1. Art and Diseño

From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
The Hematopoietic Transcription Factor PU.l Is Downregulated in Human
Multiple Myeloma Cell Lines
By Monica Pettersson, Christer Sundstrom, Kenneth Nilsson, and Lars-Gunnar Larsson
PU.l is a hematopoietictranscription factor belonging t o the
Ets-family. It is identical t o the Spi-l oncogene, which is
implicated in spleen focus-forming virus-induced murine
erythroleukemias. PU.l seems t o be requiredfor early development of multiple hematopoietic lineages, but its expression in mature cells is preferentially observed in cells of the
B-cell- andmonocyte/macrophage-differentiationlineage. It
binds the so-called Pu box,an important tissue-specific regulatory DNA element present in a numberof genes expressed
in these cell lineages. We have analyzedthe expression and
activity of PU.1 during human B-cell development using a
panel of B-cell lines representing different stages of maturation, from early precursors t o differentiated plasma cells.
PU.l mRNA expression and PU.1 DNA binding activity, as
measuredby Northern blot analysis and electrophoretic mobility shift assay, respectively, were evident in cell lines representing pro-B, pre-B, and mature B cells. We could also
show Pu box-dependent transactivation of a reporter gene
in transient transfections in these cell lines. In contrast, in
a number of multiple myeloma cell lines, representingdifferentiated, plasma cell-like B cells, PU.l DNA binding activity,
mRNAexpression, and Pu box-dependent transactivation
were absent or detectable
at a verylow level. In lymphoblastoid cell lines, which exemplify an intermediate stage of Bcell differentiation, a reduced expression andactivity were
observed. Thefindings in the human multiple myeloma cell
lines represent the firstexamples of B cells with downregulated PU.l expression and apparently contradict observations in the murine system in which PU.l is expressed and
active in plasmacytoma cell lines. At present, it is unclear
whether the lack of PU.l expression and activity in human
multiple myeloma cell lines represents a malignancy-aosociated defect in these cells or exemplifies a normal develop
mental regulation in terminally differentiated B cells.
0 7995 by The American Societyof Hematology.
A
ment of several lineages.’The PU.l binding site, the socalled Pu box, has been identified as an important tissuespecific regulatory element in the promoters or enhancers
of a number of differentiation-associated genes in different
hematopoietic cell
Thus, PU.l has been implicated as an important tissue-specific factor regulating
these genes in intimate cooperation with other transcription
factors (such as NF-EMS,” or Sp12’) or other Ets-family
members (such as Etsl,” Erg-3,” or GABPaZ3).
We are interested in the role of PU. 1 during development
of human B-lineage cells and its possible involvement in
tumor formation in these cells. A panel of human B-cell
lines representing different stages of development, from
early precursors to differentiated plasma cells, was used for
studies of PU.1 expression and activity. We found differences in PU.l mRNA expression, PU.l DNA binding, and
transcriptional activity in cell lines at different maturation
stages. In particular, we can show that PU.l activity and
expression was shut off in a panel of multiple myeloma cell
lines, representing differentiated B cells. The implications
of these findings will be discussed.
N IMPORTANT AREA of research on cellular differentiation is the identification of transcription factors
regulating cell lineage- and differentiation stage-specific
gene expression. Examples of such factors in the hematopoietic system are the Oct-2’ and GATA family proteins.’ Another transcription factor specific for hematopoietic cells is
PU. 1, originally described as a lymphoid- and macrophagespecific f a ~ t o r .However,
~.~
by gene targeting, PU.l was recently shown to be required for the development of multiple
hematopoietic lineages.’ PU. 1 belongs to the ets proto-oncogene family (including Etsl, Ets2, Erg, Elfl, GABPa,PEA3,
Hi-l, E74A, Elkl, and SAP1) characterized by the wellconserved ETS domain that mediates specific DNA binding
to the core sequence GGA.6,7The N-terminal part of the
protein, which is only weakly or not at all homologous to
other Ets-proteins, contains a glutamine-rich transactivation
domain8 and is able to bind to the TATA-box-binding protein and the retinoblastoma protein Rb in vitro.’ PU.1 also
contains a motif that mediates protein-protein interactions
with the B-cell-specific transcription factor NF-EMS.”
