PDF completo - Nieto Editores

I
SSN01864866
Vol
umen30
Supl
ement
o1,2014
Res
úmenesdel
1erCongr
es
oPanamer
i
c
anoy
XXXVI
I
Congr
es
oNac
i
onal
deMedi
c
i
naI
nt
er
na
12al
15denovi
embr
e,
2014
Ac
apul
c
o,
Guer
r
er
o
REVI
STADEL COLEGI
O DEMEDI
CI
NAI
NTERNADEMÉXI
CO
I
ndi
z
adaen:Ar
t
emi
s
a(
CENI
DS)•Per
i
ódi
c
a•Di
r
ec
t
or
i
odeRev
i
s
t
asLat
i
ndex•LI
LACS•Ni
v
el
1.I
ns
t
i
t
ut
osNac
i
onal
esdeSal
ud•EBSCO
www.
ni
et
oedi
t
or
es
.
c
om.
mx•www.
medi
net
.
net
.
mx
Medicina
Interna
de México
Colegio de Medicina
Interna de México AC
Consejo Directivo
2013-2014
Presidente
Alejandro Cárdenas Cejudo
Vicepresidente
Rodolfo Cano Jiménez
Secretario General
Carlos Lenin Pliego Reyes
Secretario de Actividades Científicas
Alfredo Torres Viloria
Pro Tesorero
Edith Flores Hernández
Vocal de Admisión y Filiales
José Luis Antonio Toriz Melchor
Vocal de Comunicación Social
Virginia Hipólita Sánchez Hernández
Primer Secretario Suplente
José Juan Lozano Nuevo
Segundo Secretario Suplente
María del Pilar Cruz Domínguez
Vocal Suplente de Comunicación Social
Carlos Lijtszain Sklar
Vocal Suplente de Admisión y Filiales
Faustino Morales Gómez
Editor
Manuel Ramiro H.
Coeditor
Asisclo de Jesús Villagómez
Consejo Editorial
David Kersenobich
Alberto Lifshitz G.
Adolfo Martínez-Palomo
Guillermo J. Ruiz-Argüelles
José Sifuentes Osornio
Roberto Tapia Conyer
Olga Lidia Vera Lastra
Niels Wacher R.
Comité Editorial Internacional
Jaime Merino (España)
Daniel Sereni (Francia)
Alberto Malliani (Italia)
Cristopher Davidson (Inglaterra)
Enrique Caballero (Estados Unidos)
Estefan Lindgren (Suecia)
Jan Willem Felte (Países Bajos)
Comisiones Especiales
Comisión de Educación Médica
César Alejandro Arce Salinas
Francisco Rafael Anaya Gómez
Comisión de Ética Médica y Bioética
María del Carmen Cedillo Pérez
María Antonieta Calderón Márquez
Comisión de Peritos y Servicio Social
Profesional
Joaquín Zúñiga Madrazo
Eduardo Meneses Sierra
Comisión Editorial
Alberto Lifshitz
José Halabe Ch.
Ricardo Juárez Ocaña
Comisión de Honor y Justicia
Manuel Ramiro Hernández
Comisión de Relaciones Internacionales
Víctor Huggo Córdova Pluma
Haiko Nellen Hummel
Comisión de Investigación
Guadalupe Castro Martínez
Alberto F Rubio Guerra
Comisión de Difusión de la Medicina Interna
Rodolfo de Jesús Palencia Vizcarra
www.nietoeditores.com.mx
Volumen 30
Suplemento 1, 2014
La revista Medicina Interna de México es el órgano oficial del Colegio de Medicina Interna de México. Revista
bimestral. Editor responsable: Enrique Nieto R. Reserva
de Título de la Dirección General del Derecho de Autor
(SEP) número 04-2008-011713163100-102. Certificado
de Licitud de Título número 11967 y Certificado de
Licitud de Contenido de la Comisión Calificadora de
Publicaciones y Revistas Ilustradas (SeGob) número
8375. Autorizada por SEPOMEX como Publicación
Periódica. Registro número PP09-1501. Publicación
indizada en Periódica (http://dgb.unam.mx/periodica/
html), en el Directorio de Revistas Latindex (http://
www.latindex.org), en la Base de Datos Internacional
de EBSCO (MedicLatina) y en LILACS.
Publicación realizada, comercializada y distribuida por
EDICIÓN Y FARMACIA, SA de CV. Domicilio de la
publicación: José Martí 55, colonia Escandón, México
11800, DF. Tel.: 5678-2811. Fax: 5678-4947. E-mail:
articulos@nietoeditores.com.mx
El contenido de los artículos firmados es responsabilidad
de sus autores. Todos los derechos están reservados de
acuerdo con la Convención Latinoamericana y la Convención Internacional de Derechos de Autor. Ninguna
parte de esta revista podrá ser reproducida por ningún
medio, incluso electrónico, ni traducida a otros idiomas,
sin autorización de sus editores. Impresa por Grupo Art
Graph, S.A. de C.V., Av. Peñuelas 15-D, Col. San Pedrito
Peñuelas, Querétaro 76148, Qro., Tel.:(442) 220 8969.
La suscripción de esta revista forma parte de los servicios que el Colegio de Medicina Interna de México
otorga a sus agremiados al corriente en el pago de sus
cuotas anuales.
Medicina
Interna
de México
Volumen 30, Suplemento 1, 2014
CONTENIDO
El contenido de este suplemento se reproduce tal cual
se recibió por parte de los autores
CASOS CLÍNICOS
S1
Intoxicación digitálica en paciente tratado con claritromicina
JAJ Batún Garrido, E Hernández Núñez, F Olán
S1Origen anómalo de coronaria derecha y miocardiopatía
hipertrófica obstructiva. Reporte de caso
Luis Carlos Álvarez Torrecilla, Alejandra Ruiz Fuentes,
Carlos Augusto Contreras Martínez, Julian Gerardo
Hurtado Garibay, Elizabeth Armijo Yescas, Abel Solorio
Razo
S2Aneurisma de la arteria pulmonar asociado a comunicación interauricular. Reporte de caso
Luis Carlos Álvarez Torrecilla, Alejandra Ruiz Fuentes,
Priscila Méndez Martínez, Roberto Álvarez Saucedo,
Mario Salcedo Roldán
S3
Hemopericardio y salto de bungee. Reporte de un caso
José Mauricio Cedillo Fernández, Brenda Gómez Gómez,
Alejandra Alarcón Sotelo, María José Pardinas Llergo,
Enrique Juan Díaz Greene, Federico Leopoldo Rodríguez
Weber
S4Disfunción microvascular coronaria
JO Duarte Flores, JN López Taboada, DM Dueñas Tamayo, T Velázquez Gaspar, JR García Díaz
S4Aneurisma gigante de la arteria coronaria derecha en
un paciente con tuberculosis ganglionar
Luis Alfonso Marroquin Donday, Alejandro Ricalde Alcocer, Jaime Galindo Uribe, Zuilma Yurith Vázquez Ortiz
S5
Pentalogía de Fallot en mujer de 36 años, nunca intervenida quirúrgicamente
Mario Alexander López Cauich, Luis Alberto Pérez Ortiz,
Oscar Faibre Álvarez, Alejandro Quintín Barrat Hernández
S6Amiloidosis cardiaca. Reporte de un caso y revisión de
la literatura
Ivonne Samantha García López, Rocío Mendoza Chávez,
Ricardo Reyes Parra, Leticia Lira Rivera, Jorge Mendoza
Balanzario
S6
Síndrome de Eisenmenger y embarazo. A propósito de
dos casos
María del Rosario Estrada Falcón, Rusvel Rincón Pozo
S7
Cardiomiopatía por estrés: reporte de 2 casos
Luis Alberto Pérez Ortiz, Mario Alexander López Cauich,
Oscar Faibre Álvarez
S8
Puente miocárdico con fenómeno de ordeñamiento
coronario, como causa de angina inestable
Gabriela González Rodríguez, Gabriel Arturo Ramos
López, Ayax Nivardo Sobrino Saavedra, Paola Elizabeth
Díaz Aceves, María de La Luz Machuca R
S8
Hipopituitarismo como manifestación de aneurisma
cerebral. Reporte de un caso
CE Garnica Camacho, F Gutiérrez Manjarrez, A Ornelas
S9Neoplasia endocrina múltiple tipo 2 A. Presentación de
un caso
Hugo Alberto Arellano Sotelo, Erica García Valadés,
Arturo Delgado Pesero, Javier Alan Domínguez Castillo,
Nallely Sandoval García
S10
Parálisis hipocalémica secundaria a enfermedad de
Graves
Sugely Fonseca Martínez, A Suárez Zaizar, J Carrizales
Luna, M Herrera Pérez, M Sánchez Ávila, V Sánchez Nava
S10
Insulinoma: reporte de caso
José Miguel Álvarez Blanco, Raúl Eugenio Valdés Galván,
Mireya Citlalli Pérez Guzmán, Héctor Montiel Falcón,
Joaquín Gerardo Joya Galeana, Javier Macías
S11
Rabdomiólisis asociado a hipotiroidismo
Laura Patricia Whittall García, Leidy Jineth Díaz Villar,
Blanca María Castillo Morfín, Eduardo Martínez Hernández, Diana Castellanos Rodríguez
S12
Hipercalcemia secundaria a enfermedad granulomatosa:
reporte de un caso
Angélica Juárez López, Iván Darío Hernández Erazo, Janeth Realpe Díaz, Nadia Alejandra Gandarilla Martínez,
Jazmín Teresa Pozos López
S12
Hipoglucemia como manifestación de hipocortisolismo
y silla turca vacía
Rocío Morales Delgado, Azucena Zapata Rivera, Karla
Victoria Rodríguez Velver, Dionicio Galarza Delgado
S13
Hipertensión arterial pulmonar, pancitopenia y colestasis intrahepática: manifestaciones atípicas de la
enfermedad de Graves
Luisa Geraldine Villanueva Rodríguez, Raúl Rivera Moscoso, Francisco Gómez Pérez
S14Enfermedad poliquística hepática no asociada a enfermedad renal poliquística autosómica dominante
JAJ Batún Garrido, E Hernández Núñez, F Olán
S15
Enfermedad celiaca con biopsia normal. A propósito de
un caso
www.nietoeditores.com.mx
Contenido
José de Jesús Casillas Plascencia, Hugo Alberto Arellano Sotelo, Nallely Sandoval García, Juan Francisco
Soto Bañuelos, Erica García Valadés
S15
Síndrome de Budd-Chiari asociado con carcinoma
renal. Reporte de caso
Adrián Pérez Toledo, Gabriela Olguín Contreras,
Héctor Infante Sierra, Cintya Barajas Toledo, Guadalupe Ferrer Burgos, Carlos Rodríguez Zúñiga
S16
Síndrome de Banti
G Ordoñez Vázquez, MG López Cruz, G Gómez
Ochoa, G Pérez Bustamante, F Vásquez Manuel
S17
Hepatitis autoinmunitaria. Presentación de un caso
PV García Piza, JL Quiroz Gaytán
S17
Uso de sistema MARS en falla hepática por hepatitis autoinmunitaria con síndrome hepatorrenal:
reporte de un caso
David Omar Rodríguez Gómez, Laura Esthela Cisneros Garza
S18
Hepatitis hipóxica. Reporte de caso
Adrián Pérez Toledo, Laura Gabriela Amador Reyes,
Juan Carlos Guerrero Nava, Pedro Alberto Verdeja
Padilla, Eduardo Federico Hammeken Larrondo
S19
Infliximab y sirolimus como inductores de remisión
en colitis ulcerativa fulminante refractaria
Oscar Morales Gutiérrez, Álvaro Cabrera García,
José Ángel Lara Sánchez, María Elena López Acosta,
Roberto Ovilla Martínez
S19
Insuficiencia hepática fulminante secundaria al uso
de suplementos herbolarios: reporte de un caso
Yesenia Ortiz Montaño, Jesús Ojino Sosa García,
Teresa de la Torre León
S20
Hepatitis tóxica aguda secundaria a ingesta de
suplemento alimenticio. Reporte de un caso
Jorge Luis Trejo Morales, Adria Jazmín Almada Córdova, Jovanni Camacho Santana
S21
Psicosis inducida por esteroide en el anciano
Nallely Solano Rodríguez, Norma Leticia Esperanza
Castro, Saul Huerta Ramírez
S21
Síndrome hemofagocítico por herpes virus humano
8 en paciente inmunocomprometido
Lucía V Maya Piña, Edgar E Medina Murillo, S Martínez Romero, H Infante Sierra, V Ahumada Topete
S22
Complicaciones hematológicas inducidas por dapsona
L Alcaraz Gaytán, R Gutiérrez Padilla, J Fernández
Hernández, A Rocha García
S23
Púrpura palpable diagnóstico diferencial. A propósito de 2 casos clínicos
Heidi Hernández Ramírez, C Flores Lorenzo
S23
Hemofilia adquirida tipo A (AHA) como expresión
del virus de inmunodeficiencia humana (VIH):
reporte de un rara asociación
E Hernández Núñez, AJ Vargas Bernal, F Olán
S24
Macroglobulinemia de Waldenström con amiloidosis secundaria
JO Duarte Flores, JA Barrios González, JN López
Taboada
S25
Inmunodeficiencia común variable como causa de
fiebre de origen desconocido
MA Flores Méndez, F Briceño Moya, F González
Márquez
S25
Trombosis porto-espleno-mesentérica una condición clínica poco frecuente
Hugo Millán Aguilar
www.nietoeditores.com.mx
S26
Coproporfiria hereditaria: reporte de un caso
O Ruvalcaba Pérez, LF Pineda Galindo
S27Aplasia pura de serie roja por parvovirus B19 en
paciente con VIH
Beatriz Alejandra Castellanos Ledesma, Pilar Benítez
Cejudo
S27
Síndrome de plaquetas pegajosas tipo II agregado
a trombofilias hereditarias
Christian Gerardo Alfaro Rivera, Clotilde Guadalupe
Ramírez Barrragán, Miguel Ángel Velázquez Ferrari,
Eloy Medina Ruíz
S28
Trombolisis con alteplase en el manejo de embolia
pulmonar aguda masiva en embarazo de 11 semanas de gestación
Juan Isaac Reyes Sepeda, Brenda Izuki López Benjume, David Hernández Pérez, José Juan Ceballos
Macías, Arturo Javier Cervantes Ramos, Jessica Martine Tebar, Laura Álvarez Gutiérrez, Enrique Figueroa
Genis
S29Aplasia pura de células rojas como causa infrecuente de anemia en lupus
Eugenia Saldarriaga, Carlos Escalante Penagos,
Cinthia Álvarez Sánchez, Darío Aguirre Hernán,
Andrés Felipe Posada
S29 Mielofibrosis primaria expresada como fiebre de
origen desconocido
Leslie Moranchel García, Brenda Grisel Rodríguez
Corchado, Sergio Alberto Mendoza Álvarez
S30
Hemofilia adquirida posparto: reporte de caso y
revisión de la literatura
Ana Lucia Diez de Sollano Basila, Jesús Martínez
Gutiérrez, Cristina Moreno del Castillo, Luis Antonio
Meillon García
S31Anemia hemolítica autoinmune como presentación
clínica de síndrome crioglobulinémico
Alejandra Ruiz Fuentes, Luis Carlos Álvarez Torrecilla,
Pamela Teresa Mendoza Barradas, Ivette Denisse
Bonilla Gudiño
S31 Abscesos hepáticos múltiples asociados con cáncer
de colon como causa de fiebre de origen oscuro
ED Zavala Álvarez, JM Sánchez Sánchez
S32
Tuberculosis ovárica y peritoneal simulando malignidad ovárica y carcinomatosis peritoneal
JAJ Batún Garrido, N Valencia Serrano, F Olán, E
Hernández Núñez
S33Aspergilosis y nocardiosis en una paciente con
tuberculosis pulmonar
JAJ Batún Garrido, N Valencia Serrano, E Hernández
Núñez, F Olán
S33
Megacolon tóxico: Reporte de un caso
JAJ Batún Garrido, E Hernández Núñez, F Olán
S34
Abscesos paravertebrales secundarios a tuberculosis. A propósito de un caso
Hugo Alberto Arellano Sotelo, Kristian Javier Navarrete Becerra, Nallely Sandoval García, Priscila
Alejandra Hernández Cortés, Dea Sosa Gaona, Erica
García Valadés
S35
Reporte de caso: endocarditis infecciosa con abscesovegetación y lesión mitral por Kocuria rosea
José Antonio Espino Moreno, Leonel Olivas Salazar,
José Ángel Ramírez Rodríguez, Israel Guerrero Díaz
S35
Coccidioidomicosis pleural
José Luis Ramos Martínez, Melissa Hughes García,
Carlos Alberto Hernández Osorio
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
S36
Polirradiculopatía desmielinizante como presentación clínica de enfermedad de Lyme
JP Carrizales Luna, MT Sánchez Ávila, A Suárez
Zaizar, S Fonseca Martínez
S37
Síndrome oculoglandular de Parinaud: reporte de
un caso
José Mauricio Cedillo Fernández, Diego Sarre
Álvarez, María José Pardinas Llergo, Enrique Juan
Díaz Greene, Federico Leopoldo Rodríguez Weber,
Ricardo Cabrera Jardines
S37
Piomiositis tropical. Uso de la resonancia magnética, a propósito de un caso
Ana Margarita García Ortíz, Juan Carlos Salas Ruiz,
Mónica Arenas Ceja
S38Leishmaniosis cutánea diseminada con manifestaciones neurológicas, en un paciente inmunocomprometido
Francisco Ruiz Pons, M Muñoz Campos, JM Vasconcelos Rueda
S39
Tuberculosis peritoneal simulando adenocarcinoma
mucinoso de ovario. Reporte de un caso
Israel Sánchez Álvarez, Marisol Hernández López,
Yolanda Gálvez Molina, Darío Vargas Torres, Federico
William Von Son De Fernex
S39
Falla orgánica múltiple secundaria a fiebre Q:
reporte de caso
María Cristina Moreno del Castillo, Javier José Hernández Buen Abad, Fernando Magaña Campos, Luis
Espinosa
S40Autoinmunidad vs infección en una paciente con
meningitis aséptica: ¿ANAS útiles o distractor?
Aldo Esteban Torres Ortiz, María Teresa Sánchez
Ávila
S41
Tétanos generalizado. A propósito de un caso
Claudia Luna Maya, David Añorve Clavel, Eduardo
Cabrera Figueroa
S41
Nefritis tubulointersticial aguda secundaria a virus
de inmunodeficiencia humana
XL Alvarado Sánchez, JA Reyes Loaeza, G Pérez
Bustamante, J Canseco González
S42
Neuroborreliosis con parálisis del VI y VII nervios
craneales. Caso clínico
Verónica Leonor Bracamonte Curiel, David Joel
Guerrero Vázquez, Luis Javier Jara Quezada, José
de Jesús Peralta Romero
S43
Colitis pseudomembranosa en paciente sin enfermedades crónicas previas, no asociada con clindamicina
Antonio Cruz Estrada, Diana Castellanos Rodríguez,
Johanna Elizabeth Paredes Sánchez, Alicia Elizabeth
Navarro Estrada
S43
Mucormicosis en un paciente sin factores de riesgo
Melissa Guadalupe Rodríguez González, Zeithel Kareli Verdugo Zazueta, Miriam Tamara Matus Román,
Carlos Alberto Kawano Soto
S44
Neurosífilis y polineuropatía inflamatoria desmielinizante crónica en paciente con VIH
Tannya Velázquez Gaspar, José Nazario López Taboada, Juan Ramón García Díaz, José Octavio Duarte
Flores, Dalia María Dueñas Tamayo
S45
Absceso pulmonar por Kocuria varians en paciente
inmunocomprometido
Alberto Suárez Zaizar, S Fonseca Martínez, J Carrizales Luna, J Paredes Vázquez, L Lunares Dueñas, G
López Bernal
S46
Fiebre de origen desconocido por citomegalovirus
Mario Alberto García Esquivel, Hiram Vela, Carlos
Lenin Pliego, Martín Peña Collazo
S46Reporte de caso: Rickettsiosis
José Antonio Espino Moreno, José Ángel Ramírez
Rodríguez, José Luis Pacheco Hernández
S47
Abscesos hepáticos tuberculosos como presentación
infrecuente de tuberculosis extrapulmonar. Reporte
de un caso
Sandra Ivet Domínguez Valdez, Estrellita Cortez Carrera, Flor Elena Rojas Terrazas, Ulises Emmanuel Guadalupe Mouret Hernández, Fernando Villalobos Guerrero,
Ivonne García López, Rocío Mendoza Chávez
S48
Micetoma torácico con afección visceral: Presentación de un caso clínico
Diana Sarai López González, Karina Teresita González
Rodríguez, Ulises Hernández Rolon, Leticia Ramírez
García, Enrique Rodríguez Franco, Luis Javier Castro
D´Franchis, Dulce Valeria Copca Nieto, Dinorah
Alemán Domínguez, Maricarmen Lagunas Alvarado
S48Tularemia ulceroglandular: reporte de caso
Juan Carlos Lara Castañeda, Daniel Iván Arroyo
Espinosa, Ernesto Eduardo Echeagaray Guerrero,
Rodrigo Torres Baranda
S49
Abscesos cerebrales por Listeria monocytogenes:
reporte de caso y revisión de literatura
Antonio Jordan Ríos, Paola Estefanía Bermúdez Bermejo, Laura Elena Jáuregui Camargo, Marco Antonio
Alegría Loyola
S50
Tuberculomas cerebrales que simulan meningiomas
en un paciente inmunocompetente con tuberculosis
miliar
Sergio Alberto Mendoza Álvarez, Fabiola González
Márquez, Citlalli Fernández Vivar
S50
Histoplasmosis diseminada como presentación de
deficiencia de mieloperoxidasa
Álvaro López Iñiguez, Aldo Olmedo Gaytán, Amado Jiménez Ruíz, Israel Anaya Silva, Ezequiel Vélez
Gómez, Alejandro Bravo Cuellar
S51
Hepatoesplenitis granulomatosa como presentación
de fiebre de origen oscuro en paciente inmunocompetente. Reporte de un caso
JE Hernández Utrera, SA Mendoza Álvarez, LLL
Navas Alemán
S52Reporte de caso: pericarditis por virus de EpsteinBarr en paciente inmunocompetente
Carlos Martínez Zavala, Alejandro Rivera Mora,
Stephanie Anely Rodríguez Fabián
S53
Hipertensión arterial pulmonar asociada a infección
por VIH. Revisión de un caso
Ariadna Aguíñiga Rodríguez, Laura Castro Castrezana, Rogelio David Castro Vallejo, Yazmín Moctezuma
Montaño, Laura Torres Rosas, María Fernanda Espeso
Robles, Carlos Márquez García
S53
Retención urinaria aguda: debut de encefalomielitis
aguda diseminada posinfecciosa. Reporte de caso
Diana Arlett Herrera Madrid, Nerina del Carmen
Fernández Martínez, Verónica Montes Martínez
S54
Mucormicosis postraumática en un paciente
inmunocompetente: osteomielitis craneal, una
manifestación inusual
Román Zamora Gómez, Isaías Ceballos Arellano,
Ramón Oscar René Villegas Loera, Karla García
Osuna
www.nietoeditores.com.mx
Contenido
S55
Tuberculosis pancreática en una paciente con síndrome de inmunodeficiencia adquirida. Reporte de
un caso
Yesenia Ortiz Montaño, Jesús Ojino Sosa García,
Teresa de la Torre León
S55
Infección masiva por Leptospira en una paciente
con leucemia mieloide crónica: reporte de un caso
Jorge García Méndez, Daniel Atilano López, Ericka
Carrillo Casas, Eduardo Cervera Ceballos
S56
Síndrome de uñas amarillas asociado a síndrome
nefrótico
JAJ Batún Garrido, E Hernández Núñez, F Olán
S57Nefropatía por depósitos de C1q: reporte de caso
y revisión
Triana Gabriela Salgado Muñoz, Isaac Morones Esquivel, Teresa Ivonne Gonzaga López, Adriana Paula
Matamoros Mejía, Maricarmen Lagunas Alvarado,
Diana Sarai López González, Dinorah Alemán Domínguez, Araceli Cruz Rodríguez, Luis Javier Castro
D’Franchis
S57
Síndrome de Alport. Reporte de un caso
Jessica Noriega Flores, María Elisa González Renteria,
Roxana Villca González
S58
Rabdomiólisis secundaria a fenoverina y nefritis
tubulointersticial difusa por quinolonas: una asociación infrecuente
Diana Garnica Chávez, María Augusta Pacheco Arias,
Roberto Andrés B
S59Glomerulonefritis focal y segmentaria asociada a
virus de inmunodeficiencia humana
Rubén Antonio Gómez Mendoza, Ericka Carrillo
Velázquez
S59
Calcinosis tumoral urémica-hiperfosfatémica en
enfermedad renal crónica e hiperparatiroidismo.
