1. Art and Diseño

From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
Compound Heterozygosity in a Complete Erythrocyte Bisphosphoglycerate
Mutase Deficiency
By Valerie Lemarchandel, Virginie Joulin, Colette Valentin, Raymonde Rosa, Frederic Galacteros, Jean Rosa, and
Michel Cohen-Sola1
-
Erythrocyte bisphosphoglycerate mutase (BPGM) deficiency
is a rare disease associated with a decrease in 2.3-diphosphoglycerate concentration. A complete BPGM deficiency was
described in 1978 by Rosa et al (J Clin Invest 62:907, 1978)
and was shown to be associated with 30% to 50% of an
inactive enzyme detectable by specific antibodies and resulting from an 89 Arg Cys substitution. The propositus' three
sisters exhibited the same phenotype, while his two children
had an intermediate phenotype. Samples from the family
were examined using polymerase chain reaction and allelespecific oligonucleotide hybridization and sequencing techniques. Amplification of erythrocyte total RNA from the
propositus' sister around the 89 mutation indicated the
presence of two forms of messenger RNAs, a major form with
the 89 Arg
Cys mutation and a minor form with a normal
sequence. Sequence studies of the propositus' DNA samples
indicated heterozygosity at locus 89 and another heterozygosity with the deletion of nucleotide C 205 or C 206. Therefore,
the total BPGM deficiency results from a genetic compound
with one allele coding for an inactive enzyme (mutation
BPGM Creteil I) and the other bearing a frameshift mutation
(mutation BPGM Creteil 11). Examination of the propositus'
two children indicated that they both inherited the BPGM
Creteil I mutation.
0 1992 by The American Society of Hematology.
T
defect responsible either for the synthesis of a modified
enzyme that would not have been detected by specific
antibodies and by the tryptic peptides sequence analysis or
for the absence of synthesis of the enzyme. Having obtained
the cDNAZ4and the gene sequencesz5of human BPGM, we
were able to reexamine this case by enzymatic amplification
(polymerase chain reaction [PCR] method) of portions of
the BPGM gene and identification of the products using
allele-specific oligonucleotide (ASO) hybridization and
direct nucleotide sequencing.
-
HE LEVEL OF 2,3-diphosphoglycerate (DPG), the
allosteric ligand of hemoglobin (Hb),'
is controlled by
bisphosphoglycerate mutase (BPGM) (EC 5.4.2.4),2 a multifunctional enzyme specifically found in the red blood cells
(RBCs) of humans and of several animal specie^.^-^ This
enzyme synthesizes DPG through its synthase activity and
degrades it through its phosphatase activity.6 In addition,
erythrocyte BPGM bears a minor activity that catalyzes 5%
of the reversible conversion of 3-phosphoglycerate to 2-phosphoglycerate,S,7 a reaction mainly catalyzed by a distinct
enzyme, phosphoglycerate mutase (PGAM) (EC 5.4.2.1).*
DPG binds to the chains of the deoxy form of Hb at the
ratio of one molecule per Hb tetramer (a2Pz),stabilizing
this conformation and thus decreasing its oxygen affinity
and increasing the oxygen delivery to the tissues in the
physiologic range of PO~.~JO
There are few cases of BPGM deficiency described in the
world. Some decreases in erythrocyte DPG content were
described associated with a hemolytic anemia,11-16but there
was no proof of any role of this defect in the generation of
hemolysis. Other patients with a deficiency have been
r e ~ o r t e d , ' ~most
- l ~ of whom are heterozygotes and exhibit a
moderate erythrocytosis. A unique completely deficient
patient was described in 1978 by Rosa et ai." This patient
had no detectable synthase activity and minute amounts of
DPG in his RBCs. This situation produces an erythrocytosis
due to a left shift of the Hb oxygen dissociation curve. The
propositus' RBCs contained only an electrophoretically
abnormal BPGM, which, although inactive, was characterized and quantified using specific antibodies to 30% to 50%
of the normal BPGM erythrocyte content.20-zzIn a previous
work, this protein was isolated and purified, with the amino
acid sequence of its tryptic peptides showing the substitution of Arg 89 for Cys. The abnormal protein was called
BPGM CrCteiLZ3
The aim of our study was to investigate the genetic status
of this patient who expressed around 30% to 50% of the
BPGM CrCteil enzyme, even though it was not unstable at
37°C and was present at the same level in reticulocytes and
in older RBCs. Such a situation suggested a compound
heterozygosity by the combination of the amino acid substitution of BPGM CrCteil (89 + Cys) and another genetic
Blood, Vol80, No 10 (November 15). 1992: pp 2643-2649
MATERIALS AND METHODS
DNA and RNA samples. DNA was prepared using standard
methods from peripheral blood (PB) samples, and from lymphoblastoid cell lines established by Epstein-Barr virus (EBV) transformation of peripheral B lymphocyte^.^^.^^ Total RNA from PB was
prepared according to the method described by Itoh et al?