PU.1 is identical to the oncogene Spi-l implicated in the
development of spleen focus-forming virus-induced murine
Friend erythroleukemia. Spleen focus-forming virus was
found to integrate in the Spi-l locus in 95% of the tumors,
resulting in an elevated expression of Spi-l mRNA.” The
observations that overexpression of Spi-1PU. 1 immortalizes
primary erythroblasts12 and that antisense oligonucleotides
inhibit the proliferation of Friend murine erythroleukemia
cell linesI3 further indicated a role for Spi-1PU.1 in the
growth control of immature erythroid cells. Also, the Etsfamily members v-Ets and Hi-l have been implicated in
the development of erythroid tumors in chickens and mice,
respe~tively.’,’~
The expression of PU. l in mature hematopoietic cells was
reported to be confined to B cells, monocytes/macrophages,
and mast cells, whereas it seems to be more broadly expressed at early stages of lymphoid and myeloid development.3.4.15-17 This would also agree with the gene-targeting
data which suggested that itis required for the early developBlood, Vol 86, No 7 (October l ) , 1995: pp 2747-2753
MATERIALS AND METHODS
Cell lines. All cell lines were maintained in RPM1 1640 (Flow
Laboratories, Ayrshire, UK) supplemented with 7.5% fetal calf seFrom theLaboratory of TumorBiology, Department of Pathology,
University of Uppsala, University Hospital, Uppsala, Sweden.
Submitted December 13, 1994; accepted June 7, 1995.
Supported by grants from the Swedish Cancer Society, T. & R.
Stjderbergs and M. Bergvalls Foundations.
Address reprint requests to Lars-Gunnar Larsson, PhD, Laboratory of TumorBiology, Department of Pathology, University of Uppsala, Univerisity Hospital, S-751 85 Uppsala, Sweden.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
oooS-4971/95/8607-0044$3.00/0
2747
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
PETTERSSONET AL
rum (GIBCO. Grand Island, NY). glutamine, 100 IUlmL penicillin,
and S0 pglmL streptomycin. A panelof cell lines was selected
representing different stages of B-cell development. KM3 is derived
from a non-B. non-T acute lymphocytic leukemia and represents a
lymphoid precursor cell line."' BJA-B, Raji, Daudi, and Ramos are
B-lymphoma cell lines representing pre-B to mature B cells.'7 Karpas
422 and MN60 are B-lymphomaand leukemia cell lines, respecti~ely.'~.'~
representing mature B cells. U-255 and Corinna I1 are
Epstein-Barr virus-immortalized Ig-secreting lymphoblastoid cell
line^,'^.''' representing B cellsat the B-blast/immunoblast stage. Karpas 707, W63, U-1996. and U-266 are multiple myeloma cell line?."
andrepresent plasmablasts-plasma cells. U-266-1970 andU-2661984 are early and late passages. respectively, of an IgE myeloma
cell line, the phenotype of which has been described."
Trcmsfection and chloramphenicol aceQltransferase (CAT)assay.
Transfections were performed using the diethyl aminoethyl (DEAE)dextran method." The cells were fed 24 hours before transfection,
and 20 X 10" cells were mixed with a solution containing 300 pg
DEAE-dextran (Pharmacia, Sollentuna, Sweden) and 5 pg DNA.
The mixture was incubated for 30 minutes atroom temperature,
followed by glycerol treatment for 3 minutes. The cells were washed
once in phosphate-buffered saline before fresh medium was added.
Seventy-two hours postinfection, the cells were harvested, and a
CAT assay was performed.25
Nuclear extracts and electrophoretic mohiliwshqt assay (EMSA).
Nuclear extracts were prepared from40 X IO" cells using thelysolecithin procedure described by Zervitz and Akusjarvi." Ten micrograms of extract wasused for each binding reaction, and 1 pg
poly(d1-dC)poly(dl-dC) (Pharmacia) and 10 pmol single-stranded
oligonucleotide were included as nonspecific competitors. EMSA
with the Pubox was performed in a buffer containing 10 mmol/L
HEPES (pH 7.9). 10% glycerol, 20 mmol/L KCI, 4 mmol/L MgCI2,
10 mmollL EDTA, 0.25 mmol/L dithiotreitol, 4 mmol/L spermidine,
and 1 0 0 p@mL bovine serum albumin. The Spl EMSA was performed in 10 mmol/L HEPES (pH 7.9). 10% glycerol, 50 mmol/L
KCI, S mrnollL MgCI2. 0.6 mmol/L dithiotreitol, and 200 pmol/L
ZnSO,. The extract was added to the buffer including the nonspecific
competitor and was incubated for 20 minutes at room temperature.
Pubox or the Spl oligonucleotide ( I to 2 fmol), end-labeled with
Klenow DNA polymerase or T4DNA polynucleotidekinase, respectively, was added. and the mixture was further incubated for 20
minutes at room temperature. Samples were analyzed on a 4% polyacrylamide gel in 0.2SX TBE (0.022 mol/L Tris-borate and 0.5
mmol/L EDTA). The Pu box oligonucleotide sequence (S'TCGACTCTGAAAGAGGAACTCTCGAGCT) is derived from the SV40
control region.' The mutated Pu box sequence is S'TCGACTCGTCCAGAGGAACTCTCGAGCT. The Spl oligonucleotide
(S'CCGGCCCCGCCCATCCCCGGCCCCGCCCATCC)contains a
dimer of a binding site found in the immediate early gene 3 of herpes
simplex virus. Antibody 1297 (kindly provided by Dr van Beveren,
La Jolla Cancer Research Foundation, La Jolla, CA) is specific for
the N-terminal region of PU. I , and antibody T-21 (Biotechnology,
Santa CNZ, CA) recognizes the C-terminal part of the protein.