Serie de casos
Guillermo Flores, Martín Armado Ríos Ayala, Paolo
Alberti Minutti, José Fabián Martínez Herrera, Francisco Javier Ramos Aguilar, Christian Martínez Pérez
S60
Esclerosis lateral amiotrófica: reporte de caso
José Ángel Ramírez Rodríguez, Esteban Monroy
Barrera, Francisco Israel Guerrero Díaz
S61
Secuestro pulmonar en un paciente adolescente.
Reporte de un caso
Luis Francisco Valdés Corona, P Soberanis Piña, J
Pedroza Granados, C Del Bosque Patoni, F Videgaray
Ortega
S61
Síndrome de Hammans con compromiso a canal
raquídeo. Revisión de un caso
Ariadna Aguiñiga Rodríguez, Joel Alonso Cortez Sarabia, Czestochowa Del Moral Stevenel, Yazmin Moctezuma Montaño, José Guadalupe Hidalgo Delgado,
Ramón García Díaz, Octavio Duarte Flores, Dalia
María Dueñas Tamayo, Tannya Velázquez Gaspar
S62
Síndrome de Osler Weber Rendu
Evelín García Barboza, Roberto Rivelino López
Anguiano, Fernando Flores Trujillo
S63
Síndrome de encefalopatía posterior reversible
(PRES) asociado a inmunosupresores. Reporte de
un caso clínico
Jaime Enrique Hernández Utrera, Claudia Monreal
Alcántara, Devora Adalid Arellano
S63Neuropatía óptica isquémica anterior no arterítica:
manifestación inicial de síndrome antifosfolipídico
en una mujer de 35 años
www.nietoeditores.com.mx
L Ramírez Gómez, G Pérez Bustamante, F Vásquez
Manuel, S Galindo Feria, D De Los Ríos Obregón,
D Magos Rodríguez, R Williams De Roux, F Vega
Boada
S64
Síndrome de Bruns. Reporte de un caso
Carolina C Ramírez Gómez, J Orozco Paredes
S65Ataque isquémico transitorio como manifestación
inicial de metástasis cerebral por mixoma auricular
Nubia Delil Osorio Jáuregui, Leonardo René Hernández Matamoros, Roberto Flores Trejo
S66
Síndrome de Rendu-Osler-Weber
Guadalupe Gómez Ochoa, M López Cruz, G Ordoñez Vázquez, G Pérez Bustamante
S66
Síndrome de Charcot-Marie Tooth: reporte de un
caso
Juan Ramón García Díaz, A Aguiñiga Rodríguez, T
Velázquez Gaspar, JO Duarte Flores, DM Dueñas
Tamayo, C Del Moral Stevenel, JA Cortés Sarabia
S67
Síndrome de Klippel-Trenaunay-Weber y trombosis
venosa cerebral. Reporte de caso
Rodolfo Ramírez del Pilar, María Berenice Rodríguez y Rodríguez, Araceli Cruz Rodríguez, Teresa
Ivonne Gonzaga López, Mónica Gonzaga López,
Manuel Martínez Ramos Méndez, Luis Javier Castro D´Franchis, Abraham Emilio Reyes Jiménez, M
Labastida Bautista
S68
Mielitis transversa por virus herpes simple en paciente inmunocompetente
Tannya Velázquez Gaspar, José Nazario López Taboada, Juan Ramón García Díaz, José Octavio Duarte
Flores, Dalia María Dueñas Tamayo, Joel Alonso
Cortés Sarabia, Czestochowa Del Moral Stevenel
S68
Intoxicación subaguda por arsénico. Reporte de
caso y revisión de la literatura
Eduardo Fernández Campuzano, Valentín Trujillo,
Aili García Tuomola
S69
Presentación atípica de trombosis venosa cerebral:
reporte de caso
Wendy Josefina Santillan Fragoso, Dinorah Alemán
Domínguez, Albino Bautista Cano, Dulce Valeria
Copca Nieto, Maricarmen Lagunas Alvarado, Diana
Sarai López González, Luis Raul López y López,
Rodolfo Ramírez Del Pilar, María Laura Rodríguez
Rosales
S70
Neuromielitis óptica (síndrome de Devic). Reporte
de un caso
Dante Rivera Zetina, Alejandro Rivera Mora, Emmanuel Flores Martínez, Anely Rodríguez Fabian
S70
Síndrome de Cogan: Reporte de caso
Diego Ontañón Zurita, José Salvador López Gil,
Mariam Paola Smith Pliego, Arnoldo Kraus Weisman
S71Encefalomielitis diseminada aguda relacionada a
inmunización contra AH1N1: revisión de caso
Ariadna Aguiñiga Rodríguez, Dalia María Dueñas
Tamayo, José Octavio Duarte Flores, Tannya Velázquez Gaspar, Juan Ramón García Díaz, Joel Alonso
Cortés Sarabia, Czestochowa Del Moral Stevenel
S71
Síndrome de encefalopatía posterior reversible
asociado a enfermedad renal crónica: presentación
de un caso
Rosa Elia Ramírez García, Antonio Cruz Estrada,
Judith Eulogia Delgado Yépez, Antonio González
Chávez, Ariana Heredia Arroyo, Alejandro Maya
Gutiérrez
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
S72
Evento vascular cerebral maligno secundario a
neurocisticercosis masiva subaracnoidea e intraventricular
Nadia Monserrat Muñoz Campos, Adriana González
Andujo, Ariana Román Flores, Alberto González
Aguilar, José Juan Lozano Nuevo
S73Encefalitis paraneoplásica como primera manifestación de carcinoma endobronquial
Jorge Ely Ortiz Balderas, Enrique Molina Carrion, Elena Deyanira Delgadillo Vega, Luis Francisco Pineda
Galindo, Diana Betzabe Villalobos Ramos
S73
Síndrome opsoclonus-mioclonus desarrollado durante el embarazo: reporte de caso
Aldo Gabriel Olmedo Gaytán, Héctor Alvarado Verduzco, Lucila Esmeralda Ruiz Jáuregui, Israel Anaya
Silva, Miguel Ángel Buenrostro Ahued
S74
Evento cerebrovascular isquémico secundario a
neurosífilis
Eugenia Saldarriaga, Lina Fajardo, Diana Casas,
Gloria Martínez, Carlos Escalante Penagos
S75
Encefalitis límbica asociada a colitis ulcerativa con
hallazgos tardíos en neuroimagen
Eduardo Martín Nares, Heriberto Ontiveros Mercado, Álvaro López Iñiquez, Ricardo Rubio Reynoso,
Luis Arnoldo Muñoz Nevárez, Lorena Valerdi Contreras, Miguel Ángel Pérez Aranda
S75
Neuromielitis óptica (enfermedad de Devic): presentación de un caso y revisión de la literatura
Rogelio Domínguez Moreno, Juan Echeverría, Alonso
Gutiérrez, Luis Guevara Arnal, Felipe Vega Boada
S76
Encefalitis límbica. Manifestación precedida a un
tumor de ovario
Al Carrillo González, D Adalid Arellano, S Alvarado
Romero
S77
Síndrome de vena cava inferior secundario a
schwannoma retroperitoneal
JAJ Batún Garrido, E Hernández Núñez, F Olán
S77
Mesotelioma peritoneal maligno en paciente sin
exposición a asbesto: reporte de caso
C Alanis Fraga, MT Sánchez Ávila, O Gaytan Torres
S78Enfermedad de Castleman: Reporte de un caso
clínico
JE Hernández Utrera, C Monreal Alcántara, R Ovilla
Martínez, LA Reynolds Ocampo, DI Calles Payan, A
Cabrera García A, RM Jiménez Alvarado
S79
Metástasis cutáneas, manifestación inicial de un
cáncer de mama
Josefina Álvaro Vásquez, Juan Carlos Salas Ruiz,
Misael Gómez Franco
S80
Polineuropatía desmielinizante crónica como manifestación inicial de un síndrome POEMS
Josué Román Cab Paat, Faustino Morales Gómez,
Jorge Uriarte Archundia
S80
Hallazgo radiológico de plasmocitoma como manifestación inicial de mieloma múltiple asociado con
insuficiencia renal
LF Valdés Corona, E Erazo Tapia, AS Cepeda Pérez,
L Jorge Diego, Antonio Enrique Cataneo Dávila
S81Alteraciones citogenéticas en un paciente con mieloma múltiple como factor pronóstico y terapéutico
Diego Armando Victoria Ríos, Jesús Gutiérrez Bajata,
Gerardo Callejas Hernández
S82Linfoma primario de sistema nervioso central.
Reporte de un caso
Berenice Vicente Hernández, María José Pardinas Llergo, José Mauricio Cedillo Fernández, Alberto Alfonso
Palacios Boix, Arturo Violante Villanueva, Enrique Juan
Díaz Greene, Federico Rodríguez Weber
S82
Síndrome de Sweet asociado con síndrome mielodisplásico
O Paredes Ceballos, L Moranchel García, M Quintal
Ramírez, O Vera Lastra
S83
Incompatibilidad RH y síndrome de hiperviscosidad
en paciente con mieloma múltiple
LI Corona Sevilla, Y Moctezuma Montaño, HB Castellanos Sinco, R Álvarez Cruz
S84
Falla renal como manifestación única de mieloma
múltiple: reporte de un caso
Juan Ramón García Díaz, JN López Taboada, JO
Duarte Flores, T Velázquez Gaspar, DM Dueñas
Tamayo, C Del Moral Stevenel, JA Cortés Sarabia
S84
Cánceres sincrónicos con actividad metastásica:
adenocarcinoma de colón y cáncer de próstata.
ID Peña Chávez, O Morales Gutiérrez, AA Holling
Martínez, C Mitrani Boyle, F Pérez Zincer, I López
Caballero
S85
Neuritis óptica retrobulbar como primera manifestación de síndrome paraneoplásico asociado con
adenocarcinoma renal de células claras, reporte
de caso
Sara Olivia Ramos Romero, Héctor Enrique Ortiz
Mendoza, Alejandro Ortiz Piña, Julio César Castañón
Pastén, Arturo Mena Benítez, José Antonio Marín
Muñoz, Juan Andrés Méndez García
S86
Fracturas patológicas como presentación inicial de
carcinoma insular de tiroides metastásico. Reporte
de un caso
Mario Joatam Pozas Rivas, Marisol Hernández López,
Yolanda Galvez Molina
S87
Sarcoma mieloide. Reporte de tres casos
Alejandro Quintin Barrat Hernández, Edgar Pérez
Barragán, Nazhira Torres Neme
S87
Síndrome de Parinaud, manifestación frecuente de
patología poco frecuente, reporte de caso
Juan Esteban Aguilar Esquivel, Carolina Candelaria
Ramírez Gómez, José Humberto Arcos Corea
S88Enfermedad de Castleman unicéntrica paramediastinal. Caso clínico y revisión de la literatura
LE Andrade Morelos, JF Flores Pérez, JA Lara Sánchez,
R Ovilla Martínez, A Cabrera García
S89
Metástasis cutáneas como recurrencia de cáncer
de mama: reporte de caso
Y López Bueno, S Méndez Flores, G Liceaga Craviotto
S89
Síndrome de compresión medular como única
manifestación en mieloma múltiple IgA
Tannya Velázquez Gaspar, Paola Castro Cortés, Alejandra Ruiz Fuentes, Adriana Aguiñiga Rodríguez,
Rosario Dorantes Romandia
S90Tumor neuroendocrino metastásico
Francisco Javier López Maldonado, Mariana Delgado
Villa, Leticia Alejandra Orozco Mendoza
S91Anemia hemolítica autoinmune: fenómeno paraneoplásico asociado con leucemia linfocítica crónica
Teresa Ivonne Gonzaga López, María Berenice Rodríguez y Rodríguez, Araceli Cruz Rodríguez, Triana
Salgado Muñoz, Isaac Morones Esquivel, Mónica Cavazzani Silva, Francisco Javier Mijangos Huesca, Luis
Javier Castro D’Franchis, Abraham E Reyes Jiménez
www.nietoeditores.com.mx
Contenido
S91Osteosarcoma extraóseo. Reporte de caso
Georgina Martínez Flores, Marlid Cruz Ramos, Saúl
Campos Gómez
S92Enfermedad poliquísitca del adulto y cáncer
Monica Cavazzani Silva, María Berenice Rodríguez
Rodríguez, Ofelia María Rosales del Real, Teresa Ivonne Gonzaga López, Adriana Paula Matamoros Mejía,
Vianey Gómez Guzmán, Ciro Marco Vinicio Porras
Méndez, Abraham Emilio Reyes Jiménez, Luis Javi
S93Linfoma cutáneo angiocéntrico de células T tipo
hidroa vacciniforme. Reporte de caso
Alejandro Maya Gutiérrez, Johanna Elizabeth Paredes
Sánchez, Eduardo Martínez Sánchez, Antonio Cruz
Estrada
S94
Síncope como presentación de paraganglioma
abdominal
Maricela Beatriz Rocha Carrillo, José Enrique Cruz,
Gabriela Liceaga Craviotto
S94
Metástasis óseas a nivel lumbar como forma de
presentación de adenocarcinoma gástrico
Pedro de Jesús Ventura Ramos, Gerardo Callejas
Hernández
S95
Crisis hipercalcémica en el paciente geriátrico como
manifestación de adenocarcinoma paratiroideo
A Carrasco Mexia, AE Márquez Pelayo, D Rodríguez
Pontones, N Arias Ponce, BG García Duarte
S96
Calcinosis cutánea paraneoplásica: reporte de un
caso
María Fernanda Arroyo Ruiz, G Paulino Camacho,
A Olvera Acevedo
S96
Quilotórax no traumático asociado con linfedema
primario idiopático: Reporte de un caso
Moisés Hinojosa Bujaidar, Diego Ceballos Ávila,
O Guerrero Soto, Sandra Mosqueda Lunar, Alma
Aguilar
S97
Derrame pleural bilateral secundario a linfangioleiomiomatosis: reporte de un caso
Ariadna Aguiñiga Rodríguez, H Garibay Chávez, JR
García Díaz, IG Verdines Rodríguez, T Velázquez
Gaspar, JO Duarte Flores
S98Retención hídrica como primera manifestación de
mieloma múltiple. Reporte de caso
Diego López Macías, Jorge Reyes Hernández, Virginia
Sánchez
S98Enfermedad de Hodgkin clásica extraganglionar
hepática primaria
Gyna Alejandra Altamirano Solórzano, Norma Ortega Gutiérrez, Cindy Ledesma De la Cruz
S99Tumor de células pardas en el cuerpo del esfenoides
secundario a hiperparatiroidismo primario por
adenocarcinoma paratiroideo
José Miguel Hinojosa Amaya, René Rodríguez Gutiérrez, Dionicio Ángel Galarza Delgado
S100Tumor germinal extragonadal tipo coriocarcinoma
Roxana Vázquez Ramírez
S100Linfoma TNK nasal en granulomatosis con poliangeítis, reporte de un caso
Fátima Margarita Rodríguez Dávila, Sergio Alberto
Mendoza Álvarez
S101 Carcinoma gástrico mixto adenoneuroendocrino
en un paciente joven. Reporte de un caso
Sonia Elena Reyes Meza, HL González Barba, DM
Escobedo Paredes, CM Tornero Romo, GC Osuna
Anguiano, MD Urzua Orozco
www.nietoeditores.com.mx
S102Linfoma no Hodgkin difuso de células grandes
tipo B, primario cutáneo. Reporte de un caso
atípico
Paulina Rita Corona Castillo, Ana Kala Díaz Noriega, Noé Romero, Perla Esmeralda Flores López
S102 Leucemia linfoblástica aguda manifestada con
síndrome de Trousseau
Estefanie Villanueva Rodríguez, Martha Elizabeth
Segovia Guardado, Merit del Carmen Hernández
Sánchez, Mario Antonio Cerecedo Rosendo, Viridiana Montserrat Mar Torres,
S103Tumor retroperitoneal, presentación atípica de
linfoma no Hodgkin
Jair Herrera Méndez, Alba Dinorah Pacheco Vázquez, Víctor Hugo Rosales Salyano
S104Linfohemangiomatosis asociada con coagulación
intravascular diseminada
Citlali Fernández Vivar, Ana Lilia Peralta Amaro, Olga
Lidia Vera Lastra, Fabiola González Márquez
S104Tamponade y síndrome de vena cava secundario a
tumor germinal primario de mediastino. Reporte
de caso
Mireya Citalli Pérez Guzmán, José Elihú Cuevas
Castillejos, Guillermo Martos, Raquel Gerson
S105 Carcinoma neuroendocrino del timo manifestado
como síndrome de Cushing: reporte de caso
Guadalupe Robledo Barriga, Bruno Ali López Luis,
Salomon Barrios López
S106 Dolor abdominal crónico y recurrente: manifestación temprana de adenocarcinoma duodenal
primario metastásico. Presentación de un caso
Carlos Alberto Rodríguez Martínez, Guillermo Flores,
Martín Armando Ríos Ayala, Paolo Alberti Minuti,
José Fabián Martínez Herrera, Francisco Javier Ramos
Aguilar, Daniela Salinas Morales
S106Linfoma de Hodgkin esternal concurrente con
absceso fúngico: reporte de caso
David Martínez Oliva, Jorge García Méndez, Martín
Granados García, Lorena Barrón Hernández, Eduardo Cervera Ceballos
S107 Pancreatitis aguda secundaria a lupus eritematoso
sistémico, reporte de un caso
Fabián Oscar Cortés Cortés, Héctor Infante Sierra,
Cintya Barajas Toledo, Guadalupe Ferrer Burgos,
Neftalí Miguel Martínez, Celia Peña Alcántara
S108Amiloidosis sistémica por depósito de cadenas
ligeras Kappa, un reto diagnóstico
MG López Cruz, G Gómez Ochoa, G Ordoñez
Vázquez, E Hernández Ruiz, G Pérez Bustamante
S109Enfermedad de Still. Reporte de un caso
Tania Adriana Luna Zúñiga, Mariana Paola González Mora, Miguel Alejandro Flores Morales, Héctor
Infante Sierra, Ana María Calderón Escutia
S109 Síndrome de Goodpasture. Reporte de un caso
Joaquín Moreno Moreno, Marisol Hernández López,
Yolanda Gálvez Molina
S110 Enfermedad de Marburg: variante de esclerosis
múltiple
JO Duarte Flores, IL Candelaria Zavala, A Cabrera
Rayo, CE García Gutiérrez, EE Castellanos Pedroza
S111 Granulomatosis con poliangeítis parotídea bilateral
como manifestación inusual, revisión de un caso
A Aguiñiga Rodríguez, R Dorantes Romandía, L
Castro Castrezana, T Velázquez Gaspar
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
S111
Enfermedad de Still como causa de fiebre origen
desconocido: reporte de caso
Isaac Morones Esquivel, José Oscar Terán González,
Luis Javier Castro D’Franchis, Dulce Valeria Copca
Nieto, Maricarmen Lagunas Alvarado, Rodolfo
Ramírez del Pilar, Adriana Paula Matamoros Mejía,
Dushan Meza Oviedo, Triana Salgado Muñoz
S112 Vasculopatía inducida por cocaína adulterada:
presentación de caso
Edith Rubí Luis Ojeda, Miguel Ángel Solís Bravo,
Alfredo Israel Servín Caamaño, Elvira Graciela
Alexanderson Rosas, Manuel Flores Ibarra, Ivonne
Arellano Mendoza, Cecilia Eugenia Pulido Collazos
S113Enfermedad por modelantes, ¿una enfermedad del
siglo XXI?