In vitro amplification. Amplification by PCR was performed
following the method of Saiki et alZ9with minor modifications in a
DNA thermocycler apparatus (Perkin Elmer-Cetus, Norwalk, a).
PCR reaction mixture (100 p,L) contained polymerase buffer (10
mmol/L Tris HC1, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCI2,
0.01% gelatin), 0.2 mmol/L dNTP, 10 pmol of specific primers, and
2.5 U of Taq DNA polymerase (Perkin Elmer-Cetus). Ten micrograms of total RNA and 1 pg of DNA were used for each reaction.
PCR conditions were denaturation at 95°C for 1 minute, annealing
at 50 to 60°C (depending on the primers used) for 1 minute, and
elongation at 72°C for 2 minutes for 30 cycles.
Complementary DNA was obtained by reverse transcription of
total cellular RNA with Moloney murine leukemia virus (M-MLV)
From INSERM U.91 and CNRS UA 607, Hbpital Henri Mondor,
Crkteil, France.
Submitted April 14, 1992; accepted July IS, 1992.
Supported by grants from the INSERM (unitk 91), the CNRS (VA
607), and the Universiti Paris XI1 (Paris Val-de-Mame).
Address reprint requests to Michel Cohen-Solal, MD, PhD, INSERM U.91-Hbpital Henri Mondor, 94010 Crkteil Ceder, France.
The publication costs of this article were defrayed in p a n by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C.section I734 solely to
indicate this fact.
0 1992 by The American Society of Hematology.
0006-4971/92/8010-0001$3.00/0
2643
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
LEMARCHANDEL ET AL
2644
reverse transcriptase. Amplification of cDNA around position 89
was performed using oligonucleotidesM l ( 5 ’ ATCTGCTCCCTGTTGAGACC 3’) and M2 (5’ TCCA’ITCACACAGCCTGGCT 3’).
Samples were analyzed by polyacrylamide gel electrophoresis for
purity and size and by dot blotting hybridization.
Amplification of exons and intron-exonjunctions of the BPGM
gene was performed using 3 pairs of oligonucleotides according to
the gene structure? D3 (5’ GCCAACTCCTI’ACTGGTTCA 3’)
and D4 (5‘ AATGTAAACGTTCGCAACAT 3’) for the promoter
region and first exon, D5 (5’ CAGTTGAATATAACTTAGAC 3’)
and D6 (5‘ AACCTCTAATAAGTGGTATA 3’) for the second
exon, and D7 (5‘ TGTGTTTAAACACCTGGTCTG 3’) and D8
(5’ GCACTGTA’IT CTACCTTCCC 3’) for the third exon and 3’
flanking region.
Oligonucleotide hybridization analysis. Amplified fragments were
dot-blotted onto a nitrocellulose membrane and then hybridized to
ASOs M9 (5’ CTAAATGAGCGTCACTATG 3’), for the wildtype sequence, and M10 (5’ CATAGTGACACTCAT’ITAG 3’),
for the 89 Arg
Cys substitution. Hybridization and washing
conditions were determined for both oligonucleotides using normal genomic DNA and DNA from an expression vector30containing the BPGM cDNA with an 89 Arg + Cys substitution.
Nucleotide sequencing. PCR products were reamplified as above,
except that the ratio of primers used was 0.1:l instead of 1:1,
leading to the production of single-strandedDNA. Sequences were
made by the dideoxynucleotide method3’ using the Sequenase kit
(US Biochemicals, Cleveland, OH).32
-
RESULTS
The pedigree of the family M . . . with total BPGM
deficiency is shown in Fig 1. The propositus is subject 11-5.
His case has been reported elsewhere.I7J9The propositus
as well as his sisters (subjects 11-2, 11-3, and 11-4) have a
complete deficiency in synthase activity with trace amounts
of DPG found in their RBCs. An inactive enzyme was
detected in the erythrocytes of these patients by Western
a n a l y ~ i s . About
~ ~ , ~ ~30% to 50% of the amount of BPGM
found in normal erythrocytes was detected using specific
antibodies in the erythrocytes of subjects II-2,11-3,11-4,and
Family M....