Plasmid constructions. pCAT-Control plasmid (Promega, Madison, WI) withthe SV40 early promoter and enhancer sequences
served as the control plasmid in the transfection experiments. An
Xho I linker was cloned into the BgI I1 site of pCAT-Promoter
plasmid (Promega), and the new plasmid was designated pPromXCAT. Four copies ofthe Pubox oligonucleotides (wild-type and
mutated) were cloned into the oligonucleotide vector (OVEC) plasmid.'7 The resulting Xho I-Sal I fragment was then inserted into the
Xho I site of pPromXCAT.
Northwn analysis. Total R N A was extracted from exponentially
growing cells by the LiCllurea method.2xRNA (IS pg) was denaturated in formamide and fractionated in an 1 % agarose gel containing
B
A
€
t
1
2
3
4
5
m
1
2
3
Fig 1. EMSA with thePu box sequence. The W 4 0 Pu box oligonucleotide was mixed with 10 p g of BJA-B nuclear extract, and the
resulting complexes were separated on a native polyacrylamide gel.
(AI Lane1,noextract;
lane 2, with extract. The specificity of the
complexes was analyzed by addition of a 500-fold molar excess of
cold Pu box sequence (lane 31, a mutated Pu box (lane 4). and an
oligonucleotide containing the Spl binding site (lane 5). The main
Pu boxlprotein complexes formed are indicated as a and b. (B) Supershift performed with an antibody directed against the N-terminal
part of the protein. Lane 1, no extract; lane 2, extract without antibody; lane 3, antibody added.
formaldehyde (4 m U l 0 0 mL gel). After electrophoresis, the RNA
was transferred to a nitrocellulose filter. The probes were "P-labeled
by the random priming method (Amersham, Buckinghamshire, UK).
Hybridization was performed at 42°C in a solution containing 50%
formamide, I X Denhardt's solution, 2X SSC (2X SSC: 0.3 mol/L
sodium chloride and 30 mmol/L sodium citrate), S mmol/L NaPO.,,
0.1% sodium dodecyl sulfate, and 200 pg/mL of salmon sperm
DNA. Filters were washed in O S % sodium dodecyl sulfate and 2X
SSC at 50°Cand exposed toKodakXAR film (Eastman Kodak,
Rochester, NY). A murine PU.1 cDNA clone (unpublished, Dr L.
Hellman, Department of Medical Immunology and Microbiology,
University of Uppsala, Sweden) and a glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) cDNA clon$' were used as probes.
RESULTS
Absence of PU.1 DNA binding activity in multiple myeloma cell lines. To establish the conditions for studies of
PU.1 DNA binding, weused the human BJA-B cell line
known to express PU. 1.3 A "P-labeled oligonucleotide containing the Pu box sequence from the SV40 control region
was mixed with nuclear extracts from BJA-B cells and analyzed by EMSA. The SV40 Pubox binds PU.1withhigh
affinity but is a poor binding site for many other Ets-family
proteins.""'43 Figure 1A shows that two major retarded complexes, a and b. were formed. These complexes were competed by an access unlabeled Pu box oligonucleotide but not
by a mutated oligonucleotide or an oligonucleotide containing an Spl binding site, thus showing the specificity of
the binding. The mutated oligonucleotide, previously shown
to eliminate binding of PU. I ,3 contains 4 substitutions 4-7
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
HUMAN PU.l
CELLS
EXPRESSION IN
B
Fig 2. PU.l DNA binding activity in B-cell nuclear
extracts. EMSA using the Pu box oligonucleotide
was performed with nuclear extracts prepared from
the following B-cell lines: lane 1, no extract; lane 2,
KM3; lane 3, BJA-B; lane 4, Daudi; lane 5, Raji; lane
6, Ramos; lane 7, Karpas 422; lane 8, MN60; lane 9,
U-255; lane 10, Corinna II; lane 11, Karpas 707; lane
12, L363; lane 13, U-1996; lane 14, U-266-1970; and
U-266-1984.