Xochitl Jiménez Jiménez, Gabriela Liceaga Craviotto,
Silvia Méndez Flores
S114 Síndrome de sobreposición (rupus). Reporte de un
caso
Shendel Vilchis González, Rogelio Zapata Arenas,
Carlos Escalante Penagos
S114 Polimiositis, caso clínico y revisión bibliográfica
Jessica Martín Tebar, Michel Villatoro Villar, Enrique
Figueroa Genis, David Hernández Pérez, María Del
S115Anemia hemolítica con autoanticuerpos mixtos
secundaria a lupus eritematoso sistémico: reporte
de caso
Humberto Baldomero Castellanos Sinco, R Álvarez
Cruz, JN López Taboada, DM Dueñas Tamayo, JR
García Díaz, JO Duarte Flores, Velázquez Gaspar,
JA Cortés Sarabia, C Del Moral Stevenel
S115 Mujer con enfermedad cavitaria pulmonar reporte
de caso
Alejandra Ruiz Fuentes, Luis Carlos Álvarez Torrecilla,
Pamela Teresa Mendoza Barradas, Ivette Denisse
Bonilla Gudiño
S116Aterosclerosis acelerada como dato pivote para el
diagnóstico de lupus eritematoso sistémico
María Fernanda Arroyo Ruiz, A Marmolejo Rodríguez, F Briceño Moya
S117Granulomatosis con poliangeítis con afección
limitada. Reporte de caso
Maricarmen Lagunas Alvarado, María Laura Georgina
Rodríguez Rosales, Valeria Copca Nieto, Wendy
Josefina Santillán Fragoso, Triana Gabriela Salgado
Muñoz, Isaac Morones Esquivel, Teresa Ivonne
Gonzaga López, Dinorah Alemán Domínguez, Dian
López González
S118 Rabdomiolisis por ejercicio
AE Morales Hernández, MQ Trejo Mondragón, RR
Pérez Rodríguez, DR Hernández Salcedo, HE Mejía
García
S118 Monoartritis de rodilla como manifestación de
síndrome de Good
Malinally Rosas José, Blanca Alicia Chong Martínez
S119Enfermedad intersticial pulmonar inducida por
metotrexato, a propósito de un caso clínico
Aldo Taurino Vázquez Ruvalcaba, Daniel Iván Arroyo
Espinosa
S120 Síndrome de activación de macrófago como presentación de lupus eritematosos sistémico. Caso
clínico
Sergio Alberto Mendoza Álvarez, Fabiola González
Márquez, María de los Ángeles Flores Méndez
S120
Evento cerebrovascular isquémico en paciente
joven, un reto diagnóstico
Viridiana Montserrat Mar Torres, Martha Elizabeth
Segovia Guardado, Estefanie Villanueva Rodríguez,
Mario Antonio Cerecedo Rosendo, Enrique González Valderrama, Francisco López Garza
S121 Tuberculosis meníngea y mielitis transversa en lupus
eritematoso
David Aparicio Hernández, Flavio Rojas Castillejos,
Pablo Calzada Torres, Alejandro Felix Canseco
S122 Síndrome de Goodpasture pANCA positivo: reporte
de caso
José Ricardo García de la Peña, Ángel de Miguel Barrios Balderrama, Ernesto Alejandro Lozano Sabido,
Joel Loeza Irigoyen, Pablo Jacinto Flores Santiago,
Daniel Iván Arroyo Espinosa
S123 Síndrome reumático paraneoplásico: lupus-like: a
propósito de un caso y revisión de la literatura
Laura Isela Rivera Ramírez, Carlos Rodrigo Escalante
Penagos
S123 Estenosis subglótica como manifestación clínica de
la policondritis recidivante. Reporte de caso
KI De la Cruz Rodríguez, JA López Pérez, E Hernández Alonso
S124 Síndrome antisintetasa. Reporte de caso
Perla Esmeralda Flores López, Andrés Roberto Lugo
Guadarrama, Stephanie Anely Rodríguez Fabián,
Nancy Lourdes Castellanos Sánchez
S125 Macroglobulinemia de Waldenström y síndrome
nefrótico. Reporte de un caso
O Ruvalcaba Pérez, M Pacheco Ruelas, M Xolotl, M
Casarrubias, O Vera Lastra
S125Esclerodermia asociada a síndrome ASIA
Citlali Fernández Vivar, Ana Lilia Peralta Amaro, Olga
Lidia Vera Lastra
S126 Síndrome antifosfolipídico asociado con insuficiencia adrenal en paciente masculino
Flora Abigail Zúñiga Villavicencio, Luis Fernando
Gasca Plancarte, Maribel Mejía Moreno
S127 Vasculitis asociada con p-ANCAS como fiebre de
origen desconocido. Reporte de caso
Mireya Citlalli Pérez Guzmán, José Miguel Álvarez
Blanco, Antonio Jordan Ríos, Daniel Toiber Geller
S128 Síndrome de anticuerpos antifosfolipídicos catastrófico: reporte de un caso
José Elihú Cuevas Castillejos, Alain Sánchez Rodríguez, Mireya Citlalli Pérez Guzmán, María del
Carmen Amigo Castañeda
S128 Síndrome de sobreposición, esclerosis sistémica rápidamente progresiva y lupus eritematoso sistémico
Eugenia Saldarriaga, Carlos Escalante Penagos, Miriam Reyna, Darío Aguirre Hernán, Felipe Posada
Andrés
S129 Miastenia gravis asociada con lupus eritematoso
sistémico. Reporte de caso
Sofia Mirely García Trejo, A Ku González, GA
Hernández García, CD Álvarez Esparza, JA Huebe
Rafool
S129Aneurisma de arteria esplénica secundario a pancreatitis crónica: reporte de un caso
Jorge Alejandro Morales Treviño, Hilda Elizabeth
Macías Cervantes
S130 Melanoma vulvar metastásico a sistema nervioso
central. Reporte de caso
www.nietoeditores.com.mx
Contenido
Sofía Mirely García Trejo, A Ku González, GA
Hernández García, AL Ramírez Mares, CD Álvarez
Esparza, JA Huebe Rafool, E Aguilar Neri
TRABAJOS LIBRES DE INVESTIGACIÓN
S131
Programa de Farmacovigilancia 2013 del Departamento de Medicina Interna
José Miguel Hinojosa Amaya, Francisco Gonzalo
Rodríguez García, Sara Gabriela Yeverino Castro,
Dionicio Ángel Galarza Delgado
S131La cintura hipertrigliceridémica como indicador de
factores de riesgo cardiometabólico
Emma Yazmín Mendoza López, Jaime Carranza
Madrigal
S132 Hallazgos electrocardiográficos en pacientes con
diabetes mellitus tipo 2 sin cardiopatías previas
atendidos en el Servicio de Hospitalización de
Medicina Interna del Hospital General Dr. Manuel
Gea González a un año de seguimiento
Iván Darío Hernández Erazo, Eduardo Wilfredo
Goicoechea Turcott, Itzel Lazcano Romano, Rosa
Elena González Pimienta, Jazmín Teresa Pozos López
S133 Metaloproteasas: su influencia en el desarrollo de
ateroesclerosis coronaria
Carlos Amir Carmona González, Nashla Hamdan
Pérez, Carmen Zavala García, Paula María del Carmen Figueroa Arredondo, Patricia Soto Márquez,
Guillermo Valero Elizondo, Víctor Gabriel Hernández
Chávez, Citlaltepetl Salinas Lara
S133 Evaluación de función endotelial en tromboembolismo pulmonar agudo experimental
A Pacheco Cantú, MA Benavides González, JL Ramos Martínez, NO Herrera Elizondo, A Niderhauser
García, DA Galarza Delgado
S134Evaluación diagnóstica del paciente con dolor
torácico no traumático en el servicio de urgencias
Henoc Malcampo Mendoza, Edgar Dehesa López,
Alberto Quintero Pérez, Carlos Alberto Kawano Soto,
Sergio Irizar Santana, Edgar Dehesa López
S135 Alteraciones electrocardiográficas en pacientes con
traumatismo craneoencefálico severo y su impacto
en la mortalidad
Lorena González Rosas, David Añorve Clavel, Carlos
Armando Orbe Cabrera, José Legorreta Soberanis,
Maritza Carolina Hernández Guerrero
S135 Factores relacionados con tiempo de retraso en
la terapia de reperfusión en pacientes con infarto
agudo de miocardio con elevación del segmento ST
en un hospital de tercer nivel
César Leonardo González Aguilar, Manuel Alfonso
Baños González, Orlando Luis Henne Otero, Manuel
Eduardo Torres Hernández, Alfonso Baños García,
José C Ruiz Soto, Efrén Rodríguez Hernández, José
Antonio Gómez Garibay
S136 Prevalencia de hipertensión arterial en el paciente
sin diagnóstico previo en un hospital de segundo
nivel de Nuevo León
Sandra Galindo Alvarado, Luis F Pérez García, Dionicio Galarza Delgado, Miguel A Villarreal Alarcón,
Claudia Lara, Luis A Morales Garza, María T Sánchez
S137 Correlación de hipocalemia con crisis hipertensiva
Andrés Ledesma Velázquez, Fidel Cerda Téllez,
Leticia Rodríguez López
www.nietoeditores.com.mx
S137
Frecuencia de eventos trombóticos recurrentes y
su relación con la baja respuesta a tienopiridinas
en pacientes sometidos a coronariografía
Paola Denise Elizalde Hernández, Beatriz Calderón
Cruz, Diana Jhoseline Medina Leyte, Astrid Sobrevilla
Zarazua, José Juan Lozano Nuevo, Marco Antonio
Peña Duque, Gilberto Vargas Alarcón, José Manuel
Fragoso, Marco Antonio Martínez Ríos, Aurora
S138 Efecto de linagliptina sobre sensibilidad a la insulina
en prediabetes
DM Hernández Corona, M González Ortiz, T González Heredia, E Martínez Abundis
S139 Efecto de la metformina en pacientes no diabéticos,
con disglucemia de ayuno con y sin resistencia a la
insulina
Jaime Carranza Madrigal, Sonia López Correa, Luz
María Castro Reyes
S139 Polimorfismos asociados a diabetes mellitus tipo 2
de inicio temprano en el noreste del país
Roberto Monreal Robles, Hugo L Gallardo Blanco,
Fernando Lavalle González, Ricardo Cerda Flores,
Pavel Carillo Molina, Minerva G Martínez Cavazos,
Laura E Martínez Garza, Dionicio Galarza Delgado,
Jesús Z Villarreal Pérez
S140 Depresión y diabetes: ¿existe una asociación?
Jaime Carranza Madrigal, Sonia López Correa, Jesús
Alveano Hernández
S141 Factores de riesgo y prevalencia de osteoporosis
(OP) y masa ósea baja (MOB) en el Hospital Ángeles
del Pedregal (HAP)
Alfredo Aisa Álvarez, Azucena Espinoza Sevilla,
Miguel Ángel Torres Pacheco, Enrique Díaz Greene,
Federico Rodríguez Weber
S141 Evaluación del perfil de lípidos antes y después del
tratamiento para hipotiroidismo en el Sistema de
Salud de PEMEX
Laura Luz Arana Luna, Adriana Hernández Alarcón,
Adriana Rodríguez Galván
S142 Correlación entre esteatosis hepática ultrasonográfica y porcentaje de grasa visceral por bioimpedancia
Juan Carlos Corona Meléndez, Edith Jaqueline Bañuelos Contreras, Francisco de Asís Pérez Lamero,
Joel de Jesús Vázquez García, Juan Roberto Flores
Montes, Eloy Medina Ruiz
S142 Prueba diagnóstica de criterios individuales de
síndrome metabólico e índice cintura-altura
Juan Carlos Corona Meléndez, Lilian Montserrat
Torres Made, Edith Jaqueline Bañuelos Contreras,
Juan Roberto Flores Montes, Eloy Medina Ruiz
S143 Tratamiento urgente de trabajadores diabéticos con
descontrol crónico
Carlos A Narváez Pichardo, Octavio AJ Rodríguez
Uriarte, David Chávez Castillo, JA Miguel Mendiola
Núñez
S144 IDegAsp disminuye la tasa de hipoglucemia vs
insulina bifásica aspártica en adultos con DT2 que
alcanzan el objetivo glucémico (HbA1C <7.0%):
un metanálisis
R Mehta, A Vaag, JS Christiansen, LK Niskanen, T
Johansen, S Rasmussen, M Mercado, G Fulcher
S145Efecto de liraglutida 3.0/1.8 mg en el peso corporal
y factores de riesgo cardiovascular en adultos con
obesidad o sobrepeso con DM2: SCALE Diabetes,
estudio aleatorizado, doble ciego a 56 semanas
Medicina Interna de México
Marcela Rodríguez Flores, Bruce Bode, Ralph DeFronzo, Richard Bergenstal, Robert Kushner, Andrew
Lewin, Trine Vang Skjøth, Ricardo Arturo Reynoso
Mendoza, Melanie Davies
S145 Insulina Degludec/Insulin Aspártica (IDegAsp)
provee control superior de GPA y reduce hipoglucemias vs insulina Aspart Bifásica 30 (BIAsp 30) en
pacientes vírgenes a insulina con diabetes tipo 2 en
un estudio aleatorizado fase 3
R Arechavaleta, E Franek, M Haluzik, S Canecki
Varzic, M Sargin, S Macura, J Zacho, M Mercado,
JS Christiansen
S146 Características ultrasonograficas del nódulo tiroideo y su asociación con cáncer de tiroides
Juan Francisco Castro Ruelas, Manuel Salvador
Aguilera Rosas, José Candelario Bátiz Beltrán
S146 Uso de metilprednisolona vs dexametasona y su
asociación con hiperglucemia en no diabéticos
Lucy Carolina Flores Arceo, Luis Eduardo Landeros
Vera, Antonio Israel Valdez Payan, Sánchez Cuen,
Jiménez Ricardez, José C Bátiz Beltrán
S147 Influencia de la funcionalidad del tejido adiposo
para desarrollar esteatosis hepática
Nashla Hamdan Pérez, Carlos Amir Carmona González, Nimbe Torres y Torres, Armando R Tovar Palacio,
Guillermo Ordaz Nava, Sofía Moran Ramos, Braulio
Martínez Benítez, Roberto Medina Santillán, Nahum
Méndez Sánchez, Gonzalo Torres Villalobos
S147 Trasplante autólogo de tejido adiposo subcutáneo
en ratas obesas para tratar obesidad
Nashla Hamdan Pérez, Carlos Amir Carmona González, Nimbe Torres Torres, Armando Tovar Palacio,
Guillermo Ordaz Nava, Sofía Moran Ramos, Lilia
Noriega, Carlos Bravo Reyna, Ivan Torre Villalvazo,
Marcia Hiriart, Roberto Medina Santillán, Nahúm
Méndez Sánchez
S148 Correlación entre el grado de obesidad y la mortalidad de los pacientes hospitalizados con hepatitis
alcohólica en el Hospital General Dr. Manuel Gea
González durante el periodo 2007-2013
Jorge Luis Pineda Castillejos, J Rivero Martínez, G
Cruz Aragón, I García Juárez, A Fuentes Venegas, R
Zacarías Castillo
S149 Identificación de anormalidades del piso pélvico
por defecografía en estreñimiento crónico
Alejandro Garza Alpirez, Priscilla Caballero Vázquez,
Ana Fernanda Alvarado Villalobos, Luis Alonso Morales Garza, Miguel Ángel Carrillo Martínez, Ignacio
Cano Muñoz, Carolina Tatiana Elizondo Vázquez.