I
II
3**
-l111
dl
1
4
I
r-l
2*
3*
Fig 1. Pedigree of family M . . . with total BPGM deficiency. (*)
Cases in which the DNA only was studied. (**) Case in which both the
mRNA and the DNA were studied. Open symbols, normal subject;
solid symbols, total BPGM-deficient subjects; half-filled symbols,
partial BPGM-deficient subjects; ND, subjects not studied; t, deceased.
11-5, which were devoid of synthase activity. A similar
enzyme level was found in a reticulocyte-enriched sample,
which would tend to indicate that the enzyme was not
particularly unstable in vivo despite its relative thermoinstability in vitro at 55°C. Both of the propositus’ children (111-2
and 111-3) have a partial deficiency in synthase activity of
approximately 50%. It has recently become possible to
study them. They both have a moderate polycythemia
(5.5 x 10l2/L for subject 111-2 and 5.2 x 10l2/Lfor subject
111-3). The packed cell volume is slightly elevated, erythrocyte 2,3-DPG slightly decreased (9.2 pmol/g Hb for subject
111-2 and 10.6 pmol/g Hb for subject III-3), which results in
a slight decrease in Pso (21 mm Hg for subject 111-2 and 24
mm Hg for subject 111-3). BPGM activities were decreased
around 44% of normal (2.53 and 2.45 U/g Hb for subjects
111-2 and 111-3, respectively; the normal value is 5.68 2 0.72
U/g Hb). Electrophoresis and chromatographies of the
propositus’ BPGM or BPGM-like enzyme showed the
presence of only one molecular form. This abnormal
enzyme was purified, and the amino acid sequence of
tryptic peptides determined, showing a single amino acid
substitution: Arg 89
Cys (BPGM Cr15teil).~~
To determine the genetic status of the propositus, a reinvestigation
was performed using a molecular biology approach. The
propositus died in 1988 of a malignant brain tumor, which
was most likely not related to his BPGM deficiency,
although he was, before diagnosis, treated with radiophosphorus injections. DNA prepared from blood samples
obtained before his death and stored frozen, as well as from
immortalized cells, were used for this study. In addition, we
were able to study samples from one of his sisters (Fig 1,
subject 11-3), who presented the same phenotype, and from
his two children, who have intermediate phenotypes.
A S 0 hybridization of RNA amplification products from
subject 11-3 around the 89 locus clearly shows that the PCR
products hybridize with both the normal and mutant
oligonucleotide probes (Fig 2, lane 5 ) . This indicates that
two messenger RNAs (mRNAs) are present in unequal
amounts, the major one hybridizing with the mutant oligonucleotide probe and the minor one with the normal probe.
Using artificial mixtures of control DNA (Fig 2, lanes 6 and
7), it was possible to have a rough idea of the amount of
mRNA (around 5%).
This second defect cannot result from a large deletion, as
shown by previous PCR results as well as by Southern blot
analysis (data not shown). To detect a small gene alteration,
a strategy for the analysis of the BPGM gene was developed, as indicated in Fig 3A. The three exons, the intronexon junctions, and the 5’ (promoter) and 3’ adjacent
regions were amplified separately and were directly sequenced using internal primers. Sequencing of the second
exon first showed the presence in position 413 (codon for
residue 89) of two nucleotides A and C instead of the
nucleotide C present in the normal sequence (Fig 4A). This
result was consistent with the RNA amplification experiment described above.
Secondly, sequencing of the second exon showed a
double sequence after nucleotide 205 (Fig 4B). One of
them corresponds to the normal sequence and the other
--f
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2645
BISPHOSPHOGLYCERATEMUTASE MUTATIONS
- 181 position (ic, both nuclcotidcs A and G found), as is
his mothcr. thc daughtcr hcing homozygous for nuclcotidc
A at this position.
M9
DISCUSSION
M10
1 2 3 4 5 6 7
Fig 2. AlIele-.pecMc detection of mRNA-ampltfied products in the
total BPGM-deficient patient. Total erythrocyte RNA from the propositus 1 sister (subject 11-4) was reverse transcribed and amplified using
oligonucleotides M1 and M2. Dot blotting was made using (1) normal
BPGM cDNA plasmid; (2) DNA obtained by PCR amplification of
normal genomic DNA; (3) mutated (Arg 89Cyt) BPGM cDNA
plasmid; (4) DNA obtained by PCR amplificationol genomic DNAfrom
the deficient patient; (5) DNA obtained by PCR amplificationof RNA
amplified from the sister of deficient patient; (6) artificial mixture of
99% of mutated BPGM cDNA plasmid DNA and of 1% normal BPGM
cDNA plasmid DNA; (7) artificial mixture of 95% and 5% of .DNAs.