lane 15,
2749
1
2
nucleotides 5' of the the GGA core binding site for Etsfamily proteins. Addition to the binding reaction of antibodies directed to the N-terminus of PU. 1 resulted in a supershift
of the upper but not the lower Pu box binding complex, thus
confirming the presence of PU.1 or an antigenically closely
related protein in the former (Fig IB). Addition to the binding reaction of antibodies specific for the C-terminus of PU.1
prevented formation of both the upper and lower complexes
(data not shown), indicating that the lower complex represents a degradation product of PU.1 containing the DNA
binding domain but lacking the N-terminal antibody-binding
epitope. PU.1 contains a so-called PEST sequence suggested
to play a role in protein degradationAU
To investigate the DNA binding activity of PU.1 in relation to B-cell differentiation, nuclear extracts were prepared
from various human B-celllines representing different stages
of B-cell differentiation. These included the pro-B-cell line
KM3; the B-lymphoma cell lines BJA-B, Raji, Daudi, and
Ramos representing pre-B to mature B cells; the Karpas 422
follicular lymphoma cell line and B-leukemia cell line MN60
representing mature B cells; the U-255 and Corinna I1 Igsecreting lymphoblastoid cell lines and, finally, the multiple
myeloma cell lines Karpas 707, L363, U-1996, U-266-1970,
and U-266-1984 representing plasmablasts-plasma cells. The
extracts were analyzed by EMSA using the Pu box sequence
as above. Figure 2 shows that a Pu box-binding complex
comigrating with the upper PU.1 complex inBJA-B cells
was clearly shown in the cell lines representing early and
mature B cells (Fig 2, lanes 2-8). In contrast, three of the
myeloma cell lines, U-1996, U-266-1970, and U-266-1 984,
were completely negative; in the other two, L363 and Karpas
707, a very faint band could be detected (Fig 2, lanes 1115). Compared with early and mature B-cell lines, a reduced
PU.1 binding activity was observed in the lymphoblastoid
cell lines, in particular in Corinna I1 (Fig 2, lanes 9 and IO).
Figure 3 shows that an oligonucleotide containing an Spl
binding site showed specific Spl binding activity in the myeloma cell extracts as well as in BJA-B extracts, thus ruling
out a general degradation of the myeloma extracts.
Absence of Pu box-dependent transcriptional activio in
3
4
5
6
7
8
9
101112131415
multiple myeloma cell lines. We next investigated whether
the observed binding of PU.1 to the Pu box in the various
extracts correlated with transcriptional activity. Four copies
of the Pu box oligonucleotide and a mutated version thereof
were cloned upstream of the SV40 early promoter in a CAT
gene construct. The plasmids were transfected into selected
B-cell lines, and, 72 hours after transfection, the cells were
harvested and assayed for CAT activity. A construct with
the SV40 early promoter and enhancer sequences was
1
2
3
4
5
6
7
8
Fig 3. Spl DNA binding activity in B-cell nuclear extracts. An oligonucleotide containing two Spl binding sites was mixed with the
following B-cell extracts and subjected to EMSA lane 1, no extract;
lane 2 and 3, BJA-B; lane 4, Karpas 707; lane 5, U63;lane 6, U-1996;
lane 7, U-266-1970; and lane 8, U-266-1984, In lane 3, a 500-fold molar
excess of unlabeled S p l sequence is included in the mixture.
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
PETERSSON ET AL
2750
A
C
0
O
E
1
2
3
4
1
2
3
4
1
2
3
1
2
9
4
1
4
2
3 4
H
G
F
E
D
1
2
3
4
transfected in parallel and served as a positive control. In
the BJA-B, Raji, U-255, and Karpas 422 cell lines, the presence of the Pu boxes led to an enhanced transcription from
the CAT gene to various degrees, whereas mutations introduced in the Pu box reduced the activity to basal level (Fig
4). Densitometrical scanning of the autoradiogram and normalizing to the activity of pPromXCAT vector lacking Pu
boxes showed that four copies of the Pu box stimulated
transcription 28 times in BJA-B cells, 8 times in Raji cells,
and 3 times in U-255 and Karpas 422 cells. Transfection of
the myeloma cell lines L363 and U-266-1984 with the Pu
box-containing plasmids did notlead to activation of the
CAT gene, thus correlating with the lack of Pu box binding
in these cells. A control CAT reporter plasmid containing
SV40 promoter and enhancer sequences strongly stimulated
transcription in the myeloma cell lines. We were also unable
to detect any Pu box-dependent transcriptional activity in
the Corinna I1 lymphoblastoid cell line, which has a reduced
PU. 1 binding activity.
The PU.1 gene is downregulated in multiple myeloma cell
lines. The lack of PU. 1 activity in the myeloma cells could
be because of a downregulation of the PU. I gene expression
or, alternatively, because the protein is present in an inactive
form. To investigate the expression of PU. 1 in the panel of
B-cell lines used above, RNA was prepared, and a Northern
blot analysis was performed using a mouse PU.1 cDNA as
probe. Figure 5A shows that the 1.4-kb PU. I transcript was
expressed in all B-cell lines with the exception of the myeloma cell lines, in which it was undetectable even after
prolonged exposure. The lymphoblastoid cell line U-255
showed a reduced expression, and the level of PU. I mRNA
was very low, but detectable, in Corinna 11. As a control,
the same filter was rehybridized with a GAPDH probe, showing that this gene was expressed in all cell lines (Fig 5B).