César Antonio Marrufo García, Miguel Ángel Mar Ruz
S149 Asociación de la supresión etílica grave por CIWA
y la presencia de sangrado de tubo digestivo alto
Martín de Jesús Reyna Ramírez, Alberto Melchor
López, José Juan Lozano Nuevo
S150 Fragilidad en pacientes geriátricos ambulatorios
en un hospital de tercer nivel, determinación de la
prevalencia
Aramara Yasmín Aco Flores, Alejandro Velásquez
Sarria, Ana Karenina López Retamoza, Antonio Cruz
Estrada, Leonor Elia Zapata Altamirano
S151 Tromboprofilaxis en pacientes no quirúrgicos en el
Hospital Ángeles Lomas en el Año 2013
Fernando Perez Zincer, María del Rosario Herrero
Maceda
Volumen 30, Suplemento 1, 2014
S151Deferasirox en recuperación hematológica y telomérica en síndrome mielodisplásico y anemia
aplásica
GE García Saavedra, HA Monroy Salazar, JM Covarrubias Covarrubias, G Mendoza Calderón, BO
Murillo Ortiz, J Ramírez Emiliano, S Martínez Garza
S152Experiencia en el uso de óxido de hierro coloidal
cubierto de carbohidrato semisintético para anemia
por deficiencia de hierro en pacientes con intolerancia o falla al tratamiento con hierro oral
Roberto Ovilla Martínez, Dannia Calles Payan, Lucía
A Reynolds Ocampo, Gabriela Ruiz Reyes, Carolina
Balderas Delgado, Andrés Montesinos Ovilla, Oscar
Morales Gutiérrez, Lilian Elizabeth Andrade Morelos,
Álvaro Cabrera García
S153 Correlación entre dosis acumulada de colistimetato
intravenoso y nefrotoxicidad en pacientes hospitalizados
Dushan Meza Oviedo, Luis Javier Castro D’Franchis,
Emilio Abraham Reyes Jiménez, José Óscar Terán
González, Miguel Ángel Labastida Bautista, Leonor
Alba Rangel
S153 Multirresistencia antimicrobiana de Escherichia coli
en urocultivos
Ofelia María Rosales Del Real, Luis Javier Castro
D’Franchis, Abraham Emilio Reyes Jiménez, José
Óscar Terán González, Miguel Ángel Labastida
Bautista, Mónica Cavazzani Silva
S154 Valor pronóstico de la procalcitonina en la práctica
clínica
Javier Guillermo Domínguez Herrera
S155 Síndrome metabólico y tratamiento antirretroviral
Ciro Marco Vinicio Porras Méndez, Luis Javier Castro
D’Franchis, Abraham Emilio Reyes Jiménez, José
Óscar Terán González, Ofelia María Rosales Del
Real, María Berenice Rodríguez y Rodríguez, Dushan
Meza Oviedo, Araceli Cruz Rodríguez
S155Tenofovir y osteoporosis en pacientes con VIH
Luis Javier Castro D’Franchis, Emilio Abraham Reyes
Jiménez, Araceli Cruz Rodríguez
S156 Conocimiento y actitud frente a la transmisión
ocupacional de tuberculosis
Sandra G Galindo Alvarado, Luis A Rendón Pérez,
Dionicio A Galarza Delgado, Miryam E Galindo
Alvarado
S156 Comportamiento de las variables bioquímicas en
los pacientes hospitalizados por dengue
Karla Gabriela Peniche Moguel, Dalia Denisse Zúñiga
Vázquez, Josué Eli Villegas Domínguez, Daniel de
Jesús Salazar Andrade, Daniel Alejandro Barrera
Amorós, Celia Denisse Cavildo Jerónimo, Antonio
Flores Morgano, Pablo César Torres Oseguera, Diana
Carolina Méndez Tino, Omar Vargas Esparza, Alonso
Alor Iturralde, Belén Medina Manrique, Verónica
Montes Martínez
S157 Manifestaciones gastrointestinales, hemorrágicas
y dermatológicas más frecuentes en pacientes
hospitalizados por dengue
Karla Gabriela Peniche Moguel, Dalia Denisse Zúñiga
Vázquez, Josué Eli Villegas Domínguez, Daniel de
Jesús Salazar Andrade, Daniel Alejandro Barrera
Amorós, Celia Denisse Cavildo Jerónimo, Antonio
Flores Morgano, Pablo Cesar Torres Oseguera, Diana
Carolina Méndez Tino, Omar Vargas Esparza, Alonso
www.nietoeditores.com.mx
Contenido
Alor Iturralde, Belén Medina Manrique, Verónica
Montes Martínez
S158 Impacto de la tobramicina inhalada en pacientes
con infecciones crónicas bronquiales
Ricardo Daniel García Sepúlveda, Juan Manuel
Sánchez Sánchez, Cesar Cruz Lozano, Ernesto Atenogénesis Cepeda Vargas, Felicitas Pérez Sánchez
S159StatLock® versus sutura convencional en la fijación
de catéteres venosos centrales y hemodiálisis en el
paciente hospitalizado
Dania Lizet Quintanilla Flores, Mónica Sánchez
Cárdenas, Alexandro Atilano Díaz, María Teresa
Ramírez Elizondo, Laura Baena Trejo, Dionicio Ángel
Galarza Delgado, Miguel Ángel Villarreal Alarcón,
Juan O Galindo Galindo
S159 Abscesos hepáticos criptogénicos causados por Klebsiella pneumoniae hipermucoviscosa, secundarios
a la cepa K1 portadora del Gen magA+
Jorge García Méndez, A Schcolnik Cabrera, M Moreno Morales, Rigoberto Hernández Castro
S160 Relación de anemia e inflamación con resistencia
a eritropoyetina en hemodiálisis
María Berenice Rodríguez y Rodríguez, Luis Javier
Castro D’Franchis, Abraham Emilio Reyes Jiménez,
César Augusto Urtiz López
S161 Características clínicas de pacientes con cáncer y
lesión renal aguda en un centro de atención de cáncer
Rafael Saavedra Pérez Salas, Alain Sánchez Rodríguez, Javier Zúñiga Varga
S161 Presencia de albuminuria en pacientes con diabetes
tipo 2 de la Clínica 31 del IMSS, DF
José de Jesús Peralta Romero, Anayeli Martínez
Zúñiga, Perla Aleidy Mundo Nava, Mariana del Rocío
Hernández Velasco, Verónica Leonor Bracamonte
Curiel, Teresa Alvarado Gutiérrez, Leticia Ramírez
Bautista, Car
S162 Mortalidad en pacientes con enfermedad renal
crónica avanzada (ERCA) en hemodiálisis
Héctor Raúl Ibarra Sifuentes, Víctor Iván Segura
Huicochea, Perla Rocío Colunga Pedraza, José
Guadalupe Martínez Jiménez, Concepción Sánchez
Martínez, Jesús Cruz Valdez, Dionicio Ángel Galarza
Delgado
S163 Calidad de vida utilizando COPD assessment test
en la EPOC
A Psaltidis López, I De La Cruz Hernández, KI De
La Cruz Rodríguez, JC Robledo Pascual, SG Tandazo
Vega
S164 Características demográficas de fenotipos clínicos en
EPOC de un hospital de Tabasco
Anahi Psaltidis López, I De la Cruz Hernández, KI De La
Cruz Rodríguez, JC Robledo Pascual, SG Tandazo Vega
S164 Factores pronósticos asociados con mortalidad en
pacientes con tuberculosis multifarmacorresistente
(TB MFR)
Julio Pascual, M Salomón Montero, S Tandazo Vega,
JA Gómez Garibay, OI Flores Barrientos, A Rodríguez
Hernández, R Méndez Morales, Miguel Ángel Salazar Lezama, Martín Castellanos Joya, Raquel Romero
Pérez
S165 Utilidad del índice de CROP como marcador pronóstico para extubación exitosa
Eduardo Adolfo Montaño Alonso, Germán Vargas
Ayala, Nayeli Gabriela Jiménez Saab
www.nietoeditores.com.mx
S166
Hallazgos tomográficos y biomarcadores de gravedad en neumonitis aguda por adyuvantes
H Mateos Toledo, C Guadarrama Pérez, I Buendía
Roldán, J Rodríguez Chagolla, J Rojas Serrano, M
García Alcalá, J Gutiérrez Bernal, M Mejía Ávila
S166 Epidemiología del cáncer pulmonar en Tabasco
JA Gómez Garibay, C Osorio Amézquita, Sheyla
García Pinzón, MA González Romo, MC Vélez
Martínez, SG Tandazo Vega, JC Robledo Pascual,
DR Cortés Niño
S167Lesión renal aguda en pacientes con cáncer: factores asociados con mal pronóstico y deterioro de
la función renal
Alain Sánchez Rodríguez, Rafael Saavedra Pérez
Salas, Javier Zúñiga Varga
S168 Perfil inmunohistoquímico y pronóstico de histologías infrecuentes de cáncer de mama en México
Sandra Ileana Pérez Álvarez, Eucario León Rodríguez,
Yemil Atisha Fregoso
S168Neoadyuvancia en cáncer de mama y pronóstico
de acuerdo con subtipo biológico
Mirza Jacqueline Alcalde Castro, Yemil Atisha Fregoso, Eucario León Rodríguez, Alejandra Armengol
Alonso
S169 Utilidad de la tomografía computarizada en el
protocolo de estudio de pacientes con pérdida de
peso inexplicable
Leslie Moranchel García, Luis Francisco Pineda
Galindo, Moisés Casarrubias Ramírez
S170 Efecto de atorvastatina sobre los niveles de adipocitocinas en pacientes diabéticos normotensos
AF Rubio Guerra, H Vargas Robles, G Vargas Ayala, JJ
Lozano Nuevo, MB Durán Salgado, BE Escalante Acosta
S170 Correlación entre los niveles de ácido úrico y disfunción vascular en adultos jóvenes
AF Rubio Guerra, H Morales López, AK Garro Almendaro, MI Portillo Muñoz, MB Durán Salgado, JJ
Lozano Nuevo
S171 Cambios metabólicos ocasionados por las combinaciones de losartán con hidroclorotiazida o con
amlodipina en pacientes hipertensos
MB Durán Salgado, AK Garro Almendaro, AF Rubio
Guerra
S171 Factores predictores de amputación en pie diabético
en un hospital académico
KI De la Cruz Rodríguez, I De la Cruz Hernández, A
Psaltidis López, JA López Pérez, JC Robledo Pascual
S172 Perfil clínico de los pacientes con meningitis aguda
según su etiología en un hospital universitario
Guillermo Delgado García, Carlos Cámara Lemarroy,
Juan Gilberto de la Cruz González, Hazael Flores
Cantú, Héctor Calderón Hernández, Fernando Góngora Rivera, Héctor J Villarreal Velázquez, Dionicio
Galarza Delgado
S173 Utilidad de pruebas clínicas-radiológicas para
predecir amputación en pie diabético
I De la Cruz Hernández, KI De la Cruz Rodríguez
KI, A Psaltidis López, JA López Pérez, JC Robledo
Pascual
S173 Fiebre de origen oscuro, comparación de dos series
con 25 años de diferencia
M Casarrubias Ramírez, SA Mendoza Álvarez, J De
Santiago Leaños, JA Alfaro Mejía, LF Pineda Galindo,
OI Vera Lastra
Medicina Interna de México
S174
Enfermedad de Fabry en México: análisis de 26 casos
Leslie Moranchel García, Luis Francisco Pineda
Galindo
S175 Hiperleptinemia en evento cerebrovascular isquémico en pacientes con hipertensión arterial
sistémica
Jorge Luis García Sánchez, Nayeli Gabriela Jiménez
Saab, Jesús Guerrero González, César Iván Elizalde
Barrera
S175 Proteinuria en pacientes con nefropatía diabética
y su asociación con síndrome de fragilidad
Javier Loaiza Félix, Nadia Monserrat Muñoz Campos,
Adriana González Andujo
S176 Impacto de un programa sobre el uso racional del
laboratorio clínico
Flores Caballero Miguel Ángel, Miguel Ángel Cruz
Moreno, Karla Elizabeth Paz Guizar, José Luis Herrera
Garza, Dionicio Ángel Galarza Delgado
S177Evaluación de un sistema electrónico para la aplicación de tromboprofilaxis en pacientes hospitalizados
Claudia Analy Vélez Viveros, Dania Lizet Quintanilla
Flores, Dionicio Ángel Galarza Delgado, Homero
Nañez Terreros
S177Relación del índice de actividad de la psoriasis y
el control glucémico en pacientes con diabetes
mellitus y psoriasis
Roberto Gasca Arriaga, Adriana López Tello, Heidegger Notberto Mateos Toledo, Luisa Dayana Bucio
Ortega
S178Asociación entre hiperuricemia y síndrome metabólico
AF Rubio Guerra, H Morales López, AK Garro Almendaro, MI Portillo Muñoz, MB Durán Salgado, S
Huerta Ramírez, JJ Lozano Nuevo
S178 Caracterización de la arquitectura del sueño en pacientes con espondilitis anquilosante y su relación
variables clínicas de la enfermedad
Alain Sánchez Rodríguez, José Padua García, Reyes
Haro Valencia, Lourdes Galicia Polo, Rubén Burgos
Vargas
S179 Caracterización de la anatomía radiográfica mandibular en pacientes con esclerodermia
E Silva Gallardo, DF Tatis Giraldo, OL Vera Lastra,
MP Cruz Domínguez, EJ Vallejo Bravo
S180Riesgo cardiovascular en lupus y uso de esteroides
K Guerra Cabrera, LF Pineda Galindo, F Briceño
Moya
S180 Efecto de un complemento nutricio sobre el perfil
metabólico en pacientes con síndrome de anticuerpos antifosfolipídico (SAAF) con síndrome
metabólico
Gabriela Medina García, Dulce Martínez Lugo,
Mayté Pérez Ayala, María del Pilar Cruz Domínguez,
Luis J Jara
S181 Revisión sistemática y metanálisis de la eficacia con
el tratamiento de leflunomida vs metotrexato como
monoterapia en pacientes con artritis reumatoide
Roberto Alfaro Lara, Héctor Fabricio Espinosa Ortega, César Alejandro Arce Salinas
S182 Patología autoinmune y diarrea crónica. Características colonoscópicas e histopatológicas en biopsias
de colon.
Rosa Angélica Carranza Muleiro, Ricardo García
Sobarzo, Miguel Ángel Pichado Farfán, J Jesús Torres
Volumen 30, Suplemento 1, 2014
Peralta, Miguel Ángel Saavedra Salinas, Gabriela
Medina García, María del Pilar Cruz Domínguez
S182 Eficacia y seguridad de la aplicación de plasma
rico en plaquetas en el tratamiento de úlceras en
pacientes con esclerodermia. Estudio piloto
María del Pilar Cruz Domínguez, Jorge García Dávila,
Ángel Guerra Márquez, María Elizabeth Enríquez
Vega, Rosa Angélica Carranza Muleiro, Gabriela
Medina García, Olga Lidia Vera Lastra
S183 Manejo perioperatorio del síndrome antifosfolipídico en un hospital de referencia de México
Eric Espejo Poox, Antonio Cabral Castañeda, Yemil
Atisha Fregoso, Eduardo Carrillo Maravilla, Eduardo
Meneses Sierra
S184El volumen plaquetario medio está disminuido en
pacientes lúpicos adultos con enfermedad activa
Guillermo Delgado García, Dionicio Galarza
Delgado, Omar Borjas Almaguer, Ilse Mandujano
Cruz, Daniel Benavides Salgado, Rolando Martínez
Granados
S184 Ensayo clínico de no inferioridad de ácido zoledrónico en infusión anual contra alendronato semanal
en mujeres postmenopáusicas. Evaluación a cinco
años
Mariana Moreno Ramírez, Héctor Fabricio Espinosa
Ortega
S185Aumento de los niveles séricos de PR3-ANCA y
recaída de de granulomatosis con poliangeítis
O Vera Lastra, RA Flores Hernández, P Cruz
S186 Causas de mortalidad en una cohorte de pacientes
mexicanas con esclerosis sistémica
Rubén Morales Aguilar, MP Cruz Domínguez, OL
Vera Lastra
S186 Comorbilidades y complicaciones en pacientes con
síndrome antifosfolipídico primario
Gabriela Medina García, María del Pilar Cruz Domínguez, Olga Vera Lastra, Luis J Jara
S187 Principales causas de atención médica en el Servicio
de Admisión Continua del Hospital de Especialidades Centro Médico Nacional La Raza durante el
año 2013
Adalid Arellano D, AL Carrillo González, S Alvarado
Romero
S188 Utilidad del ultrasonido de doble frecuencia en
comparación a técnica convencional en la instalación de accesos venosos centrales
Dania Lizet Quintanilla Flores, Mónica Sánchez Cárdenas, Alexandro Atilano Díaz, María Teresa Ramírez
Elizondo, Laura Baena Trejo, Dionicio Ángel Galarza
Delgado, Miguel Ángel Villarreal Alarcón, Rodolfo
Márquez Martin, Juan O Galindo Galindo
S189 Valores de adipocitocinas en pacientes normotensos
y prehipertensos
AF Rubio Guerra AF, H Vargas Robles, JJ Lozano
Nuevo, G Vargas Ayala, MB Durán Salgado, BE
Escalante Acosta
S189 Evaluación flujométrica con doppler pulsado: modelo experimental de embolismo pulmonar
Mario Alberto Benavides González, José Luis Ramos
Martínez, Adán Pacheco Cantú, Nancy Olivia Herrera Elizondo, Juan Manuel Reyna Fernández
S190 Etiología y resistencia antimicrobiana: Pacientes con
infección de vías urinarias en el Nuevo Sanatorio
Durango, México, DF
www.nietoeditores.com.mx
Contenido
Frida Páramo Rivas, Alejandro Tovar Serrano, Mario
Enrique Rendón Macías
S190 Evaluación de la terapia antibiótica empírica para
neumonía asociada con ventilación mecánica en
la Unidad de Cuidados Intensivos de un hospital
privado del noreste del país
Juan Manuel de Jesús Cortés de la Torre, María Teresa
Sánchez Ávila, Fernando Castilleja Leal, Luis Mario
Villela Martínez, Víctor Alán Martínez Ovalle
S191 Calidad de vida relacionada a la salud en pacientes
con diabetes mellitus tipo 2 e implicaciones clínicas
Alain Sánchez Rodríguez, Valentín Trujillo Gutiérrez,
Reyna Maribel González Ramos
S192 ¿Se justifica medir el QT antes de recetar macrólidos?
Héctor Manuel Gómez Vázquez
S192 Prevalencia y factores de riesgo asociados con
delirium intrahospitalario en el paciente geriátrico
Rocío Morales Delgado, Dania Lizet Quintanilla
Flores, Sara G Yeverino Castro, Karina A Rodríguez
Quintanilla, Dionicio Galarza Delgado
S193 Asociación entre la deficiencia de síntesis de alfa
uno antitripsina y síndrome hepatopulmonar en
pacientes con insuficiencia hepática
Elizabeth Rodríguez Romero, César Iván Elizalde
Barrera, Nayeli Gabriela Jiménez Saab
S194 Factores asociados con respuesta de leflunomida
en pacientes con artritis reumatoide
César Armando Sifuentes Cantú, César Alejandro
Arce Salinas, Fabricio Espinosa Ortega
S194 Sobrevida prolongada en mexicanos con glioblastoma multiforme (GBM) recurrente, serie de casos
Isis Ixchel Medrano Deleija, Adolfo Isassi Chapa,
Julio César Dávila Valero
S195 Toxina botulínica tipo A para tratamiento de manifestaciones clínicas en manos en esclerodermia
MA Flores Méndez, MP Cruz Domínguez, LE Molina
Carrión, G Tafoya Arellano
S196 Correlación entre tasa de filtrado glomerular y
marcadores de inflamación en AR
Mauricio Eduardo Rubio Sánchez, Fidel Cerda Téllez,
Alberto Francisco Rubio Guerra, Martín de Jesús
Reyna Ramírez, Jorge Luis Garcia Sánchez
S196 Trombosis y reestenosis del stent como causas de
cardiopatía isquémica
Ernesto Alexis Barrera Oranday, Héctor Antonio
López Morán, Víctor Manuel Sánchez Nava, José
Fernando Castilleja Leal, Luis Alonso Morales Garza,
Félix Amador Barrera Oranday
S197 Prevalencia de hiperglicemia en el paciente sin diagnóstico de diabetes mellitus tipo 2 en un hospital
de segundo nivel de Nuevo León
Luis F Pérez García, Sandra Galindo Alvarado, Juan
P Carrizales, Dionicio Galarza Delgado, Miguel A
Villarreal Alarcón, Luis A Morales Garza, María T
Sánchez, Claudia Lara
S198 Correlación: índice de presión tobillo-brazo con el
Framingham Risk Score en diabéticos
Aldo Daniel Ibarra Torres, Martín Coronado Malagón,
César Alejandro Arce Salinas
S199Efecto de administración de Gymnema sylvestre
sobre el síndrome metabólico, secreción y sensibilidad a la insulina
Esperanza Martínez Abundis, Laura Yareni Zúñiga,
Manuel González Ortiz
www.nietoeditores.com.mx
S199
Prevalencia de los tipos de mononeuritis múltiple
en pacientes con esclerodermia difusa y limitada
María del Pilar Cruz Domínguez, Jesús Millán Padilla,
Jesús Roberto Gastélum Lara, Luis Enrique Molina
Carrión, Rosa Angélica Carranza Muleiro, Daniel H
Montes Cortés, Olga Lidia Vera Lastra
S200 Metabolitos séricos asociados con la severidad de
la encefalopatía hepática
Karla Gabriela Peniche Moguel, Luis Fernando Castañares Morales, Judith Sánchez Hernández, Verónica
Montes Martínez
S200Estimación del riesgo de padecer enfermedad
coronaria en una cohorte de pacientes diabéticos
mexicanos a 2 años
Carlos Fernando Cabrera Leal, Martín Coronado
Malagón, César Alejandro Arce Salinas
S201 Mitoxantrona como substituto de adriamicina en
el tratamiento de la leucemia linfoblástica aguda
Perla Rocío Colunga Pedraza, José Carlos Jaime Pérez, César Homero Gutiérrez Aguirre, David Gómez
Almaguer, Dionicio Galarza Delgado
S202 Factores pronóstico de morbilidad y mortalidad
en pacientes geriátricos con terapia de reemplazo
renal
Ricardo Emilio Varela Jiménez, Eduardo Carrillo
Maravilla, Olynka Vega Vega
S203Aplicación del índice de Barthel en adultos mayores
hospitalizados en Medicina Interna
Rosalía García Peña, Jazmín Ariadna Salas García
S203 Fibrinógeno como indicador de enfermedad arterial
coronaria obstructiva significativa en SICA
G Domínguez Trejo, A Salas Delgado, FJ Valadez
Molina
S204 Prevalencia de pre-diabetes en población adulta
asintomática que acude a la consulta externa general del Hospital Civil Fray Antonio Alcalde durante
el periodo comprendido entre 2006-2012
Claudia Elizabeth Gómez López, María de la Luz
Alcántar Vallín, Isabel Montserrat Alvarado Padilla,
Ramón Medina González, Sol Ramírez Ochoa
S205 Manifestaciones neurocognitivas asociadas con infección por VIH en pacientes tratados en el Hospital
de Especialidades Dr. Bernardo Sepúlveda del CMN
SXXI
GD Deras, SL Pérez, MB Chong
S205 Uso de la escala de ansiedad Beck como predictor
del uso de ansiólisis previa a la colocación de CVC
y su impacto en la tasa de eventos adversos
Mónica Sánchez Cárdenas, Juan O Galindo Galindo,
Dania Lizet Quintanilla Flores, Alexandro Atilano
Atilano Díaz, María Teresa Ramírez Elizondo, Laura
Baena Trejo, Dionicio Ángel Galarza Delgado, Miguel Ángel Villarreal Alarcón
S206 Descenso de la hemoglobina asociado con hemodiálisis
Paola Santana Hernández, Arnoldo Salas Delgado,
Gabriela Domínguez Ramírez, Mónica Bustillos
Muñoz
S207 Seguridad y tolerabilidad de liraglutida 3.0 mg en
adultos con sobrepeso y obesidad: estudio aleatorizado SCALE Obesidad y Prediabetes
Rosario Arechavaleta, Carel W le Roux, David CW
Lau, Arne Astrup, Ken Fujioka, Frank Greenway,
Alfredo Halpern, Michel Krempf, Rafael Violante
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Ortiz, John Wilding, Claus Bo Svendsen, Ricardo
Arturo Reynoso Mendoza
S208Asociación entre el índice de Karnofsky y linfocitos
en el paciente con cáncer del tracto digestivo
Elizabeth Pérez Cruz, Christian P Camacho Limas
S208 Conocimiento del riesgo cardiovascular en una
población del noreste de México
José Luis Ramos Martínez, Iván Roel Bautista Cavazos, Mario Alberto Benavides González, René
Alexander Esparza Rodríguez, Raúl Reyes Araiza
S209 Etiología de la linfadenopatía y la biopsia escisional
O Paredes Ceballos, LF Pineda Galindo, E Velázquez
Jácome
S209 Hemorragia alveolar difusa: frecuencia, etiología y
desenlace en el Centro Médico, ISSEMYM, Toluca
José Manuel Rodríguez Chagolla, Emilio Estrada Castro, Miguel Ángel Rivero Navarro, Heidegger Mateos
Toledo, María Carmen, Alejandro Acuña Arellano
S210 Prevalencia de hipertensión arterial en el área
metropolitana de Monterrey
José Luis Ramos Martínez, Mario Alberto Benavides
González, Elena Alejandra Medina Sánchez, Martha
Mariela Sifuentes Loera, Blanca Elena Vallejo Domínguez
S211 Factores clínicos y bioquímicos relacionados con
larga estancia hospitalaria en el Servicio de Medicina Interna del Hospital General Dr. Manuel Gea
González
Rosa Elena González Pimienta, Alfredo Torres Viloria, Ivan Hernández Erazo, Itzel Lazcano Romano,
Guillermo Mendoza García, Diego Mireles
S211Escala de riesgo Framingham en pacientes con
enfermedad panvascular en HAE
Juan Graham Casasús, J Ruiz Macossay, MA Baños
González, A Tavares N, D Borraz N, Y Rodríguez S,
B García V, JC Chable DLC, JC Gómez M, E Ruiz G
S212 Incidencia de tuberculosis resistente a rifampicina
y factores asociados
Alejandro Garza Alpirez, Ana Fernanda Alvarado
Villalobos, Luis Alonso Morales Garza, María Teresa
Sánchez Ávila, Ricardo Garza Alpirez, Julio Molina
Gamboa, María Eugenia Galindo Mimendi
S213La epidemiología de las epilepsias en el Hospital
General de Pachuca, Hidalgo
Juan Andrés Huebe Rafool, Gerardo Alfonso Borbolla
Serrano, Marco García Méndez, Hipólito Román Nava
Chapa, Adrián Valdez Espinoza, Alejandro Lechuga
Martín Del Campo, Jorge Alejandro Lemus Arias
S213 Factores de riesgo relacionados con desarrollo de
úlceras por presión en el Hospital Universitario Dr.