Lanes 6 and 7 were used to have a rough idea of the mRNA levels.
Hybridizationwas performed at 50 C using 5' UP-labeled oligonucleotides M9 (hybridizing with normal DNA) and M10 (with Arg 89 * Cy8
mutation). Washing was performed at room temperature two times
for 2 minutes in 5x SSC + 0.1% sodium dodecyl sulfate (SDS) and 10
minutes in 2x SSC + 0.1% SDS at 54 C. The hybridization and
washing conditions used indicate that both oligonucleotides can
discriminate between normal and mutated DNAs (lanes 1, 2, and 3).
that the propositus' genomic DNA hybridizes equally with the mutated and the normal oligonucleotides (lane 4). and that the amplified
BPGM mRNA from the propositus' sister hybridizeswith both oligonucleotides (lane 5) in a ratio of 5:95 in favor of 89 Arg . Cys mutation as
assayed using artificial mixtures (lanes 6 and 7).
~
-
rcsults from thc dclction of cithcr nuclcotidc C 205 or C 206
(amino acid 19). This framcshift mutation induccs an
abnormal coding scqucncc that cnds prcmaturcly 84 nuclcotidcs downstrcm and corrcsponds to ii thcorctical ahnormal protcin scqucncc of 46 ;imino acids. 19 of thc amino
tcrminal scqucncc of BPGM and an cxtra scqucncc of 27
amino acids. Thc sccond scqucncc obscwcd aftcr nuclcotidc 205 (or 206) rcprcscnts that of thc allclc hcaring thc
89 Arg
Cys mutation. Wc proposc to call thc mutation
previously dcscrihcd RPGM Crctcil Iz7 and thc ncwly
dcscrihcd framcshift mutation RPGM CrCtcil 11.
N o othcr abnormality was found in thc BPGM gcnc
scqucncc. cxccpt for a G + A substitution at nuclcotidc181 in thc promotcr, which was found on both allclcs (ic.
only A was found at this position). Scqucncing of this rcgion
in scvcral normal individuals indicatcd that nuclcotidc
-181 is gcncrally A. iind that thc G polymorphism is lcss
frcqucnt. although it was initially dcscrihcd by Joulin ct iil?'
in thc human DPGM gcnc nuclcotidc scqucncc.
Thc samc polymorphism in thc promotcr and mutations
in thc sccond exon wcrc found both in thc propositus and in
his sistcr. indicating that thcy havc an idcntical gcnotypc.
Study of thc gcnomc of thc propositus' two childrcn
indicatcd that thcy both inhcritcd only thc RPGM CrCtcil I
mutation from thcir fathcr. Thc son is hctcrozygous for thc
-.
Erythrocytc RPGM dcficicncy is a vcry rarc discasc.M
Until now, a fcw paticnts with a partial dcficicncy,"."'.'x.??
and only onc with ii total dcficicncy," wcrc dcscrihcd. In
thc documcntcd cascs. a partial dcficicncy in synthasc
activity induccs a dccrcasc in thc crythrocytc DPG conccntration. A total dcficicncy in synthasc activity induccs an
undctcctahlc lcvcl of DPG. which rcsults in a rcduction in
oxygcn unloading. with thc hypoxia inducing an crythropoictin production rcsulting in polycythcmia.ll
Study of thc pcdigrcc of family M . . . indicatcd that all
thc propositus' sistcrs (Fig I, suhjccts 11-2. 11-3, and 11-4)
havc thc samc gcnctic dcfcct. as shown by crythrocytc
cnzymatic assays. Both parcnts (Fig 1. suhjccts 1-1 and 1-2)
had most probably ii diffcrcnt gcnctic RPGM dcficicncy in
thc hctcrozygous statc. hut thcy could not hc studicd
hccausc thcy dicd bcforc thc discovcry of a RPGM deficit in
thcir son. N o polycythcmia was notcd in cithcr of thcm.
whcrcas it occurs frcqucntly in partial dcficits. All four of
thcir childrcn havc thc samc phcnotypc. and thc samc
gcnotypc for thc two tcstcd (Fig I. suhjccts 11-3 and 11-S).
Without knowlcdgc of thc parcnts' gcnotypc, it is difticult to
cxtrapolatc thc tr;insmission of both RPGM CrCtcil I and
RPGM CrCtcil I 1 mutations. If onc ;issumcs that both
parcnts wcrc hctcrozygotcs for onc of thc two dcfccts. in as
much as thc indcx casc would not havc hccn idcntificd if he
did not hiivc an abnormal phcnotypc. it can thcn hc
calculated that thc odds o f the propositus' sihlings hcing
homozygotcs as ( 1 /4)3 or 1 in 64.Thc gcnotypc of thc two
propositus' childrcn (Fig 1, suhjccts 111-2 and 111-3) follows
ii classical mcndclian scgrcgation of mutations in thc
inhcritancc o f RPGM Crftcil I mutation.