We conclude that the PU.1 gene is shut off in the myeloma
1
L
3
4
Fig 4. Pu box-dependent transcriptional activity
in human B-cell lines. The various B-cell lines were
transfected with 5 p g of the CAT reporter plasmids
described below usingDEAE-dextran. Cells were harvested after 3 days, and transcriptional activity was
analyzed by CATassay. (A) CATassay performed
without extract (0) and with purified CAT (E). The
following cell lines were used: B, MA-B; C, Raji; D,
Karpas 422; E, U-255; F, Corinna 11; G , U-266-1984; H,
L363. Reporter plasmids were used as follows: in
lane 1 is pPromXCAT containing theW 4 0 early promoter butlacking Pu boxes. In lane 2, four copies of
the Pu box are inserted upstream of theW 4 0 early
promoter in pPromXCAT, and lane 3 contains, in a
similar way, four copies of a mutated Pu box. Lane
4 is the pCAT-Control (Promega) with SV40 early
promoter and enhancer.
cell lines, thus explaining the lack ofPU.1 transcriptional
activity and DNA binding in these cells.
DISCUSSION
PU.1is a transcription factor specific for hematopoietic
cells that seems to be required for development of early
A
B
1
2
3
4
5
6
7 8
9 1 0 1 1
Fig 5. Northern blot analysis of PU.l expression in human B t e l l
lines. Total RNA was prepared from 11 different B-cell lines and fractionated on a formaldehyde-containing agarose gel. After blotting
onto nitrocellulose filter, hybridization was performed using "P-labeled probes. Lane 1, KM3; lane 2, RIA-B; lane 3, Daudi; lane 4, Raji;
lane 5, Karpas 422; lane 6 MN60; lane 7, U-255; lane 8, Corinna II;
lane 9, L363; lane 10, U-1996; lane 11, U-266-1984. (A) A murine PU.l
cDNA clone was used as probe. (B) Hybridized probe was removed,
and the filter was rehybridized with
a GAPDH probe.
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
PU.1 EXPRESSION IN HUMAN B CELLS
precursor cells. It has also been suggested to play a role in
mature B cells and macrophages. We have undertaken a
study to investigate the presence and activity of PU. 1 during
human B-cell development using a panel of human B-cell
lines representing the B-cell lineage from early precursors
to differentiated plasma cells.
Our results show major differences in the expression and
activity of PU. l in cell lines representing different levels of
B-cell development. PU. 1 mRNA expression and PU.l DNA
binding activity was shown in the pro-B<ell line KM3 as
well as in pre-B and mature B-cell lines. Pu box-dependent
transcriptional activity of a CAT reporter gene was also
shown in these cell lines in transient transfections. In contrast, in a panel of multiple myeloma cell lines representing
differentiated B cells, no or only very low mRNA expression,
DNA binding activity, and Pu box-dependent transactivation
were detectable. A reduced PU.l activity and expression
were observed in the lymphoblastoid cell lines U-255 and
Corinna 11, representing an intermediate stage of differentiation. This reduction was most pronounced in Corinna 11,
which seems further differentiated than many other EpsteinBarr virus-transformed lymphoblastoid cell lines in that it
lacks CD37 expression (our unpublished observations).
However, Corinna I1 is clearly less differentiated than the
myeloma cell
Our observations in human pro-B, pre-B and mature B
cells are in good agreement with previous studies in murine
B-cell lines.4,'6.19,22,45
However, the lack of PU. 1 expression
and activity in human multiple myeloma cell lines is a unique
finding and represents the first example of B cells with downregulated PU. 1 expression. Our results are apparently contradictory to results obtained in the murine system, in which
PU.1 is expressed and active inmost plasmacytoma cell
lines.4,i9.4S
Our finding in human multiple myeloma cell lines may
be interpreted in at least two different ways. (1) Because
PU.1 seems generally expressed in other B cells, one interpretation is that the lack of PU. 1 is a malignancy-associated
defect common to human multiple myeloma. If PU.1 is an
important transcription factor involved in commitment along
the B lineage, it is conceivable that loss of PU.l may result
in problems for the cell to recognize itself as a B cell, and,
thus, it may be unable to complete the differentiation program and develop into terminally differentiated, resting
plasma cells. However, from Southern analysis (data not
shown) and cytogenetic analysis of chromosome 11,46 we
have found no evidence for chromosomal aberrations of the
PU.1 loci in the myeloma cell lines. This does not exclude
minor alterations such as small deletions or point mutations.