José Eleuterio González
Sandra G Galindo Alvarado, Rocío Morales Delgado, Dionicio A Galarza Delgado, María L Galindo
Alvarado
S214 Validación de pruebas diagnósticas alternas en el
diagnóstico de influenza
Martha Elena Rodea Rubio, Elizabeth Mendoza
Portillo, Patricia Ruiz González, José Juan Lozano
Nuevo
S215 Mucormicosis: características clínicas y desenlace
en un hospital de tercer nivel
Alejandra Tepox Padrón, Luis Alfredo Ponce de León
Garduño, José Sifuentes Osornio, Pedro Torres González
S215 Características epidemiológicas del hipotiroidismo
clínico en adultos mexicanos
Adriana Rodríguez Galván, Laura Luz Arana Luna,
Adriana Hernández Alarcón
S216 Causas de sangrado de tubo digestivo alto en cirrosis
hepática, ¿todos son de origen variceal? estudio
observacional retrospectivo
José Gildardo Paredes Vázquez, Mayra Zavala de la
Garza, María Teresa Sánchez Ávila
S217 Brote de influenza H1N1 2013-2014: Experiencia
de un centro de referencia en el norte de México
Aldo Esteban Torres Ortiz, Juan Pablo Carrizales Luna,
José Juan Góngora, Julio Molina Gamboa
S217 Prevalencia de síndrome metabólico y frecuencia
de factores de riesgo cardiovascular en sujetos de
protección civil de la UNAM en el año 2013
Montserrat Durán Salgado, Ana Garro Armendaro,
Alberto Rubio Guerra, Jorge Echeverri Rico
S218Nuevo modelo de atención para disminuir la prevalencia de úlceras por presión
Rocío Morales Delgado, Carlos Soto Rincón, Tania
Annel Medina Vidales, Javier Alejandro Dávila Olalde, Dionicio Ángel Galarza Delgado, Laura Irma
Baena Trejo
S219Delirium, presentación y asociación con mortalidad
intrahospitalaria en pacientes de Medicina Interna
P Caballero Vázquez, A Barragán Berlanga, M Galingo Mimendi, M Sánchez Ávila
S220 Serie de casos de pacientes con intoxicación por
paraquat en el Hospital de Alta Especialidad Dr.
Juan Graham Casasús
Jesús Ruiz Maccosay
S220 Prevalencia de síndrome metabólico en población
rural
Jorge Chávez Pagola
S221 El síndrome metabólico en adolescentes y adultos
jóvenes en población rural
Jorge Chávez Pagola
www.nietoeditores.com.mx
Resúmenes
Med Int Méx 2014;30(Supl. 1):S1-S221
1er Congreso Panamericano y XXXVII Congreso
Nacional de Medicina Interna*
CASOS CLÍNICOS
Intoxicación digitálica en paciente tratado con claritromicina
JAJ Batún Garrido, E Hernández
Núñez, F Olán
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa Pérez, Villahermosa, Tabasco
Introducción: la digoxina presenta
un estrecho margen terapéutico,
con una frecuencia de intoxicación del 4% en los pacientes
con tratamiento crónico. En la
intoxicación digitálica es posible
la aparición de cualquier arritmia.
El 10% de la población tratada
con digoxina oral la metaboliza
a nivel intestinal en metabolitos
inactivos, por acción de Eubacterium lentum, disminuyendo su
absorción hasta en un 50%, la
claritromicina es un macrólido
muy activo contra esta bacteria,
aumentando los valores séricos
y el riesgo de toxicidad. Descripción del caso: femenino 60 años,
portadora de DM tipo 2, HAS,
IRC en hemodiálisis, insuficiencia
cardiaca tratada con digoxina 0.25
mg de lunes a viernes desde hace
6 meses. Cuatro días previos a su
ingreso presenta herida secundaria
a traumatismo en primer dedo de
pie derecho, con datos de infección por lo que se le prescribe
claritromicina 500 mg cada 12 h x
10 días. Acude a sesión de hemodiálisis refiere astenia y adinamia,
FC de 35 latidos por min, EKG
reporta bigeminismo ventricular,
FC de 34 latidos x min y bloqueo
AV de 1er grado, con cubetas digitalicas, se hospitaliza, es valorada
por cardiología quien indica prueba con atropina y administración
de orciprenalina 20 mg cada 8
h. EF paciente desorientada, con
precordio arrítmico. Paraclínicos
glucosa 269 mg/dL, Cr 1.77 mg/
dL, Urea 33.38 mg/dL, BUN 15.6
mg/dL, potasio 2.9 mmol/L. Se
suspende la administración de
digital y de claritromicina, se
corrige potasio, y se administra
DFH, se solicitan niveles séricos
de digoxina los cuales reportan
2.9 ng/mL. 48 h posteriores a
su ingreso la paciente presenta
bloqueo AV completo por lo cual
se realiza colocación de marcapasos permanente, se mantiene
en observación, manteniendo
FC por encima de 60 latidos x
min, y niveles séricos de digoxina
dentro de los límites normales,
con mejoría clínica y evolución
satisfactoria, se egresa. Comentario y Conclusiones: El 10% de los
pacientes que emplean digoxina
presentan riesgo de intoxicación
al combinarse con macrólidos, debido a la complejidad del manejo
de esta intoxicación, se debe evitar
esta combinación o el empleo
de otros fármacos que afecten la
farmacocinética de la digoxina,
especialmente en pacientes con
factores de riesgo como la edad,
la hipokalemia y la IRC.
Origen anómalo de coronaria
derecha y miocardiopatía hipertrófica obstructiva. Reporte
de caso
Luis Carlos Álvarez Torrecilla,
Alejandra Ruiz Fuentes, Carlos
Augusto Contreras Martínez,
Julian Gerardo Hurtado Garibay,
Elizabeth Armijo Yescas, Abel Solorio Razo
Coordinación de Cardiología y
Cirugía Cardiotorácica, Hospital
Regional de Alta Especialidad
*El contenido científico y editorial de estos resúmenes no es responsabilidad de Medicina Interna de México.
www.nietoeditores.com.mx
S1
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Bicentenario de la Independencia, ISSSTE, Tultitlan, Estado de
México
Introducción: las anomalías
coronarias de origen o curso
son raras y se presentan en el
0.5-1% de la población general. Se clasifican en anomalías
coronarias menores o benignas,
que constituyen la mayoría y no
revisten importancia clínica, y
en anomalías coronarias mayores o malignas, asociadas con
isquemia miocárdica, infarto
de miocardio, síncope o muerte
súbita. Presentación del caso:
masculino de 61 años de edad,
factores de riesgo edad, genero, sedentarismo con historia
cardiovascular de disnea de
medianos esfuerzos de 3 años
de evolución, ecocardiograma
transtóracico ventrículo izquierdo (VI)con hipertrofia ligera, a
nivel del tracto de salida del VI
aceleración del flujo así como
jet en forma de daga a nivel del
TSVI originado por la hipertrofia
del tercio basal del septum, gradiente máximo de 218 mmHg,
gradiente medio de 138 mmHg.
VD tamaño normal, TAPSE 22
mm, velocidad de jet de regurgitación de 2-6 m/seg a través
de la cual PSAP 27 mmHg;
conclusiones función sistólica
del VI, hipertrofia concéntrica
ligera VI. Disfunción diastólica tipo rodete subaórtico con
obstrucción dinámica VI como
complementación diagnóstica
se realizo cateterismo cardiaco
diagnostica por vía transfemoral
concluyendo origen anómalo de
S2
coronario derecha emergiendo
del seno izquierdo, más lesión
critica en segmento vertical del
70% la coronaria izquierda sin
lesiones angiográficas significativas, discutiéndose en sesión
médico-quirúrgica concluyendo manejo de mínima invasión
para intervención coronaria
percutánea de CD y ablación
septal con alcohol en un segundo tiempo. Conclusión: el
origen anómalo de las arterias
coronarias es infrecuente, pero
clínicamente significativo. Debido a su baja incidencia, no
se sabe la prevalencia real de
esta anomalía. Las manifestaciones clínicas pueden variar
desde pacientes totalmente
asintomáticos hasta pacientes
con angina, infarto de miocardio, fallo cardiaco, síncope,
arritmias y/o muerte súbita; sin
embargo en este caso reviste
importancia dada la asociación
con miocardiopatía hipertrófica
septal asimétrica la cual es
infrecuente, considerando solo
manejo de mínima invasión
tanto para la enfermedad arterial coronaria y obstrucción
dinámica del tracto de salida
del ventrículo izquierdo.
Aneurisma de la arteria pulmonar asociado a comunicación
interauricular. Reporte de caso
Luis Carlos Álvarez Torrecilla,
Alejandra Ruiz Fuentes, Priscila
Méndez Martínez, Roberto Álvarez Saucedo, Mario Salcedo
Roldán
División de Medicina Interna,
Hospital General J Vicente Vi-
llada, ISEM, Cuautitlán, Estado
de México
Introducción: los aneurismas
de arteria pulmonar son una
afección poco frecuente; en
la literatura mundial sólo se
encuentran documentados algunos casos aislados y todavía
no está claro su manejo. La
etiología de los aneurismas de
la arteria pulmonar (AAP) puede ser congénita o adquirida.
Presentación del caso: mujer
de 48 años de edad, con antecedente de hipertensión arterial
sistémica de 5 años tratada con
enalapril 1x2 oxígeno dependiente por EPOC. PA: Inicia
su padecimiento un día previo
al ingreso con dolor en región
precoridal típico de angina así
como cortejo neurovegetativo
y exacerbación de la disnea
asi mismo manifestando de 1
año a la fecha disminución de
la clase funcional y edema de
miembros inferiores sin protocolo diagnostico. EF: soplo
tricuspídeo sistólico intensidad
II/VI incrementa con maniobra
de Rivero Carvallo s2 desdoblado fijo y Talon de Dressler
(+). Excursión diafragmática
limitada, movs de amplexion
y amplexacion limitados, sin
crépitos destaca mencionar hiperclaridad pulmonar. Fovea(+)
TA 140-90 mmHg S0291%.
Bioquímicamente: sin datos
destacabales por comentar, Rx
Tórax: cardiomegalia, arterias
pulmonares con calibre incrementado ECG: BCRDHH+F.A
Respuesta ventricular media.
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
El ECOTT:FEVI 75%, hipertrofia
concéntrica del VI, disfunción
diastólica tipo II, dilatación
severa del ventrículo y aurícula derecha, PSAP 70 mmHg,
dilatación aneurismática del
tronco de la pulmonar, CIA
ostium secundum 13.7 mm
con cortocircuito bidireccional,
insuficiencia de pulmonar leve
y tricúspide moderada. Se realiza TAC contrastada de Torax:
encontrando dilatación aneurismática de la arteria pulmonar
de 48x10 mm. Discusión: los
aneurismas de arteria pulmonar son una afección poco
frecuente. Esta afección puede
ser congénita o adquirida Los
congénitos se asociación a
alteraciones estructurales del
tabique ineratrial o interventricular Los adquiridos pueden
ser idiopáticos o asociados
a infecciones (tuberculosis,
sífilis),traumas, estenosis valvular pulmonar o enfermedad
del tejido conectivo. por lo
tanto, en gran parte de los AAP
concurren una serie de situaciones fisiopatológicas previas
al desarrollo del aneurisma el
aumento del flujo pulmonar, la
HAP y/o la coexistencia de un
proceso patológico que afecte
a la pared vascular. Conclusión:
en la literatura mundial sólo
se encuentran documentados
algunos casos aislados, y todavía no está claro su manejo
en este caso al contar con
HAP severa y cortocircuito
enviándose a CCV para sesión
medico-quirúrgica y evaluar
mejor conducta.
Hemopericardio y salto de
bungee. Reporte de un caso
José Mauricio Cedillo Fernández, Brenda Gómez Gómez,
Alejandra Alarcón Sotelo,
María José Pardinas Llergo,
Enrique Juan Díaz Greene,
Federico Leopoldo Rodríguez
Weber
Hospital Ángeles Pedregal,
México, DF
Masculino 25 años, asma desde
la infancia, en remisión, consume AINE’s en forma ocasional.
Fuma 5 a 10 cigarrillos/día hace
unos 10 años (IT 7.5 paq/año)
ingiere alcohol de forma social
ocasionalmente. Inicia su padecimiento 2 semanas previas
con disnea de medianos esfuerzos que progresó a ortopnea
y opresión torácica posterior
a haber realizado salto de
bungee. Urgencias con TA de
70/45 mmHg, FC de 123 lpm,
FR de 26 rpm y temperatura de
37.5ºC y SaO2 al aire ambiente
de 85%. EF: sin ingurgitación
yugular, ruidos cardiacos se
encontraban disminuidos de
intensidad con adecuado murmullo vesicular, no se integraba
síndrome pleuropulmonar. ECG
taquicardia sinusal, ondas T
invertidas en V5, V6, DI y aVL
y alternancia eléctrica. Radiografía: cardiomegalia grado III
y “corazón en garrafa” ECO TT
separación entre ambas hojas
pericárdicas de 2.3 cm, que
correspondía a un derrame pericárdico de aproximadamente
1000 mL, con repercusión
hemodinámica. Pericardio-
centesis, obteniendo 450 mL
hemáticos con análisis citológico y citoquímico (leucocitos
de 6380 eritrocitos 115,000
con PMN 24% MN 76% proteínas 4.8 g/dL). Unas 96 horas
posterior a la misma presenta
nuevamente sensación de opresión torácica y disnea, se decide
pericardiotomía con ventana
pericárdica, con su análisis
patológico mostró pericarditis
crónica con hiperplasia linfoide
nodular y aguda fibrinosa moderada con hemorragia reciente
y antigua. Sin la presencia de
granulomas o infección. El salto de bungee es una actividad
que cada vez toma mayor popularidad. En algunos estudios
se ha reportado que hasta el
42% de los participantes reportan algún malestar médico
posterior al salto, siendo las
más frecuentes cefalea, visión
borrosa, mareo, parestesias en
miembros pélvicos, dolor lumbar, dolor torácico y dolor en
las extremidades. Las lesiones
penetrantes y no penetrantes
de tórax se pueden asociar a
hemopericardio y tamponade
cardiaco que por lo general
ocurre desde algunas horas
posteriores a la lesión hasta
días. Las lesiones por bungee
son producidas por caída libre
y mecanismos de aceleración
y desaceleración reversa. Las
fuerzas gravitacionales efectivas
sobre el organismo que resultan
de este deporte, se calculan
en 2.5 a 3.0 g en promedio,
llegando en ocasiones hasta
8 g. En este caso se identifica
S3
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
como único factor de riesgo de
importancia para el desarrollo
de un derrame pericárdico hemorrágico el antecedente del
salto de bungee.
Disfunción microvascular coronaria
JO Duarte Flores, JN López
Taboada, DM Dueñas Tamayo,
T Velázquez Gaspar, JR García
Díaz
Servicio de Medicina Interna,
Hospital General de Zona 48,
Instituto Mexicano del Seguro
Social, México, DF
Introducción: la disfunción
microvascular coronaria es
definida por una reserva de
flujo coronaria limitada, con
o sin disfunción endotelial
coronaria caracterizando por
un dolor torácico persistente y
enfermedad arterial coronaria
no obstructiva. Presentamos el
caso de un paciente de 23 años.
Objetivo: determinar causas
de cardiopatía isquémica en
pacientes jóvenes. Descripción: masculino de 23 años,
sin antecedente de crónico
degenerativo. Tabaquismo y
toxicomanías negadas. Inicia
su padecimiento al presentar en reposo dolor torácico
opresivo intensidad 9/10 con
irradiación a extremidad superior izquierda, adormecimiento
de varias horas de duración,
al día siguiente misma sintomatología acompañado de
nauseas, acude a Urgencias
Hospital de segundo nivel. A la
exploración física signos vitales
S4
normales. Campos pulmonares
sin alteraciones. Ruidos cardiacos rítmicos, adecuado tono
e intensidad, desdoblamiento
del primer ruido cardiaco en
foco pulmonar. Resto de la
exploración sin alteraciones.
Se evidencia elevación del ST
en cara inferior, estudios de
laboratorio electrolitos séricos
normales, DHL 408 U/L, CK
1303 U/L, CKMB 178 U/L, colesterol total 109 mg/dL, HDL
21 mg/dL. Se diagnostica IAM
con elevación del ST en cara inferior sin terapia de reperfusión
debido a tiempo de evolución,
TIMI 1, GRACE 73, KK1. Recibe manejo antiisquémico
óptimo, sin presentar nuevo
episodio de angina. Se realiza
ecocardiograma que reporta
zona discinética sugestiva de
Infarto del Miocardio reciente
en cara inferior con FEVI 55%.
Se realizar prueba de esfuerzo
con positividad para isquemia.
Se envía a tercer nivel para
cateterismo cardiaco, el cual
reporta ausencia de lesiones
ateroescleróticas con presencia
de flujo lento, se diagnostica
disfunción microvascular coronaria. Dos meses posteriores
se realiza ecocardiograma de
control con FEVI conservada
y zona hiperrefringente secundaria a zona de infarto previa.
Comentario: los factores de
riesgo no tradicionales para
cardiopatía isquémica no se
han estudiado de manera completa y aún existen diversas
incógnitas. Actualmente, se
continúa en estudios sobre el
entendimiento de la disfunción microvascular coronaria.
Conclusión: el infarto agudo
al miocardio en paciente joven
corresponde a un 5% de los
casos. Casi el 12% de los casos
tienen coronarias normales. La
disfunción microvascular coronaria se encuentra dentro de las
causas de enfermedad arterial
coronaria no obstructiva.
Aneurisma gigante de la arteria coronaria derecha en
un paciente con tuberculosis
ganglionar
Luis Alfonso Marroquin Dond ay, 1 , 2 A l e j a n d r o R i c a l d e
Alcocer,1,2 Jaime Galindo Uribe, 2 Zuilma Yurith Vázquez
Ortiz1,2
1
Residente de Medicina Interna, Centro Médico ABC,
México, DF
2
Instituto Nacional de Ciencia
Médicas y Nutrición Salvador
Zubirán, México, DF
Paciente femenina de 74 años
de edad con antecedente de
hipertensión arterial sistémica,
dislipidemia y tuberculosis
ganglionar y renal (tratamiento completo), se presentó a
consulta, 5 años previo a su ingreso, con molestia torácica (no
dolor) relacionada al ejercicio,
fatiga y un electrocardiograma normal, en esa ocasión
se diagnóstico enfermedad
por reflujo gastroesofágico
y recibió tratamiento. La paciente continuó con molestia
torácica intermitente por los
siguientes 3 años, hasta abril
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
2010 donde su sintomatología
se exacerbó, agregándose disnea de pequeños esfuerzos y
lipotimia durante el ejercicio.
El electrocardiograma mostró
bradicardia sinusal (42 lpm),
y un Holter con extrasistolia
auricular y ventricular frecuente
además de episodios de taquicardia supraventricular. Debido
a la sospecha de cardiopatía
isquémica, se realizó un ecocardiograma transtorácico de
estrés con dobutamina, el cual
demostró isquemia severa de la
pared inferior además de una
imagen compatible con una
masa que comprimía las cavidades derechas del corazón.
Para detallar con precisión la
imagen observada, se realizó una resonancia magnética
cardiaca que mostró un aneurisma gigante (64 x 54 mm)
dependiente de la arteria coronaria derecha proximal, además
de adenopatías mediastinales
de etiología tuberculosa. La
coronariografía confirmó el
diagnóstico e indicó la necesidad de tratamiento quirúrgico.
Se propuso tratamiento quirúrgico pero la paciente lo
rechazó. Por persistencia de
arritmias, la paciente requirió
la colocación de un marcapasos unicameral en modo VVI.
En enero 2012, la paciente se
presentó en urgencias con un
infarto agudo al miocardio sin
elevación del ST, se realizó nueva coronariografía que mostró
el hallazgo ya conocido. Se
ofreció nuevamente tratamiento
quirúrgico, el cual fue acepta-
do. Un nuevo ecocardiograma
transtorácico mostró crecimiento del aneurisma además de
insuficiencia cardiaca sistólica
del ventrículo derecho. Se realizó cirugía de by-pass coronario
y exclusión aneurismática de
la arteria coronaria derecha
con éxito. El cirujano reportó
la presencia de caseum en el
interior del aneurisma, aunque
la patología fue negativa para
tuberculosis. Este caso ilustra
un hallazgo inusual como causa de cardiopatía isquémica
y síndrome coronario agudo,
estudiado mediante análisis cardiovascular multi-imagen, en el
escenario de un paciente con
tuberculosis extra-pulmonar,
como factor inflamatorio local
para el desarrollo de un aneurisma coronario gigante.
Pentalogía de Fallot en mujer
de 36 años, nunca intervenida
quirúrgicamente
Mario Alexander López Cauich,
Luis Alberto Pérez Ortiz, Oscar
Faibre Alvárez, Alejandro Quintín Barrat Hernández
CMN Adolfo Ruiz Cortines,
IMSS, Veracruz. Medicina
Interna, Puerto de Veracruz,
Veracruz
Reporte de caso: la pentalogía
de Fallot consta de cuatro alteraciones (tetrallogía de Fallot:
hipertrofia del ventrículo derecho, obstrucción del tracto de
salida del ventrículo derecho,
comunicación interventricular
y cabalgamiento aórtico) más
comunicación interauricular.
Descrito en 1888, por Etienne
Fallot. Femenino de 41 años,
con Antecedentes: tetrallogía
de Fallot a los 7 años, estudiada
por disnea y cianosis periférica,
al correr. Se protocolizó esta
vez por disnea al caminar 100
m. Con ecocardiograma en
mayo de 2012 concluyendo
tetralogía de Fallot. Fue manejada como tretalogía de Fallot,
se agregó digoxina 0.125 mg al
día. Al no haber mejoría se envió al CMN Adolfo de Veracruz,
se le realizó estudios de laboratorio prequirúrgicos: Enero
de 2013: hemoglobina: 16.10
g/dL, hematocrito: 53.2%. A la
exploración física: acropaquia
marcada, disnea moderada, cianosis periférica, soplo en barra
holosistólico aórtico, con ingurgitación yugular grado I. En
febrero de 2013 se diagnostica
por cateterismo cardiaco pentalogía de Fallot, con hallazgos:
comunicación interventricular
sub-aórtica, estenosis pulmonar mixta infundibular y
valvular severa, arco aórtico
derecho y ascendente muy dilatada, comunicación interatrial
amplia, hipertrofia y dilatación del ventrículo derecho.