Thc total dcficicncy of thc propositus could havc rcsultcd
from a homozygous statc of RPGM Crftcil I mutation. This
situation sccms unlikcly bccausc thc pcdigrcc is not consanguincous and hccausc thc abnormal cnqmc would havc
hccn found with ;i highcr lcvcl of cxprcssion in vivo. thc
protcin hcing stablc iit 3 P C (30% to 50% of thc normal).
Thcrcforc, thc propositus' gcnotypc is thc rcsult of thc
assdiition of thc BPGM CrCtcil I mutation and anothcr
allelic mutation.
Thc stratcgy followcd to cxaminc thc mutations arising in
thc DPGM gcncs of thc dcficicnt paticnt rclics on PCR
amplification of gcnomic DNA, followcd by dircct scqucncing o f thc PCR products as single-strandcd DNA tcmpl;itcs.35This stratcgy was prcfcrrcd to thc cloning of PCR
products in vectors likc M13, hccausc it givcs faster rcsults.
and hccausc it prcvcnts errors duc to thc Taq polymcrasc
that could hc misintcrprctcd as mutations.%
Thc study of thc naturc of RPGM mRNAs prcscnt in thc
RRCs of thc propositus' sistcr aftcr thc spccific amplification of thc cDNA by PCR tcchniquc indicatcd that thcy arc
not found in cqual amounts. This rcsult rulcd out thc
hypothesis of a largc dclction in thc gcnc, and is consistent
with thc Southcrn blot rcsults. Amplification of RPGM
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2646
LEMARCHANDEL ET AL
A
nt 413 C -+ T = Arg 89 -+ Cys
BPGM Creteil I
nt 205 or 206 C deleted
BPGM Crbteil II
Promoter
El
12
I1
E3
'
I
'A
I
I
I
D4I
d
I
I
I
I
3
-
&
J
1
D7
735 bp
D3
346 bp
D8
1165bp
4
M2
129 bp
B
nt413 C -Ti= Arg 89 + Cys
-!+
&
k
O
B
-
P
G
M Creteil I
P
G
M Creteil II =frameshift mutation
Arg 89 -+ Cys variant
nt 205 or 206 C deleted
-!+
k&
O
B
mRNAs around position 89 associated with the amplification and sequencing of the gene indicated that the two
BPGM mRNAs resulted from the transcription of one
allele bearing a A
C substitution in position 413 (codon
89) and the other bearing a C deletion in position 205 or
206. Therefore, the total BPGM deficiency observed in the
erythrocytes of the propositus and his sisters is the result of
the combination of one allele producing an inactive BPGM,
as previously reported (BPGM CrCteil I),23and one allele
producing low levels of an abnormal peptide not immunologically detectable (BPGM CrCteil 11) or no protein (Fig
3B). Although nucleotide sequences of both alleles were
determined as a mixture in the same experiment, there is no
ambiguity in the results. First, each mutation was present in
association with the normal sequence. Second, both mutations cannot be associated in cis on the same allele. In such
a case, the patient would produce a small peptide from the
mutated allele and normal BPGM by the other allele. In
addition, the mutation Arg 89 + Cys would not be seen
because the frameshift mutation arises before the point
mutation in the BPGM gene. This hypothesis is totally
inconsistent with the previous enzyme assays and purification and structural studies of BPGM CrCtei1.20-23Our
results indicate that both the propositus and his sister most
-+
I
I
Fig 3. Strategy followed for BPGM gene analysis.
(A) Amplification of BPGM gene was performed in
three parts, each containing one exon, the intronexon junction sequences, and the flanking regions
including 5' (promoter) and 3' adjacent regions. Oligonucleotides D3 and D4 were used for amplification of
the promoter region, exon 1, and the junction beD5 and D6 were used for
tween exon land intron l.
amplification of exon 2 and adjacent intron-exon
regions. D7 and D8 were used for amplification of the
intron 2-exon 3 junction, exon 3, and the 3' flanking
region. DNA sequences were determined using oligonucleotides used for PCR experiments as well as
several internal oligonucleotides. For analysis around
the Arg 89 residue located in exon 2, t w o oligonucleotides (M1 and M2) were used. Analysis of PCR
products by AS0 hybridization was performed as
indicated in Fig 2. (6) Genotype of the propositus
(subject 11-5) and of his sister (subject 11-3) with total
BPGM deficiency as determined by molecular biology
study, indicating that both are compound heterozygotes for BPGM Criteil I(point mutation) and BPGM
Criteil II (frameshift mutation) alleles.
probably have the same genetic alterations. It is likely that
the two other sisters (Fig 1, subjects 11-1 and 11-3) who have
the same phenotype and enzymatic defectI9 have this
genotype as well.