(2) An alternative interpretation is that the shutoff of the
PU.1 gene is a normal event occumng at a late stage of Bcell development corresponding to that of the myeloma cell
lines. This interpretation is supported by the reduced expressionand activity in the U-255 and Corinna I1 cell lines
representing an intermediate stage of differentiation. Data
from homozygous gene-targeted PU.l mouse embryos suggest that PU.l is a very early hematopoietic transcription
factor required for generation of B- and T-lymphocyte,
monocyte, and granulocyte progenitors, thus acting already
2751
at a stage of a multipotent stem
This interpretation
would be in agreement with previous expression studies suggesting that PU.1 is expressed in early myeloidflymphoid
cells committed to the erythroid, granulocytic, monocytic,
mast cell, B- and T-lymphoid lineages. It is then shut off
early in T-cell, erythroid, and granulocytic differentiation
but is expressed at later stages of monocytic, mast cell, and
B-cell differentiati~n.~~~"'"~
The present data may suggest
that it is shut off late during B-cell differentiation, thus performing its function at preterminal stages of B-cell development. From this perspective, the differences in expression
in human myelomas and murine plasmacytomas may be because of slight differences in maturation stage or a malignancy-associated inability to shut off PU.1 in the plasmacytomas or might represent a species difference. Studies of
PU.l expression in normal human and mouse plasma cells
are required to clarify these points.
It may seem remarkable that PU.l is shut off in human
myeloma cell lines that produce Ig at a high level, because
PU. 1 has been suggested to be one important transcriptional
activator of both the heavy- and light-chain Ig
However, there are alternative pathways of Ig gene regulation mediated by, for instance, Oct-2 and NF-KB, acting on
the heavy chain enhancer and onthe K-chain intron enhancer,
respectively, that seem to increase in importance at late
stages of B-cell differentiati~n.'~,~',~~
Therefore, such alternative pathways may be in operation in the human myeloma
cell lines. Other genes suggested to be regulated by PU.l in
B cells are the J-chain,' the mb-l and B29 antigen receptorassociated signaling proteins,'8320p2 i n t e g r i n ~ ,and
~ ~ the
major histocompatibility complex class I1 antigens4The expression of these genes seems to be connected to B-cell
activation, proliferation, and IgM secretion at preterminal
stages of differentiation rather than to terminally differentiated plasma cells or myelomas.
Therefore, one interesting possibility is that PU.l might
be a transcription factor which integrates differentiation and
cell growth at proliferative stages along the B-cell differentiation lineage. The oncogenic potential of PU.l/Spi-l in
erythroleukemia and its ability to interact with Rb in vitro
would point in this direction. Immunohistochemical studies
in normal murine bone barrow also suggest the highest expression of PU.l in dividing cells." An attractive hypothesis
is that PU.l is replaced byan alternative Ets-family or a
non-Ets transcription factor such as Oct-2 or NF-KB,lacking
proliferative or having an antiproliferative capacity, at terminal stages of B-cell differentiation in which high expression
of the differentiation-associated genes is connected to irreversible growth-arrest. Examples of other Ets-family members expressed in hematopoietic cells are Etsl, Ets2, Erg,
Fli-l, Elfl, GABPa,and/or S P ~ BThe
. ~ EMSA and transactivation assays in the myelomas suggest that PU.l is not replaced byan Ets-family protein with capacity to bind the
SV40 Pu box. However, other PU. 1 binding sites in relevant
cellular target genes may have a broader Ets-family binding
specificity that could result in a competition between different Ets-family proteins or a sequential role of these during
B-cell development. Further studies of PU.1 and other Etsfamily proteins during normal B-cell development is re-
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2752
PETTERSSON ET AL
quired toestablish whether our findings in multiple myeloma
cell lines represent a malignancy-associated deregulationof
PU.l in these cells or exemplify a normalphase of B-cell
differentiation.
ACKNOWLEDGMENT
We thank Dr L. Hellman for providing the PU. 1 cDNA clone, Dr
C. van Beveren for providing the antiserum against the N-terminal
part of PU.l, and A. Kraft for skillful technical assistance.
REFERENCES
1. Kemler I, Schaffner W: Octamer transcription factors and the
cell type-specificity of immunoglobulin gene expression. FASEB J
4:1444, 1990
2. Orkin SH: GATA-binding transcription factors in hematopoietic cells. Blood 80575, 1992
3. Pettersson M, Schaffner W: A purine-rich DNA sequence motif
present in SV40 and Lymphotropic papovavirus binds a lymphoidspecific factor and contributes to enhancer activity in lymphoid cells.
