking the
central one-third of the molecule. Biochemistry 298343, 1986
29. Meulien P, Faure T, Mischler F, Harrer H, Ulrich P, Bouderbala B, Dott K, Sainte Marie M, Mazurier C, Cazenave J-P, Courtney
M, Pavirani A:Anew recombinant procoagulant protein derived
from the cDNA encoding human factor VIII. Protein Eng 2:301,
1988
30. Dorner AJ, Bole DG, Kaufman RJ: The N-linked glycosyiation and heavy chain-binding protein association secretion of glycoproteins. J CeIl Biol 105:2665, 1987
3 1 . Pittman DD, Alderman EA, Tomkinson KA, Wang JH, Giles
AR, Kaufman RJ: Biochemical, immunological, and in vivo functional characterization of B-domain deleted factor VIII. Blood
81:2925, 1993
R
, Fass DN, Wang JH,
32. Nesheim M, Pittman DD, Giles A
Slonosky D, Kaufman RJ: The effect of plasma von Willebrand
factor on the binding of human factor VIII to thrombin-activated
human platelets. J Biol Chem 266:17815, 1991
33. Kane WH, Devore-Carter D, Ortel TL: Expression and characterization of recombinant human factor V and a mutant lacking a
major portion of the connecting region. Biochemistry 29:6762, 1990
34. Pittman DD, Marquette KA, Kaufman RJ: The role of the Bdomain for factor VI11 and factor V expression and function. Blood
84:4214, 1994
35. Kaufman RJ:Vectors used for expression in mammalian cells.
Methods Enzymol 185:487, 1989
36. Pittman DD, Kaufman RJ: Site-directed mutagenesis and ex-
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
3034
pression in mammalian cells to evaluate structure-function relationships in coagulation factors V and VIII. Methods Enzymol 222:236,
1993
37. Sanger F, Nicklen S, Coulson AR: DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 745463, 1977
38. Domer A J , Kaufman RJ: Analysis of synthesis, processing,
and secretion of proteins expressed from heterologous genes in mammalian cells. Methods Enzymol 185:577, 1989
39. Dreyfuss G, Adam SA, Choi YD: Physical change in cytoplasmic messenger ribonucleoproteins in cells treated with inhibitors
of mRNA transcription. Mol Cell Biol 4:415, 1984
40. Nesheim ME, Katzmann JA, Tracy PB, Mann KG: Factor V.
Methods Enzymol 80249, 1981
41. Hortin GL: Sulfation of tyrosine residues in coagulation factor
V. Blood 76:946, 1990
42. Pittman DD, Wang JH, Kaufman RJ: Identification and functional importance of tyrosine-sulfate residues within recombinant
factor VIII. Biochemistry 31:3315, 1992
43. Pittman DD, Tomkinson KN, Michnick D, Selighsohn U,
Kaufman RI: Posttranslational sulfation of factor V is required for
efficient thrombin cleavage and activation and for full procoagulant
activity. Biochemistry 33:6952, 1994
44. Michnick DA, Pittman DD, Wise RI, Kaufman RJ: Identification of individual tyrosine sulfation sites within factor VI11 required for optimal activity and efficient thrombin cleavage. J Biol
Chem 269:20095, 1994
45. Tulinsky A,Qiu X: Active site and exosite binding of athrombin. Blood Coagul Fibrinolysis 4:305, 1993
MARQUETTE,PITTMAN,ANDKAUFMAN
46. Qiu X, Padmanabhan KP, Carperos VE, Tulinsky A, Kline
T, Maraganore JM, Fenton JW 11: Structure of the hirulog 3-thrombin
complex and nature of the S' subsites of substrates and inhibitors.
Biochemistry 31:11689, 1992
47. Ofosu FA, Fenton JW 11, Maraganore J, Blajchman MA, Yang
X, Smith L, Anvari N, Buchanan MR, Hirsh J: Inhibition of the
amplification reactions of blood coagulation by site-specific inhibiI283:893, 1992
tors of a-thrombin. Biochem .
48. Church FC, Pratt CW, Noyes CM, Kalayanamit T, Sherrill
GB, Tobin RB, Meade JB: Structural and functional properties of
human alpha-thrombin, phosphopyridoxylated alpha-thrombin, and
gamma T-thrombin. Identification of lysyl residues in alpha-thrombin that are critical for heparin and fibrin(ogen) interactions. J Biol
Chem 264:18419, 1989
49. Gan Z-R, Li Y, Chen Z, Lewis SD, Shafer JA: Identification
of basic amino acid residues in thrombin essential for heparin-catalyzed inactivation by antithrombin 111. J Biol Chem 269:1301, 1994
50. Ye J, Rezaie AR, Esmon CT: Glycosaminoglycan contributions to both protein C activation and thrombin inhibition involve a
common arginine-rich site in thrombin that includes residues arginine 93, 97, and 101. J Biol Chem 269:17965, 1994
5 1. Ofosu FA: Modulation of the enzymatic activity of a-thromin
by polyanions: Consequences on intrinsic activation of factor V and
factor VIII. Haemostasis 21:240, 1991
52. Barrow RT,Healey JF, Lollar P: Inhibition by heparin of
thrombin-catalyzed activation of the factor VIII-von Willebrand factor complex. J Biol Chem 269593, 1994
53. Suzuki K,Dahlback B, Stenflo J: Thrombin-catalyzed activation of human coagulation factor V. J Biol Chem 257:6556, 1982
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
1995 86: 3026-3034
The factor V B-domain provides two functions to facilitate thrombin
cleavage and release of the light chain
KA Marquette, DD Pittman and RJ Kaufman
Updated information and services can be found at:
http://www.bloodjournal.org/content/86/8/3026.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.