The marked decrease of synthase activity in BPGM
CrCteil I has been previously interpreted by Rosa et
taking only into account the fundamental role of the 89 Arg
residue in the binding of monophosphoglycerates during
the enzymatic mechanism. Frameshift mutations are responsible for the lack of production of normal protein, with the
low amount of corresponding mRNA being interpreted as a
relative instability due to untranslatability or low translatability.36
In the course of this study, we were able to detect a
polymorphism in the promoter region of the BPGM gene: a
G -+ A interchange in position -181. This nucleotide is
located in front of an AACCAAT element in the BPGM
promoter shown to bind a CAAT f a ~ t o rand
~ ~to, ~weakly
~
bind the erythroid-specific factor hGATA 139on an overlapping binding site. This mutation does not interfere with the
binding of factors (V. Joulin, V. Mignotte, P.H. RomCo,
and M. Cohen-Solal, unpublished results) and therefore
represents a silent polymorphism in the BPGM gene. This
polymorphism does not induce any restriction site modifica-
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
2647
BISPHOSPHOGLYCERATE MUTASE MUTATIONS
A
NORMAL
G
A
PATIENT
G
T
C
-
A
T
C
-
-T.C 1 8 9 Arg,Cys
NORMAL
G
Rg 4. NucleotMe defects responsible for total
BPGM deficiency. (A) Abnormalities found around
residue 89. The results indicate that in subject 11-5
nucleotide 413C is replaced by A,
from family M
leading t o EPGM Crhteil I mutation (Arg 89 - - Cys) in
an heterozygous state, ie. both C and T are found at
this position (right). (B) Frameshift mutation in exon 2
of EPGM gene in patient 11-5 from family M.
The
nucleotide sequence of the mutant allele is indicated
at the right, in comparison t o its normal counterpart.
Reading the sequence from the bottom t o the top
indicated a unique sequence until residue 205 is
reached, followed by a double sequence due to the
combination of the sequencer of the normal and
mutated alleles. The mutation results from the deletion of one nucleotide, either C 205 or C 206. Such
abnormality induces BPGMCrbteil II mutation (frameshift mutation).
A
T
PATIENT
C
0
A
T
C
nl mutant
. ..
...
-
-G
-A
-G
-G
G
A
G
G
-
144,
tion and can only bc dctcctcd by nuclcotidc scqucncing, in
contrast to Tu9 I and Msp I rcstriction fragmcnt lcngth
polymorphisms (RFLPs) dcscribcd for thc BPGM gcnc.."'
This rcport dcscribcs. at thc gcnc Icvcl, BPGM abnormalitics rcsponsiblc for enzymatic dcficicncy, including thc
case of a paticnt with a complctc dcficicncy with two
diffcrcnt abnormal allclcs. Most RBC cnzymopathics arc
associatcd with hemolytic ancmia and sc" of the rclcvant
mutations have bccn idcntificd by nuclcotidc scquencing'.J'.J' in thc hctcrozygous statc associated with partial
dcficits. Complctc dcficits in RBC cnzymopathics arc less
frcqucnt, cxccpt in malcs whcn an X-linkcd gene is involvcd. We dcscribcd hcrc a case of complctc dcficicncy
rcsulting from thc association of two diffcrcnt mutations in
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
LEMARCHANDEL ET AL
2648
a compound heterozygote. If one of the two abnormalities
was
described by amino acid sequencing Of the
abnormal Protein,23 the other was described during this
work by DNA and RNA analysis methods. It shows that a
combination of techniques at protein, RNA, and DNA
levels can elucidate the genotype of such deficient patients.
ACKNOWLEDGMENT
We thank Drs S. Amselem, M.-C. Garel, J.L. Laplanche, Ph.
LeBoulch, and M. Vidaud for their help during the course of this
work, and Dr M. Fellous for lymphoblastoid cell lines. A.M. Dulac
kindly prepared the manuscript and figures and N. BlumenfeldCharbit reviewed the manuscript.