Presiones: TAPSE: 24/15/19,
aorta: 144/80/105, ventrículo
derecho: 157/14, ventrículo
izquierdo: 155/15, gradiente
transpulmonar: 131 mmHg. Gasometría arterial prequirúrgica:
SO2: 76%, pCO2: 55 mmHg,
pO2:46 mmHg. Postquirúrgica: pCO2: 40 mmHg, pO2: 76
mmHg, SO2: 94%, FiO 21%.
Se realiza cirugía, con hallaz-
S5
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
gos y procedimientos: defecto
interventricular de 20 mm, estenosis valvular pulmonar e
infundibular severas, defecto
aproximadamente 9 mm. Se
cierra comunicación interventricular con parche doble Vellour,
se cierra parcialmente comunicación interauricular. Paciente
sale de cirugía permanece en
unidad de cuidados coronarios
48 horas sin complicaciones
agudas. La importancia de este
padecimiento es que es rara, la
mayoría de los pacientes viven
operados desde la infancia, en
promedio de 20 a 30 años, en
cirugías sin complicaciones.
En este caso la paciente sobrevivió sin cirugías hasta los 36
años, sin causa conocida, la
sobrevivencia la paciente, probablemente se debió a que las
alteraciones no eran tan severas
en la infancia.
Amiloidosis cardiaca. Reporte
de un caso y revisión de la
literatura
Ivonne Samantha García López,1 Rocío Mendoza Chávez,1
Ricardo Reyes Parra,2 Leticia
Lira Rivera, 1 Jorge Mendoza
Balanzario1
1
Hospital de Especialidades Belisario Domínguez México, DF
2
Cardiología, Hospital Central
Sur de Alta Especialidad, Pemex, México, DF
Introducción: la amiloidosis
es una enfermedad de etiología desconocida que ataca a
la población adulta senil en
alrededor de 8 por millón de
S6
habitantes/año. Está causada
por el depósito de material proteináceo insoluble, la sustancia
amiloide, en el intersticio del
corazón. Las causas de la formación y depósito de amiloide
no han sido aún dilucidadas.
Descripción del caso: masculino de 39 años, antecedente de
padre, abuelo y tío paterno con
miocardiopatía hipertrófica.
A los 27 años se diagnosticó
hipertensión arterial. A los 28
años se determinó miocardiopatía hipertrófica asimétrica
(MHA) sin arritmias cardiacas,
trastornos de la conducción
o isquemia. 10 años después
inició con disnea, se realizó
estudio Holter, que reportó fibrilación auricular (FA) y MHA,
el ecocardiograma reportó
función sistólica del ventrículo
izquierdo deprimida, hipocinesia global, hiperrefringencia
del ventrículo izquierdo que
sugería miocardiopatía infiltrativa, dilatación biauricular,
insuficiencia mitral severa. Se
realizó resonancia magnética
que evidenció MHA no obstructiva del ventrículo izquierdo,
de la porción media y apical
del ventrículo derecho, fibrosis
extensa del ventrículo izquierdo. Cursó con síncope en 3
ocasiones. 2 meses después se
realizó biopsia endomiocárdica
mediante cateterismo, reportando a la tinción con rojo Congo
depósitos de material amiloide.
Se realizó biopsia de tejido
subcutáneo periumbilical, de
médula ósea, pulmonar y renal
negativas a infiltración. Se rea-
lizo estudio molecular para gen
TTR en el padre y el paciente,
descartando mutaciones en
éste de la forma autosómica. Se inició dexametasona,
anticoagulante, inhibidor de
enzima convertidora de angiotensina, diurético de asa,
mostrando mejoría de su clase
funcional. Discusión y Conclusiones: es una enfermedad
poco frecuente, por lo que no
se plantea como primer diagnóstico, el promedio de edad
de presentación es de 60 años,
la presentación de amiloidosis
cardiaca es infrecuente antes
de los 40 años y en este caso
nuestro paciente tenía 39 años,
fuera de los rangos de edad
mencionados, sin embargo los
síntomas y datos aportados por
gabinete apoyaron la sospecha
diagnóstica que se corroboró
por estudio histopatológico, teniendo en cuenta que el tiempo
transcurrido entre la aparición
de los síntomas y el diagnóstico
repercute claramente en el grado de compromiso sistémico y
en el pronóstico de sobrevida
de los pacientes.
Síndrome de Eisenmenger y
embarazo. A propósito de dos
casos
María del Rosario Estrada Falcón, Rusvel Rincón Pozo
Servicio de Medicina Interna,
Hospital Regional Dr. Rafael
Pascasio Gamboa, SSA, Tuxtla
Gutiérrez, Chiapas
Introducción: el síndrome de
Eisenmenger se define como
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
una enfermedad vascular pulmonar de tipo obstructivo,
que se desarrolla a partir de la
existencia previa de una comunicación entre la circulación
sistémica y pulmonar. Su pronóstico es pobre, resultando en
deterioro progresivo de la clase
funcional y muerte. Presentamos el caso de 2 pacientes con
este síndrome, secundario a CIA
y aurícula única. Descripción
del caso: caso 1: mujer de 25
años de edad, ingresa a nuestra
institución con embarazo de 34
sdg, sin control prenatal, portadora de cardiopatía congénita
del tipo CIA, diagnosticada en
este internamiento, tipo ostium
secundum amplia, con flujo bidireccional, PSAP de 92 mmHg.
Con sO2 88% al aire ambiente, clase funcional III de la
NYHA. Se decide interrupción
de embarazo vía abdominal a la
semana 35 del embrazo. Caso
2: mujer de 21 años de edad,
portadora de cardiopatía congénita tipo aurícula única con
PSAP de 114 mmHg, con sO2
84% al aire ambiente, clase
funcional III de la NYHA, sin
seguimiento médico desde los
8 años de edad. Resolución de
embarazo via abdominal, por
restricción importante del crecimiento intrauterino secundario
a hipoxia crónica a las 33sdg.
Comentarios: ambas pacientes
llegaron al tercer trimestre del
embarazo, está descrito que la
combinación de hipertensión
pulmonar y embarazo, tienen una mortalidad de hasta
50%. Los cambios cardiovas-
culares como hipervolemia y
disminución de la resistencia
vascular periférica, provocan
que la hipertensión pulmonar
sea pobremente tolerada por la
embarazada con Eisenmenger.
En esta serie clínica no hubo
muertes maternas, los riesgos
perinatales correspondieron a
los propios de la prematurez
y restricción de crecimiento
intrauterino. Debido a la severidad de ambos cuadros,
ambas pacientes son manejadas con medidas paliativas.
Si bien, se ha visto que los
prostanoides y antagonistas
de receptores de endotelina,
han tenido impacto en la mortalidad de estos pacientes, no
se tiene accesibilidad a ellos.
Conclusiones: presentamos
esta pequeña serie, debido a
que estos pacientes deben ser
abordados de manera multidisciplinaria, en mejora de la
calidad de vida, ya que el único
tratamiento definitivo en ambas
es trasplante cardiopulmonar.
Afortunadamente, se ven con
menos frecuencia en la etapa
adulta, las secuelas de cardiopatías congénitas no corregidas
en la infancia, sin embargo por
la complejidad de su abordaje
y tratamiento representan todo
un reto para el clínico.
Cardiomiopatía por estrés:
reporte de 2 casos
Luis Alberto Pérez Ortiz, Mario
Alexander López Cauich, Oscar
Faibre Álvarez
UMAE núm. 14 Adolfo Ruiz
Cortines, Veracruz, Ver.
La cardiomiopatía por estrés,
corazón roto o cardiomiopatía
takotsubo. Se caracteriza por
disfunción sistólica transitoria
en ápice y/o segmentos medios del ventrículo izquierdo,
simula infarto de miocardio, en
ausencia obstrucción arterial
coronaria, desencadenado por
enfermedades graves, estrés
físico o emocional. 1) masculino de 72 años de edad,
ingresa a UCI con diagnóstico
de PO LAPE, hepatorrafia,
cierre primario de colon por
lesión de arma de fuego. Antecedentes: HAS, dislipidemia.
Con evolución tórpida en 24 h
presentando angor típico, EKG
necrosis cara anterior e isquemia subepicárdica cara lateral,
TNI 13, CPK 897, CPKMB 52,
posteriormente con insuficiencia cardiaca aguda requiriendo
ventilación mecánica invasiva;
se realizó ECOT con acinesia
de segmentos medios de cara
anterior, inferior y discinesia
apical, FEVI 18%, requirió de
inotrópicos, aminas vasoactivas, el cateterismo reportó
coronarias izquierdas normales,
coronaria derecha dominante
sin lesión, ventrículo izquierdo
con discinesia apical, ascinesia
segmentos medios del septum,
con evolución favorable. ECOT
10 días posterior a ingreso
con FEVI 75%, contractilidad
normal. Se egresa con betabloqueador y antiagregante
plaquetario. 2) Masculino de
69 años, antecedente IT 7.8,
ingresa a Ingresa a UCI con
diagnóstico de IAM CEST; pos-
S7
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
terior a riña, presenta angor
típico, EKG necrosis de cara
inferior, biomarcadores TNI
21,4M CPK 1119, CPKMB 67,
recibió nitratos, sin mejoría,
presentado FA paroxística e
insuficiencia cardiaca aguda,
requirió cardioversión farmacológica y eléctrica; cateterismo
reportó coronarias izquierda
y derecha sin datos de obstrucción, normales, ventrículo
izquierdo con acinesia anteroapical e inferior, FEVI 40%,
requirió de inotrópicos, con
mejoría retirándose en 72 h,
ECOT con cardiopatía isquémica con hipocinesia apical
del ventrículo izquierdo, con
FEVI del 47%. Egresa con betabloqueador, antiagregante,
IECA. Por su baja frecuencia,
no hay criterios definidos dentro de los sugeridos ambos
cumplen con: discinesia o
acinesia transitoria apical del
ventrículo izquierdo, asociado
a evento gatillo, elevación del
segmento ST y biomarcadores
cardiacos, en ausencia de enfermedad coronaria obstructiva
por angiografía. El diagnóstico
diferencial con SICA por su
similitud es imposible, por
lo que esta patología puede
ser más frecuente de lo esperado en nuestro medio, y
probablemente se encuentran
subdiagnosticados.
Puente miocárdico con fenómeno de ordeñamiento coronario,
como causa de angina inestable
Gabriela González Rodríguez,
Gabriel Arturo Ramos López,
S8
Ayax Nivardo Sobrino Saavedra,
Paola Elizabeth Díaz Aceves,
María de La Luz Machuca R
División de Medicina Interna,
Hospital Civil de Guadalajara
Dr. Juan I Menchaca, Guadalajara, Jalisco, México
Se trata de paciente femenino
de 42 años de edad previamente sana, sin antecedentes
de enfermedades crónico degenerativas, tabaquismo o
toxicomanías, sin factores de
riesgo cardiovascular, la cual
acude al servicio de urgencias
por presentar subitamente al
reposo dolor precordial opresivo, intenso en escala visual
analoga del dolor 10/10, con
irradiación a hombro y brazo
izquierdo, trasfictivo a espalda,
acompañado de palpitaciones
y diaforesis profusa, por lo
que clinicamente presenta un
síndrome coronario agudo,
se realiza EKG: en ritmo sinusal, con FC de 100 latidos
por minuto, sin desviacion
del eje, datos de isquemia o
alteraciones en la conducción
eléctrica, con enzimas cardiacas y triponina I negativas. Se
inicia manejo antisquémico,
con presencia de periodos de
angina intermitentes sin cambios electrocardiograficos, Por
lo anterior se realiza estudio
angiográfico que comprueba
una compresión de la arteria
descendente anterior como
causa del síndrome isquémico
Agudo. Se da manejo medico
con posibilidad de referirse a
revascularización miocárdica
en caso de recurrencia clínica.
Según series angiográficas la
incidencia del fenómeno es de
0.6 a 4% , siendo, sin embargo, la incidencia de puentes
miocárdicos en estudios necrópsicos dirigidos, de hasta un
55-85% están constituidos por
haces de fibras musculares que
recubren un trayecto variable
de una arteria coronaria epicárdica, cursando en muchos
casos de manera asintomático
u originan síntomas debido a
síndromes isquémicos coronarios agudos como en el caso
de la paciente , Su diagnóstico
se realiza in-vivo por estudio
angiográfico, al comprobarse
una compresión sistólica de una
arteria coronaria que desaparece durante la sístole, fenómeno
denominado de Milking u “ordenamiento”.
Hipopituitarismo como manifest ación de aneurisma
cerebral. Reporte de un caso
CE Garnica Camacho,1 F Gutiérrez Manjarrez,2 A Ornelas3
1
Residente de medicina interna
2
Medicina Interna, neurología
y neurofisiología
3
Medicina Interna
Hospital General Tijuana,
ISESALUD, Tijuana, Baja California
Introducción: el hipopituitarismo es la incapacidad de la
glándula pituitaria para liberar
las hormonas necesarias para
la homeostasis. Es causado en
dos terceras partes por un tumor
pituitario. Entre las restantes,
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
los aneurismas cerebrales son
causas raras. Se describe el caso
de una mujer con hipopituitarismo asociado a aneurisma
cerebral como etiología. Caso
clínico: mujer de 40 años de
edad, previamente sana, sin
antecedentes de importancia.
Desde hace 7 años presenta amenorrea, aumento de
peso, polidipsia y poliuria. A su
valoración destacaba deshidratación y galactorrea. Sodio 159
meq/L, densidad urinaria menor
a 1.005, TSH 0.08, T4L 1.04,
prolactina, LH y FSH normales.
Se realiza TC de cráneo simple
normal. Inició levotiroxina
100 mcg y desmopresina 178
mg. En la actualidad, acude
a Urgencias por cuadro de 4
semanas de somnolencia, cefalea holocraneana, poliuria, y
deshidratación. Reportan sodio
173 meq/L, potasio 2.5 meq/L.
TC contrastada de cerebro donde se observa hiperdensidad
en espacio interpeduncular.
Se inician soluciones hipotónicas y desmopresina cada
8 horas con mejoría clínica
gradual. Se complementa estudio con angiotomografía
cerebal reportando un aneurisma de 145 mm X 136 mm
en el espacio interpeduncular
en mesencéfalo, dependiente
de la bifurcación de la arteria
basilar con las cerebrales posteriores. Comentario: causas de
hipopituitarismo se atribuyen a
tumores pituitarios, extrapituitarios, trauma, enfermedades
infiltrativas, infecciosas, genéticas y vasculares. Dentro de
estas últimas, los aneurismas
cerebrales corresponden al
0.17%. Su mecanismo es por
interrupción de la liberación de
hormonas hipotalámicas e hipofisiarias. Los aneurismas pueden
simular tumores pituitarios, al
manifestar hipopituitarismo
y generar compresión, traduciéndose en afección visual y
síndromes neurológicos. Así,
distinguir entre estas dos entidades es esencial para dirigir
un tratamiento específico. En
el tratamiento, la reposición
hormonal es fundamental, sin
embargo, la cirugía es el tratamiento primario. Su objetivo es
minimizar el riesgo de ruptura
aneurismática y la restauración
hormonal.
Neoplasia endocrina múltiple
tipo 2 A. Presentación de un
caso
Hugo Alberto Arellano Sotelo,
Erica García Valadés, Arturo
Delgado Pesero, Javier Alan
Domínguez Castillo, Nallely
Sandoval García
UMAE núm. 1, Hospital de Especialidad, CMN Bajío, IMSS,
León, Guanajuato
Introducción: la neoplasia
endocrina múltiple tipo 2 es
un síndrome raro con forma
hereditaria autosómica dominante con una prevalencia
estimada de 1/30,000 en la
población general. Se ha clasificado dentro de 3 variantes:
NEM2A en un 55%, carcinoma
medular familiar de tiroides en
35% y NEM 2B en un 10%. El
diagnóstico de NEM2A se basa
en presencia de dos o más tumores endócrinos específicos
(carcinoma medular de tiroides,
feocromocitoma o adenoma/
hiperplasia de paratiroides) en
un individuo. Las variantes son
causadas por mutaciones en el
protooncogén RET y probablemente una mutación de novo
en 5% se observa en NEM2A.
Descripción del caso: paciente
femenina de 23 años de edad,
con carga genética para hipertiroidismo, padre con tumor
suprarrenal de origen desconocido. Inicia cuadro clínico
con crisis de ansiedad, palpitaciones, cefalea holocraneana
que aumenta con esfuerzos
y maniobra de Valsalva. En
noviembre de 2011 se detecta
quiste renal derecho de 9 cm
por TAC, así como tumor en
glándula suprarrenal izquierda
de 3cm de diámetro, heterogéneo con datos de necrosis,
concluyendo diagnóstico de
feocromocitoma. Metanefrinas
totales en orina de 24 horas
10,118 mcg. Metanefrinas totales en plasma 5053pg/ml.
Tratada con suprarrenalectomía
el 21/12/2011. Diagnóstico
histopatológico: paraganglioma
maligno. Hallazgo de tumoración suprarrenal derecha.
Manejada con metoprolol y
prazocina. En 17/02/2012 se
realiza diagnóstico de aumento de actividad metabólica de
glándula adrenal derecha que
sugiere tumor residual. Glándula tiroides con actividad
hipermetabólica en lóbulo de-
S9
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
recho, sugerente de neoplasia
primaria a este nivel por medio
de PET/CT. Tratamiento establecido con suprarrenalectomía y
tiroidectomía total con disección radical de cuello bilateral.
Comentarios: La NEM 2 A se
hereda de forma autosómica
dominante. Es la variante más
común de las NEM 2. Se requiere de diagnóstico de 2 tumores
endócrinos en un individuo
para llegar a su diagnóstico.
No existe una prueba de escrutinio bien establecida para
realizar el diagnóstico de esta
patología, aunque se intentó
establecer la prueba provocativa de liberación de calcitonina
como diagnóstico precoz en
familiares de pacientes con
diagnóstico de NEM 2 A. Conclusiones: a la paciente se le
realiza el diagnóstico de NEM
2 A por presentar dos tumores
endocrinos; entre ellos cáncer
tiroideo y feocromocitoma. Se
establece tratamiento quirúrgico con resección de ambos
tumores.
Parálisis hipocalémica secundaria a enfermedad de Graves
Sugely Fonseca Martínez, A
Suárez Zaizar, J Carrizales Luna,
M Herrera Pérez, M Sánchez
Ávila, V Sánchez Nava
TEC Salud, Hospital San José,
Unidad de Cuidados Intensivos
del Adulto, Monterrey, Nuevo
León
Introducción: la parálisis
periódica tirotóxica es una
complicación grave y potencial-
S10
mente letal del hipertiroidismo
caracterizada por un inicio
súbito de debilidad muscular
acompañada de hipocalemia,
ocasionada por el desplazamiento intracelular de potasio,
puede acompañarse de hipofosfatemia e hipomagnesemia.
Caso clínico: paciente masculino de 42 años sin antecedentes
de importancia que presentó
episodios súbitos de paresias
en extremidades inferiores de
intensidad variable que resolvían de manera espontánea
después de algunas horas. En
el último episodio se presentó
con cuadriplejia, disnea y disfagia asociadas a la presencia
de hipocalemia, K+1.7mEq/L,
e hipofosfatemia, PO4 <0.7
mEq/L. Fuerza muscular 1/5,
reflejos osteotendinosos 0/5 en
las 4 extremidades. Se realiza
un perfil tiroideo en donde se
reporta TSH menor de .01 UI/
mL, T4 libre 2.69 ng/dL, T3
3.09 ng/dL. Al interrogatorio el
paciente refirió síntomas de pérdida de peso de 7kg en un mes,
insomnio, temblor de manos,
polidipsia y poliuria. Se solicitaron anticuerpos anti-peroxidasa
con resultado positivo, inmunoglobulina estimulante de la
tiroides con resultado negativo.
En la gammagrafía tiroidea
con tecnecio-99 se reportó:
glándula tiroides aumentada
en tamaño 43 g, con captación
tiroidea heterogénea del 4.8%
sugestivo de bocio tirotóxico. Se
inició tratamiento con tiamazol
y reposición de potasio intravenoso. El paciente presento una
recuperación inmediata con
mejoría de la fuerza muscular
en extremidades (fuerza muscular 5/5), manteniendo niveles
de potasio y fosfato dentro de
parámetros normales. Comentarios: en el caso presentado los
datos clínicos de tirotoxicosis
se encontraron en el interrogatorio por aparatos y sistemas,
la presencia de paresias y la
evolución a parálisis fue el
síntoma principal presentado
por el paciente. Aunque la
parálisis hipocalémica como
complicación de la tirotoxicosis se describe con mayor
frecuencia en países asiáticos,
su presencia en caucásicos,
afroamericanos e hispanos se
ha incrementado en los últimos
años. Conclusiones: la parálisis periódica tirotóxica es un
diagnostico a considerar en el
contexto de parálisis de inicio
súbito en pacientes jóvenes del
sexo masculino ya que el manejo correcto de estos cuadros
puede prevenir complicaciones
cardiopulmonares graves. La
prevención de las recurrencias
se lleva a acabo manteniendo
el estado eutiroideo y evitando
factores precipitantes (ingesta
de carbohidratos, alcohol, sal).