Genes Dev 1:962, 1987
4. Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki
RA: The macrophage and B cell-specific transcription factor PU.l
is related to the ets oncogene. Cell 6:113, 1990
5. Scott EW, Simon MC, Anastasi J, Singh H: Requirement of
transcription factor PU.l in the development of multiple hematopoietic lineages. Science 265:1573, 1994
6. Karim FD, Urness LD, Thummel CS, Klemsz MJ, McKercher
SR, Celada A, Van Beveren C, Maki RA, Gunther CV, Nye JA,
Graves BJ: The ETS-domain: A new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes Dev 4: 1451, 1990
7. Wasylyk B, Hahn SL, Giovane A: The Ets family of transcription factors. Eur J Biochem 21 1.7, 1993
8. Shin MK, Koshland ME: Ets-related protein PU.1 regulates
expression of the immunoglobulin J-chain gene through a novel Etsbinding element. Genes Dev 7:2006, 1993
9. Hagemeier C, Bannister AJ, Cook A, Kouzarides T: The activation domain of transcription factor PU.1 binds the retinoblastoma
(RB) protien and the transcription factor TFIID in vitro:RB shows
sequence similarity to TFIID and TFIIB. Proc Natl Acad Sci USA
90:1580, 1993
10. Pongubala JMR, Van Beveren C, Nagulapalli S, Klemsz MJ,
McKercher SR, Maki RA, Atchison ML: Effect of PU.1 phosphorylation on interaction withNF-EM5and transcriptional activation.
Science 259:1622, 1993
11. Moreau-Gachelin F, Tavitian A, Tambourin P: Spi-l is a
putative oncogene in virally induced murine erythroleukaemias. Nature 331:277, 1988
12. Schuetze S, Stenberg PE, Kabat D: The Ets-related transcription factor PU. 1 immortalizes erythroblasts. Mol Cell Biol 135670,
1993
13. Delgado MD, Hallier M, Meneceur P, Tavitian A, MoreauGachelin F Inhibition of Friend cells proliferation by spi-l antisense
oligodeoxynucleotides. Oncogene 9: 1723, 1994
14. Ben-David Y, Giddens EB, Letwin K, Bemstein A: Erythroleukemia induction by Friend murine leukemia virus: Insertional
activation of a new member of the ets gene family, Fli-l, closely
linked to c-ets-l . Genes Dev 5:908, 1991
15. Schuetze S, Paul R, Gliniak BC, Kabat D: Role of the PU. 1
transcription factor in controlling differentiation of Friend erythroleukemia cells. Mol Cell Biol 12:2967, 1992
16. Galson DL, Hensold JO, Bishop TR, Schalling M, D’Andrea
AD, Jones C, Auron PE, HousmanDE: Mouse P-globin DNAbinding protien B1 is identical to a proto-oncogene, the transcription
factor Spi-1PU.1, and is restricted in expression to hematopoietic
cells and the testis. Mol Cell Biol 13:2929, 1993
17. Hromas R, Orazi A, Neiman RS, Maki R,
Van Beveren C,
Moore J, Klemsz M: Hematopoietic lineage- and stage-restricted
oncogene family memberPU.1.Blood
expression of theETS
82:2998, 1993
18. Hagman J, Grosschedl R: An inhibitory carboxyl-terminal
domain in Ets-l and Ets-2 mediates differential binding of ETS
family factors to promoter sequences of the mb-1 gene. Proc Natl
Acad Sci USA 89:8889, 1992
19. Nelsen B, Tian G, Erman B, Gregoire J, Maki R, Graves B,
Sen R: Regulation of lymphoid-specific immunoglobulin p heavy
chain gene enhancer by ETS-domain proteins. Science 261:82, 1993
20. Omori SA, Wall R: Multiple motifs regulate the B-cell-specific promoter of the B29 gene. Proc Natl Acad Sci USA 90:11723,
1993
2 I . Pahl HL, Scheibe M,Zhang D-E, Chen H-M, Galson DL,
Maki RA, Tenen DG: The proto-oncogene PU. 1 regulates expression
of the myeloid-specific CD1 Ib promoter. J Biol Chem 2685014,
1993
22. Rivera RR, Stuiver MH, Steenbergen R, Murre C: Ets proteins: New factors that regulate immunoglobulin heavy-chain gene
expression. Mol Cell Biol 13:7163, 1993
23. Battinger EP, Shelley CS, Farokhzad OC, Arnaout MA: The
human p2 integrin CD18 promoter consists of two inverted ets cis
elements. Mol Cell Biol 14:2604, 1994
24. Zhang D-E, Hetherington CJ, Chen H-M, Tenen DG: The
macrophage transcription factor PU. 1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Mol Cell
Biol 14:373, 1994
25. Chen H-M, PahlHL, Scheibe RJ, Zhang D-E, Tenen DG:
The Spl transcription factor binds the CD1 l b promoter specifically
in the myeloid cells in vivo and is essential for myeloid-specific
promoter activity. J Biol Chem 2689230, 1993
26. Schneider U, Schwenk H-U, Bornkamm G: Characterization
of EBV-genome negative “null” and “T” cell lines derived from
children with acute lymphoblastic leukemia and leukemic transformed non-Hodglun lymphoma. Int J Cancer 19:621, 1977
27. Nilsson K, Klein G: Phenotypic and cytogenetic characteristics of humanB-lymphoid cell lines and their relevance for the
etiology of Burkitt’s lymphoma. Adv Cancer Res 37:319, 1982
28. Dyer MJS, Fischer P, Nacheva E, Labastide W, Karpas A: A
new human B-cell non-Hodgkin’s lymphoma cell line (Karpas 422)
exhibiting both t( 14;18) and t(4;ll) chromosomal translocations.