REFERENCES
1. Benesch R, Benesch RE: The effect of organic phosphates
from the human erythrocyte on the allosteric properties of hemoglobin. Biochem Biophys Res Commun 26:162, 1967
2. Rapoport S, Luebering J: The formation of 2,3-diphosphoglycerate in rabbit erythrocytes: The existence of a diphosphoglycerate
mutase. J Biol Chem 183:507,1950
3. Rosa R, Gaillardon J, Rosa J: Diphosphoglycerate mutase
and 2,3-diphosphoglycerate phosphatase activities of red cells:
Comparative electrophoretic study. Biochem Biophys Res Commun 51:536,1973
4. Harkness DR, Isaaks RE, Roth SC: Purification and properties of 2,3-bisphosphoglycerate phosphatase-mutase from erythrocytes of day-old chicks. Eur J Biochem 78:343,1977
5. Sasaki R, Ikura K, Sugimoto E, Chiba H: Purification of
bisphosphoglycero-mutase, 2,3-bisphosphoglycerate phosphatase
and phosphoglyceromutase from human erythrocytes. Three enzyme activities in one protein. Eur J Biochem 50:581, 1975
6. Sasaki R, Ikura K, Narita H, Yanagama S-I, Chiba H:
2,3-Bisphosphoglycerate in erythroid cells. Trends Biochem Sci
7:140, 1982
7. Rosa R, Audit I, Rosa J: Evidence for three enzymatic
activities in one electrophoretic band of 3-phosphoglycerate mutase from red cells. Biochimie 57:1059, 1975
8. Fothergill-Gilmore LA, Watson HC: The phosphoglycerate
mutases. Adv Enzymol62:227,1989
9. Benesch R, Benesch RE: Reciprocal binding of oxygen and
diphosphoglycerate by human hemoglobin. Biochemistry 59:526,
1968
10. Bunn HF, Forget BG: Oxygen and carbon dioxide transport
in health and disease, in Bunn HF, Forget BG (eds): Hemoglobin:
Molecular, Genetic and Clinical Aspects. Philadelphia, PA, Saunders, 1986, p 91
11. Harkness DR, Roth S , Goldman P, Kim C, Isaaks RE:
Studies on a large kindred with hemolytic anemia and low
erythrocyte 2,3-DPG, in Brewer GJ (eds): The Red Cell. New
York, NY,Liss, 1978, p 251
12. Travis SF, Martinez J, Garvin J, Atwater J, Gillmer P: Study
of a kindred with partial deficiency of red cell 2,3-DPGM and
compensated hemolysis. Blood 51:1107,1978
13. Bowdler AJ, Prankerd TAJ: Studies in congenital nonspherocytic haemolytic anaemias with specific enzyme defects.
Acta Haematol31:65,1964
14. Alagille D, Fleury J, Odievre M: DCficit congenital en
2,3-diphosphoglycCro-mutase. Bull Mem SOC Med H6p Paris
115:493, 1964
15. Lohr GX, Waller HD: Zur Biochemie einiger angeborener
hamolytischer Anamien. Folia Haematol (Leipz) 8:377,1963
16. Schroter W: Kongenitale nictspharo cytare hamolytische
Anamie bei 2,3-Diphosphoglyceratmutase. Mangel der erythrocyten im fruhen Sauglingsalter. Klin Wochenschr 43:1147, 1965
17. Rosa R, Prthu M-0, Beuzard Y, Rosa J: The first case of a
complete deficiency of diphosphoglycerate mutase in human erythrocytes. J Clin Invest 62:907,1978
18. Labie D, Leroux J-P, Najman A, Reyrolle C: Familial
diphosphoglycerate mutase deficiency. Influence on the oxygen
affinity curves of hemoglobin. FEBS Lett 9:37, 1970
19. GalactCros F, Rosa R, PrChu M-0, Najean Y, Calvin M-C:
DCficit en diphosphoglyckrate mutase: Nouveaux cas associks i
une polyglobulie. Nouv Rev Fr Hematol26:69, 1984
20. Peterson LL: Red cell diphosphoglycerate mutase. Immunochemical studies in vertebrate red cells, including a human variant
lacking 2,3-DPG. Blood 52:953, 1978
21. Rosa R, PrChu M-0, Albrecht-Ellmer K, Calvin M-C:
Partial characterization of the inactive mutant form of human red
cell bisphosphoglyceromutase and comparison with an alkylated
form. Biochim Biophys Acta 742:243,1983
22. Calvin M-C, Prehu M-0, Kechemir D, Villeval J-L, Rosa R:
An immunochemical method for detecting an inactive enzyme
(bisphosphoglyceromutase) after cellogel electrophoresis. Electrophoresis 6:567, 1985
23. Rosa R, Blouquit Y, Calvin M-C, Prom6 D, Prome J-C, Rosa
J: Isolation characterization, and structure of a mutant 89 Arg +