Insulinoma: reporte de caso
José Miguel Álvarez Blanco,
Raúl Eugenio Valdés Galván,
Mireya Citlalli Pérez Guzmán,
Héctor Montiel Falcón, Joaquín
Gerardo Joya Galeana, Javier
Macías
Centro Médico ABC, México,
DF
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Presentamos el caso de paciente
femenina de 75 años, quien es
llevada a nuestro hospital tras
ser encontrada inconsciente
en su domicilio. Durante su
traslado se documentó glicemia
capilar de 17 mg/dL y recuperó
el estado de consciencia tras
administración de dextrosa
intravenosa. Al interrogatorio
la paciente negó ser diabética
o tomar medicamentos hipoglucemiantes. Refirió tener el
diagnóstico de hipoglucemia
recurrente desde hace 20 años
en un hospital estadounidense,
sin una etiología específica, y
con manejo de dieta en quintos,
con lo que se había mantenido asintomática. Los dos días
previos a su ingreso presentó
cuadro de gastroenteritis severa
asociada a fatiga severa, con
incapacidad para levantarse de
la cama, sin ingesta de alimentos
por al menos doce horas, sin
poder recordar lo acontecido
la noche previa a su ingreso.
Negó fiebre o consumo de alcohol en altas cantidades. A su
ingreso no volvió a presentar
síntomas de gastroenteritis. Se
decidió mantener en ayuno a
la paciente durante la primera
noche de su ingreso con el
objetivo de documentar nuevo
episodio de hipoglucemia. Durante su ingreso se documentó
glucosa central en 37 mg/dL sin
síntomas, además de niveles de
insulina 7.3 µUI/mL, péptido C
plasmático 2.04 ng/mL, proinsulina 19.9 pmol/L, IGF-II 184 ng/
mL, beta-hidroxibutirato 0.06
nmol/L. Con dichos resultados
se realizó el diagnóstico de
hiperinsulinismo endógeno. Se
decidió realizar ultrasonido endoscópico en donde se visualizó
masa hipoecoica de 10 X 5mm
en cuerpo de páncreas. Se realizó enucleación laparoscópica
de masa pancreática de 0.9 cm
en su eje mayor, que estudio
histopatológico se documentó
una neoplasia neuroendocrina
grado 1 con positividad por
inmunohistoquímica a insulina.
Los insulinomas tienen una incidencia de 3 casos por millón
de personas-año. Representan
la causa más frecuente de hiperinsulismo endógeno. Su
diagnóstico requiere la exclusión
de otras causas de hipoglucemia, incluyendo el consumo de
alcohol, enfermedad infecciosa
grave, insuficiencia hepática,
renal o cardiaca, además de
excluir diabetes mellitus o el
uso de hipoglucemiantes orales,
al tiempo que se demuestran
concentraciones anormales de
insulina y péptido C en presencia de hipoglucemia. Sólo así
se realizará estudio de imagen
y posteriormente se realizará el
manejo quirúrgico, que suele
ser curativo.
Rabdomiólisis asociado a hipotiroidismo
Laura Patricia Whittall García,
Leidy Jineth Díaz Villar, Blanca
María Castillo Morfín, Eduardo
Martínez Hernández, Diana
Castellanos Rodríguez
Medicina Interna, Hospital
General de México Dr. Eduardo
Liceaga, México, DF
El músculo esquelético es un
órgano blanco de los trastornos tiroideos, alrededor
de 79% de los paciente con
hipotiroidosmo tiene síntomas neuromusculares, las
manifestaciones más frecuentes son mialgias, debilidad
muscular proximal y reflejos
osteotendinosos hipoactivos,
la rabdomiólisis es infrecuente
y se asocia a varios meses de
deficiencia hormonal. Paciente
masculino de 49 años de edad
con etilismo positivo desde los
15 años a la fecha con consumo de 150 g/sem, tabaquismo
con IT 30. Niega enfermedades
crónicas. Antecedente de tiroidectomía total con disección
ampliada de cuello en agosto
del 2013 por carcinoma papilar de tiroides de alto riesgo
MACIS 7 estadio III, TNM
estadio IV A, sin sustitución
hormonal posterior. Inició un
mes previo a su ingreso, con
parestesias en extremidades,
mialgias, astenia y adinamia,
las cuales incrementaron hasta provocar postración por
debilidad generalizada por lo
que acude a urgencias. A la
exploración física se encuentra
paciente alerta, con mucosas
deshidratadas, piel áspera seca,
cuello con cicatriz quirúrgica,
tórax normal, abdomen globoso a expensas de panículo
adiposo, no viseralomegalias,
extremidades con dolor a la
palpación de musculatura de
cintura escapular y pélvica
con fuerza 3/5 proximal y 4/5
distal, sensibilidad preserva-
S11
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
da. Durante su estancia se
encuentra desequilibrio hidroelectrolítico caracterizado
por hipocalcemia y elevación
de azoados con creatinina de
1.3, perfil tiroideo con TSH
de 100, T4 libre 0.26, T3 libre
1.99 y enzimas musculares con
CPK de 27,000. Con evolución
tórpida, anuria, elevación de
creatinina a 9, requiriendo
terapia de sustitución renal,
cursando con neumonía nosocomial que requirió manejo en
terapia intensiva con manejo
avanzado de la vía aérea, dado
de alta tras 31 días de estancia
intrahospitalaria con sustitución de hormonas tiroideas y
corrección de lesión renal, al
alta creatinina de 0.9, CPK de
1265. El paciente cursó con
con rabdomiólisis secundaria
a hipotiroidosmo grave, lo
que lo llevó a lesión renal
aguda AKIN con necesidad de
terapia de sustitución renal. El
caso muestra la importancia
del reconocimiento del hipotiroidismo como causa de
síntomas neuromusculares. La
miopatía por hipotiroidismo
tiene evolución favorable una
vez iniciada la terapia de remplazo hormonal, sin embargo
hasta el 30% de los pacientes
pueden persistir con síntomas
residuales hasta 1 año de controlado el cuadro.
Hipercalcemia secundaria a
enfermedad granulomatosa:
reporte de un caso
Angélica Juárez López, Iván
Darío Hernández Erazo, Janeth
S12
Realpe Díaz, Nadia Alejandra
Gandarilla Martínez, Jazmín
Teresa Pozos López
Hospital General Dr. Manuel
Gea González, Servicio de
medicina interna, México, DF
La hipercalcemia es un trastorno relativamente común.
Determinar la etiología permite
distinguir entre tratamiento
quirúrgico y médico, relacionado con el pronóstico. Hay
causas poco frecuentes, como
el secundario a enfermedades
granulomatosas. Masculino
de 63 años, originario de estado de Guerrero, agricultor.
Antecedentes de tabaquismo
y etilismo. Lepra lepromatosa desde 2011, tratada con
dapsona, rifampicina y clofazimina; Diabetes mellitus tipo
2 e Hipertensión arterial sistémica diagnosticadas en 1998;
hipertrofia prostática benigna
con diagnóstico en 2011. Dengue en enero/2013 resuelto de
manera conservadora; pérdida
ponderal involuntaria de 10kg
en 1 mes. Inició febrero/2013
con cefalea, astenia, adinamia,
edema de miembros pélvicos y
torácicos, evolucionó a edema
facial, suspendió tratamiento
contra lepra; se agregó hiporexia. En valoración médica se
halló dermatosis generalizada
a cara, tórax y extremidades
pélvicas por placas infiltradas
eritemato-violáceas con bordes
activos y disestesias. Laboratorios destacaron hemoglobina
11.2 g/dL, creatinina 1.63 mg/
dL, albúmina 2.9 mg/dL, fós-
foro 4.51 mg/dL, calcio sérico
14.4 mg/dL (corregido 15.2
mg/dL.) Se solicitó PTH: 2 y
4.7 pg/mL (12-88 pg/mL). Se
solicitó de manera externa 25
hidroxivitamina D y 1,25 dihidroxivitamina D. Sospechando
malignidad como causa frecuente, se realizó estudio para
cáncer esofágico, pulmonar,
renal, linfoma y mieloma múltiple, siendo negativos. Niveles
de 25 hidroxivitamina D y 1.25
dihidroxivitamina D con cifras
de 10.5 ng/dL (5-50.8 ng/mL)
y 105 pg/mL (18-72 pg/mL)
respectivamente. Se diagnosticó hipercalcemia secundaria
a enfermedad granulomatosa.
El paciente recibió tratamiento
de soporte con hidratación
intensiva, diuréticos de asa y
esteroides, se reanudó tratamiento para lepra, con mejoría
y resolución de síntomas. La
hipercalcemia secundaria a
enfermedad granulomatosa
ocupa, junto con otros diagnósticos diferenciales, menos
del 10% de los casos. La sarcoidosis y tuberculosis se reportan
en mayor cantidad, siendo los
menos los relacionados con
lepra. La fisiopatología se cree
se debe a la presencia de alfa1 hidroxilasa en células del
granuloma, incrementando la
conversión de 25 hidroxivitamina D a 1,25 dihidroxivitamina
D. El tratamiento es soporte y
tratar la causa subyacente.
Hipoglucemia como manifestación de hipocortisolismo y silla
turca vacía
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Rocío Morales Delgado,1 Azucena Zapata Rivera, 2 Karla
Victoria Rodríguez Velver,2 Dionicio Galarza Delgado1
1
Departamento de Medicina
Interna
2
Servicio de Endocrinología
Hospital Universitario José
Eleuterio González, Universidad Autónoma de Nuevo
León, Monterrey, Nuevo León,
México
Introducción: la hipoglucemia
se define por la reducción en
el nivel de la glucosa sanguínea capaz de inducir síntomas
debido a la estimulación del
sistema nervioso autónomo o
a la disfunción del sistema nervioso central. Es un síndrome
clínico multifactorial. Tiene
varias causas relacionadas con
el aumento en la utilización
periférica, falla en la síntesis o
secreción de hormonas contra
reguladoras y disminución de
producción hepática. Descripción del caso: femenino de 78
años de edad con antecedente
de diabetes mellitus tipo 2 desde hace 2 años en tratamiento
con metformina. Dentro de sus
antecedentes gineco-obstétricos se encuentran 11 gestas, 11
partos, éste último con sangrado
abundante que requirió transfusión sanguínea, posterior a esto
no tuvo lactancia y ya no tuvo
menstruaciones. Refiere cuadro
clínico de 2 meses de evolución
caracterizado por cefalea intensa síncope y crisis convulsivas,
motivo por el cual estuvo hospitalizada en cinco ocasiones.
Fue estudiada con punción
lumbar, Resonancia magnética
de cerebro, todo normal. En
uno de sus internamientos se
documentó hipoglucemia de
27 y tríada de Whipple mejorando los síntomas al revertir la
hipoglucemia, posteriormente
acude nuevamente a urgencias por crisis convulsiva y se
documenta hipoglucemia de
34. A la EF neurológicamente
íntegra, orientada, coloración
adecuada de tegumentos, no
facies característica, mucosa
oral bien hidratada, no datos
de hiperpigmentación, cuello
cilíndrico sin adenopatías,
glándula tiroides no palpable,
tórax bien aereado no ruidos
agregados, ruidos cardiacos
sin soplos, abdomen blando,
depresible, peristalsis normal,
no masas, no adenopatías, extremidades sin edema, pulsos
normales. Se realizó péptido C
cuyo resultado fue de 0.9 ng/
mL (valor normal de 1.1 a 4.4
ng/mL), cortisol sérico con valor
de 3.3 ug/dL, GH con valor de
0.55, insulina valor 9 (corte de
0-30), TSH de 3.41, T4L 1.18,
estimulación cortrosyn basal
de 3.2, a los 30 min de 5.9, a
los 60 min de 3.8 mcg/dL, FSH
73, LH 32.5, E2 < 5, prolactina
9.34. Se analizó la resonancia
magnética previamente tomada
a nivel de hipófisis encontrando
aracnoidocele grado III más silla
turca vacía. Se inició tratamiento con prednisona 5 mg en am
y 2.5 mg en pm. Comentarios:
en este caso se hizo abordaje
para hipoglucemia tomando en
cuenta las causas más frecuentes. Conclusiones: se llegó al
diagnóstico de hipocortisolismo
secundario a silla turca vacía
en una paciente mayor de edad
con hipoglucemia.
Hipertensión arterial pulmonar, pancitopenia y colestasis
intrahepática: manifestaciones
atípicas de la enfermedad de
Graves
Luisa Geraldine Villanueva Rodríguez, Raúl Rivera Moscoso,
Francisco Gómez Pérez
Departamento de Endocrinología, Instituto Nacional de
Ciencias Médicas y Nutrición
Salvador Zubirán, México, DF
Introducción: la enfermedad
de Graves es la principal causa
de hipertiroidismo. Existen
manifestaciones atípicas de
esta entidad, la falta de su conocimiento puede retrasar el
diagnóstico. Descripción del
caso: femenino de 30 años,
sin antecedentes médicos de
importancia. En mayo 2012
presentó ictericia, dolor en hipocondrio derecho, pérdida de
peso, edema de extremidades
inferiores y fiebre. T/A: 100/60,
FC: 106 lpm, FR: 20 rpm, peso:
39 kg, temperatura: 38.4ºC.
Ictericia escleral y exoftalmus.
Tiroides aumentada de tamaño,
blanda, no dolorosa. Hepatomegalia. Edema de miembros
inferiores. Anemia normocítica
normocrómica (Hb 11.4 g/dL,
VGM 87.7 fL, HCM 30.2 pg),
leucopenia (leucocitos 3.9) y
trombocitopenia (plaquetas 87),
S13
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
BT 30.68, BD 21.58, BI 9.1, ALT
60, AST 85, FA 175, albúmina
2.5, GGT 70 e INR 1.49. Frotis
de sangre periférica y perfil de
hierro compatibles con anemia
por enfermedad crónica. PFT:
(T captación 51.2 %, T3 total
2.67 nmol/L, T4 total 265.76
nmol/L, TSH 0.02) anticuerpos
antitiroideos positivos. USG de
H y VB: alteración del la ecotextura hepática, incremento
de la velocidad del flujo en la
porta y arteria hepática. Perfil
de hepatitis viral, Perfil de hepatitis autoinmune: negativo.
Biopsia hepática: colestasis
intracanalicular e intracelular.
USG tiroides: Incremento de
dimensiones y vascularidad.
Ecocardiograma: HAP moderada. PSAP en 55 mmHg.
Función sistólica normal. Recibió tratamiento con tapazol
presentando resolución del
cuadro clínico. Comentarios y
Conclusiones: nuestra paciente
tenía síndrome colestásico,
pancitopenia e HAP como
signos atípicos de Graves. La
anemia suele presentarse en
enfermedad de Graves severa, puede acompañarse con
pancitopenia y se asemeja
a la anemia por enfermedad
crónica. La afección hepática
puede ir desde alteraciones de
las PFH asintomáticas hasta
hepatitis franca. El mecanismo
de lesión hepática pudiese
deberse a hipoxia relativa ó a
toxicidad en el tejido hepático
de las hormonas tiroideas. Las
tionamidas pueden restaurar la
PFH al normalizar las PFT. La
S14
HAP asociada a hipertiroidismo
tiene buen pronóstico. La prevalencia HAP e hipertiroidismo
no se ha reportado igual que sus
mecanismos patogénicos.
Enfermedad poliquística hepática no asociada a enfermedad
renal poliquística autosómica
dominante
JAJ Batún Garrido, E Hernández
Núñez, F Olán
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa
Pérez, Villahermosa, Tabasco
Introducción: Bristowe en 1856
describe la asociación entre la
enfermedad poliquistica hepática (EPH) y la enfermedad
renal poliquística autosómica
dominante. En 1950 se propone
la EPH como una condición
independiente. Tiene una prevalencia < 0.01%, se debe a
mutación de los genes PRKCSH
y SEC63. Es asintomática en
80% de los casos, los síntomas
son causados por compresión
de órganos vecinos. El diagnóstico se realiza por USG, TAC y
RM. El tratamiento consiste en
aspiración percutánea, embolización arterial, fenestración,
resección parcial o trasplante
hepático. Descripción del caso:
femenino 67 años con historia de osteoporosis y quistes
hepáticos con seguimiento semestral por USG. Refiere dolor
en hombro derecho intenso,
súbito, que incrementa con
movilización, no relacionado a
trauma o actividad física, dolor
abdominal en epigastrio, EVA
9/10, urente, irradia a hipocondrio derecho y ambos hombros,
diaforesis, palidez, disnea, y
dolor retroesternal. Acude a
clínica particular, se descarta
cardiopatía y se egresa con manejo ambulatorio. Progresan los
síntomas, incrementa dolor, disnea y distensión abdominal, por
lo que se ingresa. EF dolor a la
palpación superficial en mesogastrio e hipocondrio derecho.
Labs: leucocitos 10.6 x 103/µL,
Hb 12.1 g/dL, Hto 36.1 %, ALT
344 IU/L, LDL 355 IU/L. El control de 12 h con Hb 10.6 g/dL y
Hto 31.9%. TAC abdomen con
2 quistes hepáticos hemorrágicos en segmentos Couinaud
(VII y VIII de 82x105x92 425
cc; II, III y IV 162x63x113 590
cc, comunicación en segmentos
IV y VIII) y 6 quistes pequeños
simples. Se realiza drenaje percutáneo de ambos quistes en
dos intervenciones con lo que
disminuye la sintomatología.
Sin presentar datos de sangrado
activo y Hb 13.2 g/dL, se decide
su egreso y seguimiento por
USG en la consulta. Comentario y Conclusiones: se presenta
el caso de una paciente con
EPH aislada Gigot’s tipo 1, la
importancia radica por la baja
prevalencia y su complicación
hemorrágica. El dolor irradiado
en hombro se debe a que los
nervios aferentes derivan de
los dermatomas C3 a C5. El
paciente con EPH pocas veces
requiere tratamiento quirúrgico
para sus complicaciones, estas
se suelen resolver por compresión hepática por el drenaje de
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
los quistes, como se realizo con
nuestra paciente.
Enfermedad celiaca con biopsia
normal. A propósito de un caso
José de Jesús Casillas Plascencia, Hugo Alberto Arellano
Sotelo, Nallely Sandoval García,
Juan Francisco Soto Bañuelos,
Erica García Valadés
UMAE núm. 1, Hospital de Especialidad, CMN Bajío, IMSS,
León, Guanajuato
Introducción: la prevalencia de
la enfermedad celiaca en una
población de adultos sanos varía entre 1 en 100 y 1 en 300 en
la mayoría de las regiones del
mundo. Descripción del caso:
masculino 55 años de edad, laboro como mecánico industrial.
Inicio con cuadro clínico 2 años
previos con pérdida de peso,
conjuntivitis herpética bilateral,
con secuelas de amaurosis y parálisis facial derecha, se agrega
síndrome diarreico, hasta llegar
secundariamente a síndrome
consuntivo. Se inicia protocolo
con endoscopia alta, reportando
candidiasis esofágica, descartándose TORCH, VHC, VHB,
VIH, se realiza colonoscopia
en dos ocasiones, reportando
colitis inespecífica; TAC toracoabdominal, sin evidencia de
lesiones, se realiza marcadores
tumorales negativos. Presenta
deterioro generalizado progresivo, con pérdida de 20 kg.
Hace un año pérdida de fuerza
y sensibilidad de extremidades
inferiores. Se descarta por imagen TB, PCR para TB en sangre
negativo. Se realizan ANAs los
cuales presentan positividad,
complemento bajo, inmunoglobulinas bajas. Reumatología lo
cataloga como inmunodeficiencia en estudio con enteropatía
perdedora de proteínas. Posteriormente inmunología descarta
la inmunodeficiencia primaria.
Se realiza exámenes generales,
se realiza serie ósea completa
encontrando datos de osteopenia, aplanamiento de epífisis,
así como pseudofracturas en
huesos largos. Niveles de Vit
B12 0 pg/mL, ácido fólico 0
ng/dL y vitamina D 4.87 ng/dL
y se solicita electromiografía
con hallazgos compatibles
con polineuropatía sensitiva
y motora distal del tipo de
degeneración axonal severa
y desmielinizante. Se realiza
endoscopia de tubo digestivo
alto reporta pangastrits crónica
de aspecto atrófico, y se envía
biopsia de duodeno distal y yeyuno reportando una duodenitis
aguda, con actividad leve, con
edema y congestión. Niveles
de Ac antigliadina IgA 37 UE/
mL, IgG 38 UE/mL, anticuerpos
anti- transglutaminasa IgA e IgG
negativos, Ac antiendomicio
IgA positivos. Confirmándose
el diagnostico de enfermedad
celiaca. Inició dieta libre de
gluten, con mejoría y ganancia
ponderal. Comentarios y Conclusión: este caso es importante
a dar a conocer debido al atraso
del diagnóstico que tuvo el paciente durante 3 años, el cual
pudo haberse recortado con el
adecuado abordaje de diarrea
crónica, además es importante
señalar la negatividad de la
biopsia de intestino, pero la
positividad de los anticuerpos
aunado a la gran mejoría con
la dieta libre de gluten.
Síndrome de Budd-Chiari asociado con carcinoma renal.
Reporte de caso
Adrián Pérez Toledo, Gabriela
Olguín Contreras, Héctor Infante Sierra, Cintya Barajas Toledo,
Guadalupe Ferrer Burgos, Carlos Rodríguez Zúñiga
Servicio de Medicina, Interna
Hospital de Especialidades de la
Ciudad de México Dr. Belisario
Domínguez, México, DF
El síndrome de Budd-Chiari
es una enfermedad vascular
hepática con obstrucción de
venas hepáticas o cava inferior, provocando hipertensión
portal. El 75% es debido a
hipercoagulabilidad incluyendo invasión tumoral. Cuadro
clínico con hepatomegalia,
hepatalgia, ascitis, red venosa
colateral y aumento de enzimas
hepáticas. Diagnóstico por eco
Doppler de venas hepáticas
o resonancia magnética, con
oclusiones venosas y aumento
de lóbulo caudado, flebografía
en patrón de tela de araña,
biopsia con datos de congestión hepática. Tratamiento con
anticoagulantes, endoprótesis
o derivación porto sistémica
intrahepática transyugular y
trasplante hepático. Masculino
de 61 años, con antecedente
de tabaquismo y alcoholismo.
S15
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Inicia padecimiento actual
en octubre de 2013 con mal
estado general, aumento de
perímetro abdominal, edema
de miembros pélvicos y pérdida
ponderal de 20 Kg en 3 meses.