Blood 75:709, 1990
and
29. Nilsson K: Characteristics of established myeloma
lymphoblastoid cell lines derived froman E myeloma patient: A
comparative study. Int J Cancer 7:380, 1971
30. Karpas A, Fischer P, Swirsky D: Human myeloma cell line
carrying a Philadelphia chromosome. Science 216:997, 1982
3 1 . Diehl V, Schaadt M, Kirchner H, Hellriegel K-P, Gudat F,
Fonatsch C, Laskewitz E, Guggenheim R: Long-term cultivation of
plasma cell leukemia cells and autologous lymphoblasts (LCL) in
vitro: A comparative study. Blut 36:331, 1978
32. Jernberg H, Nilsson K, Zech L, Lutz D, Nowotny H, Scheirer
W: Establishment and phenotypic charaterization of three new human myeloma cell lines (U-1957, U-1958, and U-1996). Blood
69:1605, 1987
33. Hellman L, Josephson S, Jernberg H, Nilsson K, Pettersson
U: Immunoglobulin synthesis in the human myeloma cell line U266; expression of two immunoglobulin heavy chain isotypes ( E and
a ) after long-term cultivation in vitro.Eur J Immunol 18:905, 1988
34. Lnthman H, Magnusson G: Highefficiency polyoma DNA
transfection of chloroquine treated cells. Nucleic Acids Res 1 1 :1295,
1983
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
PU.l EXPRESSION INHUMAN
B CELLS
35. Gorman CM, Moffat LF, Howard BH: Recombinant genomes
which express chloramphenicol acetyltransferase in mammalian
cells. Mol Cell Biol 2:1044, 1982
36. Zervitz K, A k u s j b i G: An improved nuclear extract preparation method. Gene Anal Tech 6:101, 1989
37. Westin G, Gerster T, Muller MM, Schaffner G, Schaffner W:
OVEC, a versatile system to study transcription in mammalian cells
and cell-free extracts. Nucleic Acids Res 15:6787, 1987
38. Auffray C, Rougeon F Purification of total mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor
RNA. Eur J Biochem 107:303, 1980
39. Tso JY, Sun X-H, Kao T, Reece KS, Wu R: Isolation and
characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: Genomic complexity and molecular evolution of
the gene. Nucleic Acids Res 13:2485, 1985
40.Reddy ESP, RaoVN: erg, An ets-related gene, codes for
sequence-specific transcriptional activators. Oncogene 6:2285,
1991
41. Rao VN, Reddy ESP A divergent ets-related protein, Elk-l,
2753
recognizes similar c-ets-l proto-oncogene target sequences and acts
as a transcriptional activator. Oncogene 7:65, 1992
42. Rao VN, Ohno T, Prasad DDK, Bhattacharya G, Reddy ESP:
Analysis of the DNA-binding and transcriptional activation functions
of human Hi-l protein. Oncogene 8:2167, 1993
43. Wasylyk C, Kerckaert J-P, Wasylyk B: A novel modulator
domain of Ets transcription factors. Genes Dev 6:965, 1992
44. Rogers S, Wells R, Rechsteiner M: Amino acid sequences
common to rapidly degraded proteins: The PEST hypothesis. Science
234 364, 1986
45. Pongubala JMR, Atchison ML: Functional characterization of
the developmentally controlled immunoglobulin kappa 3’ enhancer:
Regulation by Id, a repressor of helix-loop-helix transcription factors. Mol Cell Biol 11:1040, 1991
46. Jemberg H, Zech L, Nilsson K: Cytogenetic studies on human
myeloma cell lines. Int J Cancer 40:811, 1987
47. Corcoran LM, Karvelas M,Nossal GJV, YeZ-S, Jacks T,
Baltimore D: Oct-2, although not required for early B-cell development, is critical for later B-cell maturation and for postnatal survival.
Genes Dev 7:570, 1993
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
1995 86: 2747-2753
The hematopoietic transcription factor PU.1 is downregulated in
human multiple myeloma cell lines
M Pettersson, C Sundstrom, K Nilsson and LG Larsson
Updated information and services can be found at:
http://www.bloodjournal.org/content/86/7/2747.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.