Cys bisphosphoglycerate mutase. Implication of the active site in
the mutation. J Biol Chem 264:7837,1989
24. Joulin V, Peduzzi J, Romto P-H, Rosa R, Valentin C,
Dubart A, Lapeyre B, Blouquit Y, Garel MC, Goossens M, Rosa J,
Cohen-Sola1 M: Molecular cloning and sequencing of human
erythrocyte 2,3-bisphosphoglycerate mutase; revised amino acid
sequence. EMBO J 5:2275,1986
25. Joulin V, Garel M-C, LeBoulch P, Valentin C, Rosa R, Rosa
J, Cohen-Sola1 M: Isolation and characterization of the human
2,3-bisphosphoglycerate mutase gene. J Biol Chem 263:15782,1988
26. Blin N, Stafford DW: A general method for isolation of high
molecular weight DNA from eukaryotes. Nucleic Acids Res
3:2303,1976
27. Sambrook J, Fritsch EF, Maniatis T Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1989
28. Itoh N, Nose K, Okamoto H: Purification and characterization of proinsulin from rat B-cell tumor. Eur J Biochem 97:1, 1979
29. Saiki RK, Gelfand DH, Stoffel SJ, Scharf SJ, Higuchi R,
Horn GT, Mullis KB, Erlich H A Primer-directed enzymatic
amplification of DNA with a thermostable DNA polymerase.
Science 239:487, 1988
30. Garel M-C, Joulin V, LeBoulch P, Calvin M-C, PrChu M-0,
Arous N, Longin R, Rosa R, Rosa J, Cohen-Sola1 M: Human
bisphosphoglycerate mutase. Expression in Escherichia coli and
use of site-directed mutagenesis in the evaluation of the role of the
carboxyl-terminal region in the enzymatic mechanism. J Biol Chem
264:18966,1989
31. Sanger F, Nicklen S, Coulson R: DNA sequencing with
chain terminating inhibitors. Proc Natl Acad Sci USA 74:5463,
1977
32. Tabor S, Richardson CC: DNA sequence analysis with a
modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci
USA 84:4767,1987
33. Rosa R, GalactCros F, PrChu MO, Calvin MC: Inactive
bisphosphoglycerate mutase variants: New data. Biomed Biochim
Acta 46:S207,1987
34. Tanaka KR, Zerez CR: Red cell enzymopathies of the
glycolytic pathway. Semin Hematol27:165,1990
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
BISPHOSPHOGLYCERATE MUTASE MUTATIONS
35. Attree 0,Vidaud D, Vidaud M, Amselem S, Lavergne J-M,
Goossens M: Mutations in the catalytic domain of human coagulation factor-IX: Rapid characterization by direct genomic sequencing of DNA fragments displaying an altered melting behavior.
Genomics 4:266, 1989
36. Takeshita K, Forget BG, Scarpa A, Benz EJ Jr: Intranuclear
defect in P-globin mRNA accumulation due to a premature
translation termination codon. Blood 64:13,1984
37. Chodosh LA, Olesen J, Hahn S, Baldwin AS, Guarente L,
Sharp P A A yeast and a human CCAAT-binding protein have
heterologous subunits that are functionally interchangeable. Cell
53:25, 1988
38. Gallinari P, La Bella F, Heintz N: Characterization and
purification of HlTF2, a novel CCAAT-binding protein that
2649
interacts with a histone H1 subtype specific consensus element.
Mol Cell Biol9:1566,1989
39. Wall L, de Boer E, Grosveld F The human P-globin gene 3’
enhancer contains multiple binding sites for an elythroid-specific
protein. Genes Dev 2:1089,1988
40. Dracopoli NC, Feltquate DM, Sam B, Schartl M: TaqI and
MspI RFLPs are detected by the human 2,3-bisphosphoglycerate
mutase (BPGM) cDNA. Nucleic Acids Res 18:1928,1990
41. Miwa S: Molecular basis of red cell enzymopathies associated with hereditary nonspherocytic hemolytic anemia. Haematologia 22215,1989
42. Beutler E: Glucose-6-phosphate dehydrogenase deficiency.
N Engl J Med 324:169,1991
From www.bloodjournal.org by guest on February 6, 2015. For personal use only.
1992 80: 2643-2649
Compound heterozygosity in a complete erythrocyte
bisphosphoglycerate mutase deficiency
V Lemarchandel, V Joulin, C Valentin, R Rosa, F Galacteros, J Rosa and M Cohen- Solal
Updated information and services can be found at:
http://www.bloodjournal.org/content/80/10/2643.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.