A su ingreso, con disnea de
pequeños esfuerzos, ascitis
grado III y red venosa colateral, los paraclínicos reportan
lesión renal aguda AKIN III,
aumento de transaminasas e
hiperbilirrubinemia, diagnosticándose Insuficiencia Hepática
CHILD C. Se realiza ecografía
abdominal evidenciando hepatopatía crónica difusa tipo
fibroso, datos de hipertensión
portal y hallazgo de imagen
ovoidea hiperecoica 25 por 20
milímetros en polo inferior de
riñón vascularizado. Se reporta
panel viral de Hepatitis B y C
negativo, gradiente suero albumina-suero ascitis 1.2. Reporte
de patología no concluyente.
Antígeno Ca 125 de 121 U/mL
(0-35). Tomografía contrastada
con parénquima hepático heterogéneo y en lóbulo derecho
compromiso venoso suprahepático, tumor renal izquierdo
en polo inferior con realce
heterogéneo, signos de trombo
tumoral con obstrucción mayor
de 90 % de vena renal y cava inferior hasta la aurícula derecha.
El ultrasonido Doppler reporta
obstrucción de vena cava inferior y flujo reverso, trombo
de 10mm que protruye a aurícula derecha confirmada por
ecocardiograma y resonancia
magnética. Diagnosticándose
síndrome de Budd-Chiari con
S16
clasificación de Neves nivel IV
y el tumor renal en clasificación
T3b N0 M0. Se inicia tratamiento a base de enoxaparina
y se envía a Institución con el
servicio de Oncología quirúrgica para normar terapéutica
posterior. Este síndrome es una
patología rara, siéndolo más
su asociación a una neoplasia
del tipo carcinoma renal (4-10
%) ya que el 1% se extiende a
aurícula. Discernir la etiología
de la ascitis sigue representando
un reto diagnóstico al internista.
Síndrome de Banti
G Ordoñez Vázquez, MG López Cruz, G Gómez Ochoa, G
Pérez Bustamante, F Vásquez
Manuel
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad de Oaxaca
La esclerosis hepatoportal (EHP
o síndrome de Banti) se caracteriza por hipertensión portal
intrahepática presinusoidal
asociada a esplenomegalia y
anemia en pacientes con un
hígado no cirrótico. Masculino
de 53 años, APP: alcoholismo
intenso, hemorragia de tubo
digestivo alto, multitransfundido. Enviado a la consulta
externa de hematología, por
síndrome anémico y pérdida
ponderal de 5 kg en 2 meses.
Reporte de BHC: HB 3.5, HTO
13.8, VCM 73, HCM 18.4,
leucocitos 16630, neutrófilos
9650, reticulocitos 1.16%,
eritroblastos 9%, plaquetas
119000. Se hospitaliza para
transfusión de 3 concentrados
eritrocitarios y alta posterior.
Reingreso 2 meses después
por choque hipovolémico secundario a hemorragia de tubo
digestivo alto, palidez de piel
y tegumentos, abdomen con
hepatomegalia, palpación de
tumor abdominal en mesogastrio, hipocondrio y flanco
izquierdo, pétreo de 25-30 cm.
BHC: HB 3, Hto 11.3, VCM 73,
HCM 19.24, leucocitos 12320,
neutrófilos 8130, plaquetas
114000, dacriocitos, ES, QS y
PFH normales, Panendoscopia:
varices esofágicas grado II, varices gástricas fúndicas grado I de
sarín, gastritis corporal y antral
de aspecto atrófico. En USG:
hígado aumentado de tamaño
en lóbulo derecho 17 cm, vena
porta con calibre 16 mm. Bazo
horizontalizado, ecogenicidad
normal de 20 x 11 cm, resto
normal. Conclusión: hepatomegalia y esplenomegalia. USG
doppler: descarta trombosis de
las venas supra hepáticas. TAC
de abdomen: Esplenomegalia
severa, hepatomegalia, no se
reportan lesiones solo datos
indirectos de hipertensión portal. AMO: normal. Se realizo
toma de biopsia hepática más
esplenectomía terapéutica y
diagnóstica, los hallazgos de
bazo aumentado de tamaño de
30 cm. Hígado de características macroscópicas normales.
Diagnóstico histopatológico:
hígado sin fibrosis, bazo se
reporta congestión crónica,
tinciones especiales negativos.
Conclusión diagnóstica: sín-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
drome de Banti. La etiología
de la esclerosis hepatoportal
es desconocida. Clínicamente
se relaciona a síntomas producidos por hipertensión portal:
anemia, varices esofágicas y
esplenomegalia. Existen criterios diagnósticos del comité
japonés en el estudio de la EHP,
el pronóstico de estos pacientes
es mejor que en aquellos que
presentan hipertensión portal
asociada a cirrosis hepática, la
supervivencia es del 90 % a 10
años de seguimiento y la principal causa de mortalidad es la
relacionada con hemorragia de
varices esofágicas.
Hepatitis autoinmunitaria. Presentación de un caso
PV García Piza, JL Quiroz Gaytán
Departamento de Medicina
Interna, Servicio de Gastroenterología. Unidad Médica de
Alta Especialidad T1, Instituto
Mexicano del Seguro Social,
León, Guanajuato
Introducción: enfermedad inflamatoria crónica del hígado,
etiología desconocida, prevalencia 0.02% de la población,
predomino en mujeres jóvenes.
Descripción del caso: mujer, 35
años de edad, sin antecedentes
crónico-degenerativos o infectocontagiosos, transfusiones y
promiscuidad; inmunocompetente, presenta evolución
de un mes con ictericia, dolor
abdominal, vómito, acolia,
coluria, abordada como colecistitis crónica litiásica que
pese a tratamiento quirúrgico
desarrolla falla hepática aguda.
Comentarios: mujer, 35 años
de edad, tabaquismo negado,
etilismo ocasional desde hace
15 años. Niega enfermedades
crónico-degenerativas, infectocontagiosas, toxicomanías,
tatuajes, promiscuidad y transfusionales. Inició con pérdida
ponderal de 20 kg en un año;
así como ictericia de piel y
tegumentos de un mes de evolución y dolor abdominal en el
hipocondrio derecho, acolia,
coluria, nausea, vómito, fiebre
no cuantificada, astenia y adinamia. A su ingreso se realizó
lo siguiente: Hb 13.3 g/dL,
plaquetas 246,000, leucocitos
6,490/mL, neutrófilos 3,900/
mL, linfocitos 1,890. TP 22.2
seg, INR 1.92, TPT 45 seg, Cr.
0.5 mg/dL, lipasa 97 U/L, amilasa 76 U/L, albumina 3.6 g/dL,
ALT 1,168 U/L, AST 3,489 U/L,
FA 230 U/L, DHL 2,590 U/L, BT
22 mg/dL, BD 18.8 mg/dL. Marcadores tumorales negativos.
US abdominal: hepatomegalia,
vesícula biliar con lito de 4 cm,
vía biliar intra y extrahepática
normal, colédoco 4 mm y
porta 10 mm. TAC abdominal:
lito de gran tamaño, líquido
perivesicular, no neoplasias.
CPRE: normal. Se decide manejo quirúrgico. 4 días después,
presentó insuficiencia hepática
aguda, solicitándose: marcadores serológicos para hepatitis
A, B, C negativos; anticuerpos
antinucleares positivo 1:640,
antimitocondriales y antimúsculo liso negativos; IgG 1640
mg/dL; biopsia hepática: infiltrado de células plasmáticas
en zona periportal y necrosis
focal con infiltrado lobular. Fue
manejada con medidas antiamonio, hidratación parenteral,
antibioticoterapia de amplio
espectro y prednisona 60 mg c/
24 h, con mejoría. Conclusiones: es un caso que se presenta
poco frecuente, abordado como
colecistitis litiásica, que al
no mejorar con tratamiento
definitivo y evolucionar a insuficiencia hepática aguda, se
reoriento su abordaje diagnóstico. Se cumplieron con criterios
por laboratorio, autoanticuerpos y hallazgos histológicos
para diagnóstico definitivo de
hepatitis autoinmunitaria, iniciando tratamiento adecuado
con mejoría de la paciente.
Uso de sistema MARS en
falla hepática por hepatitis autoinmunitaria con síndrome
hepatorrenal: reporte de un caso
David Omar Rodríguez Gómez,
Laura Esthela Cisneros Garza
Hospital San José Tec de Monterrey
Introducción: en los últimos
años se han evaluado procedimientos terapéuticos para la
insuficiencia hepática, siendo
uno de los más estudiados el
sistema de recirculación con adsorbentes moleculares (MARS),
mediante diálisis con albúmina.
El siguiente es una descripción
de uso de MARS en un caso
de falla hepática secundario
a hepatitis autoinmune con
S17
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
síndrome hepatorrenal. Descripción del caso: mujer de 57
años de edad, con cuadro de ictericia de un mes de evolución.
Niega alcoholismo, toxicomanías, tatuajes o conductas de
riesgo; antecedente de hipertensión arterial en tratamiento con
ARA-II, antecedente quirúrgico
colecistectomía en el 2002, con
patrón de PFHS de predominio
colestásico, Se realizan pruebas diagnósticas, incluyendo
ANAS y anti-ML con resultados
positivos, integrando diagnóstico de hepatitis autoinmune
iniciándose tratamiento inmunosupresor. Posteriormente la
paciente presenta criterios de
falla hepática aguda, ademas de
decremento de función renal,
cumpliendo criterios de síndrome hepatorrenal. Se somete a la
paciente a 2 procedimientos de
MARS y se inicia tratamiento,
además de 3 sesiones de hemodiálisis al cumplir criterios
en agudo. Comentarios: la
hepatitis autoinmune constituye una entidad de etiología no
bien definida que representa un
diagnostico difícil. En el caso
antes descrito, la evolución
del cuadro fue rápida, progresando a falla hepática aguda,
además de presentar deterioro
de función renal y cumplir con
criterios de síndrome hepatorrenal tipo 1. Se realiza MARS
en dos ocasiones, presentando
un cambio clínico y por laboratorio, con un decremento de
bilirrubina inicial de 41.06 mg/
dL y AST de 421 mg/dL a valores 4.32 mg/dL y 23 mg/dL. Así
S18
mismo, creatinina de 5.5 mg/
dL mejoró con valores al egreso
de 1.2 mg/dL. Conclusiones: la
información sobre los efectos
del tratamiento con MARS
es reciente y todavía no hay
resultados de estudios que lo
evalúen como tratamiento definitivo, y si bien no se encuentra
literatura del mismo tratamiento
en síndrome hepatorrenal, tomando como referencia el caso
antes descrito, podemos inferir
la necesidad del estudio de los
efectos del MARS dentro de la
investigación del tratamiento de
ambas patologías.
Hepatitis hipóxica. Reporte
de caso
Adrián Pérez Toledo, Laura
Gabriela Amador Reyes, Juan
Carlos Guerrero Nava, Pedro
Alberto Verdeja Padilla, Eduardo
Federico Hammeken Larrondo
Hospital de Especialidades de la
Ciudad de México Dr. Belisario
Domínguez, Secretaría de Salud
del Distrito Federal
La hepatitis hipóxica se caracteriza por falla hepática
aguda transitoria secundaria a
etiologías cardiovasculares y
respiratorias. Mujer de 57 años,
con antecedente de diabetes
mellitus 2, niega ingesta de
fármacos hepatotóxicos. Inició
3 semanas previas con dolor
torácico opresivo y fluctuante, agregándose 2 semanas
después disnea de pequeños esfuerzos, acudiendo a urgencias,
encontrándose con bradicardia,
normotensa, diaforética, ta-
quipneica y con ingurgitación
yugular grado III, tele de tórax con cardiomegalia severa
y congestión venocapilar. El
ECG con cambios inespecíficos; elevación de troponinas;
hiperbilirrubinemia, hipertransaminasemia y alargamiento
de los tiempos de coagulación,
DHL elevada, acidosis metabólica con lactado elevado.
Ingresó a la UTI alcanzando
AST 2600, ALT 1773, DHL
2700, BILT 4.5, TP 75, TTP
66; perfil de hepatitis y VIH
negativo. El ECOTT reportó
miocardiopatía dilatada con
hipocinesia generalizada y
fracción de expulsión del ventrículo izquierdo de 30% e
hipertensión arterial pulmonar.
Evoluciona con desaparición
del dolor torácico y normalización electrocardiográfica,
así como mejoría bioquímica.
Se egresó a Medicina Interna
y se diagnosticó con hepatitis
hipóxica asociada a miocarditis. 9 días después con función
hepática normal y mejoría de
su clase funcional, decidiendo su alta. Un mes posterior
con laboratorios normales,
ECOTT con PSAP menor, aún
con hipocinesia generalizada
y FEVI del 38%. La hepatitis
hipóxica es un tipo de falla
hepática aguda caracterizada
por elevación súbita de AST y
NCL secundaria a hipoxia. Los
criterios incluyen: a) aumento
de la AST >10 veces lo normal, b) compromiso cardiaco,
respiratorio o circulatorio, c)
exclusión de otras causas de
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
NCL. Hay elevación desmedida
de la DHL en comparación con
otras etiologías. Su frecuencia
es de 1/1000 de las admisiones
hospitalarias. No es indispensable la biopsia hepática. El
tratamiento es enfocado a la
causa primaria y de sostén hemodinámico. Si bien la falla
hepática aguda se consideró
secundaria a hipoxia, la literatura anterior requería de un
estado de choque previo, pero
recientemente se reporta que
solo el 50% de los pacientes
cursan con choque, denominada ahora hepatitis hipóxica,
y en este caso la miocarditis fue
el predisponente. La hepatitis
hipóxica es infradiagnosticada
ya que se confunde con otras
enfermedades hepáticas, su
diagnóstico debe de realizarse
por criterios clínicos y descarte
de otras etiologías de hepatitis.
Infliximab y sirolimus como
inductores de remisión en
colitis ulcerativa fulminante
refractaria
Oscar Morales Gutiérrez, Álvaro Cabrera García, José Ángel
Lara Sánchez, María Elena
López Acosta, Roberto Ovilla
Martínez
Medicina Interna, Hospital
Ángeles Lomas, Huixquilucan,
Estado de México
Introducción: la colitis ulcerativa es una enfermedad
inflamatoria-autoinmune, caracterizada por aumento de la
proliferación celular, activación
de células T, producción de
citocinas proinflamatorias e infiltración leucocitaria. Diversos
compuestos con propiedades
antiproliferativas han mostrado un efecto terapéutico en
modelos murinos de colitis
ulcerativa. La molécula blanco
del sirolimus mTOR es una proteína quinasa implicada en la
carcinogénesis y proliferación
celular del colon. La inhibición
de mTOR en modelos inducidos
de colitis ulcerativa ha mostrado disminuir significativamente
el índice de actividad de la
enfermedad, el infiltrado leucocitario y el daño de las criptas
en la mucosa colónica. No
obstante existe poca evidencia
de su utilidad como inductor
de remisión en pacientes con
colitis ulcerativa fulminante
refractaria a esteroides. Descripción del caso: paciente
masculino de 30 años de edad,
diagnosticado hace 12 años con
colitis ulcerativa grave (Truelove
y col.) con 10 evacuaciones al
día acompañadas de sangre,
Hb 10 g/dL, VSG 32 mm/h. Se
inicia tratamiento con mesalazina 2 g/día y prednisona 10
mg/día con reducción gradual
hasta descontinuar por mejoría. Permanece asintomático
hasta hace 2 años presentando
exacerbación de los síntomas
con, dolor abdominal, 20 evacuaciones al día acompañadas
de sangre y en ocasiones exclusivamente material hemático,
Hb 4.5 g/dL y VSG 40 mm/h,
requiriendo apoyo transfusional
y carboximaltosa férrica en 4
ocasiones. Una colonoscopía
reporta distorsión de la arquitectura de las criptas, lámina
propia con gran infiltrado de
linfocitos y células plasmáticas,
con lecho ulceroso activo, clasificado como colitis ulcerativa
grave con índice de actividad
de Mayo 12 puntos. Iniciamos
tratamiento con metilprednisolona IV seguido de infliximab
300 mg, observando mejoría
del dolor con persistencia de
evacuaciones diarréicas. Se
propone agregar sirolimus 1
mg cada 12 h vía oral y 7 dosis
más de infliximab observando
una mejoría dramática de los
síntomas, con reducción del
número de evacuaciones (3
veces al día), Hb 14 g/dL y
VSG 20 mm/h, permaneciendo
asintomático hasta la fecha.
Comentarios y Conclusiones:
la excelente evolución en este
paciente aporta evidencia que
la combinación de infliximab
y sirolimus puede ser un inductor a la remisión eficaz en
pacientes con colitis ulcerativa
fulminante resistente.
Insuficiencia hepática fulminante secundaria al uso de
suplementos herbolarios: reporte de un caso
Yesenia Ortiz Montaño,1 Jesús
Ojino Sosa García,2 Teresa de
la Torre León2
1
Medicina Interna, Hospital General Dr. Manuel Gea
González, Centro Nacional
de Excelencia Tecnológica en
Salud (CENETEC), México, DF
2
CENETEC, Médica Sur, México, DF
S19
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Introducción: la falla hepática fulminante (FHF) es una
enfermedad poco frecuente
con una mortalidad entre 30
al 100% independientemente
de la etiología. Se desconoce
la prevalencia de hepatotoxicidad por uso de suplementos
herbolarios debido a que no se
reporta. Caso clínico: masculino de 27 años de edad con
obesidad para lo cual llevó un
tratamiento con suplementos
herbolarios (no especificado)
por 6 meses, niega toxicomanías. Acudió al servicio de
urgencias por presentar astenia,
adinamia, ascitis e ictericia de 4
semanas de evolución. Dentro
de los laboratorios destacaba
trombocitopenia 36 mil, INR
4.2, ALT 1780 UI/L, AST 3456
UI/L, fosfatasa alcalina 224,
gammaglutamiltransferasa 312.
Se le realizó una tomografía
axial computada con evidencia
de daño hepatocelular, derrame
pleural bilateral y ascitis. Perfil
viral de hepatitis A, B, C, E y
herpes simple negativos. Se le
dio manejo con N-acetilcisteína, penicilina y esteroide sin
mejoría. Falleció y se realizó
autopsia que concluyó como
causa de muerte hepatotoxicidad, sin evidencia de esteatosis.
Comentarios: el diagnóstico
de FHF secundaria al uso de
suplementos herbolarios es un
reto médico ya que es de exclusión. Se debe de interrogar
de forma dirigida acerca del
uso de éstos. Conclusiones: es
de suma importancia reportar
los casos de FHF secundaria al
S20
uso de suplementos herbolarios
ya que mucha gente los utiliza
sin conocer sus posibles efectos
que pueden ser fatales debido
a que no existe tratamiento
específico por lo que debemos
fomentar no utilizarlos.
Hepatitis tóxica aguda secundaria a ingesta de suplemento
alimenticio. Reporte de un caso
Jorge Luis Trejo Morales, Adria
Jazmín Almada Córdova, Jovanni Camacho Santana
Servicio de Medicina Interna,
Hospital Darío Fernández Fierro, ISSSTE, México, DF
Introducción: el daño hepático agudo asociado a reacción
idiosincrática es una reacción
adversa poco común, no relacionada con la dosis, siendo
un diagnóstico de exclusión,
las causas más comunes son
la ingesta de fármacos, hierbas
medicinales y suplementos
alimenticios. Nuestro caso trata
de una paciente con hepatitis
aguda por hepatotoxicidad de
patrón hepatocelular asociado
a la ingesta de suplemento
alimenticio (Oxyelite pro) corroborándose dicho diagnóstico
por biopsia. Descripción del
caso: femenino de 39 años
de edad la cual desde hace 3
meses se encuentra en plan
de ejercicio e ingesta de suplemento alimenticio para
la disminución de peso, con
ingesta de 1 cápsula diaria de
producto denominado Oxyelite pro, ingiriéndola por 10
días abandonando hace 6 se-
manas. Presenta cuadro de
2 semanas de evolución con
dolor abdominal tipo cólico
localizado en hipocondrio
derecho y epigastrio así como
ictericia generalizada y coluria.
EF: signos vitales estables, con
ictericia generalizada, abdomen doloroso a la palpación
media en hipocondrio derecho.
Laboratorio con elevación de
TGP 1516 UI/L y TGO 1348
UI/L con un índice TGP del
paciente respecto del control de
16 sugestivo de hepatitis aguda
con patrón hepatocelular. Ecografía abdominal: acentuación
de conductos intrahepáticos y
TAC sin alteraciones. El manejo
implementado fue con medidas
de soporte hídrico manteniendo flujos urinarios adecuados
disminuyendo la posibilidad de
nefrotoxicidad por pigmentos.
Con cifras de transaminasas y
tiempos de coagulación estables, con realización de biopsia
reportando hepatitis aguda con
necrosis masiva e infiltrado
inflamatorio lifoplasmocitario
y escasos eosinófilos. Comentarios: femenino de 4ª década de
vida. El alto valor de transaminasas sugiere proceso tóxico o
isquémico, el índice de ALT/nivel normal con un valor mayor
a 16 sugiriendo la posibilidad
de lesión tóxica hepatocelular.
El diagnóstico de hepatitis viral
se descarta con el panel viral
negativo mientras que la causa
isquémica se descarta debido a
que no presentó elevación de la
DHL. Conclusiones: la lesión
hepática aguda secundaria a la
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
ingesta de hierbas medicinales
y suplementos alimenticios es
de vital importancia dado que
estos productos no cuentan
con pruebas que muestren los
posibles efectos secundarios
asociados a ellos; esta publicación busca coadyuvar en el
abordaje de casos similares.
Psicosis inducida por esteroide
en el anciano
Nallely Solano Rodríguez, Norma Leticia Esperanza Castro,
Saul Huerta Ramírez
Medicina Interna, Hospital
General de Zona 48, San Pedro
Xalpa, IMSS, México, DF
Introducción: entre los pacientes de edad avanzada, los
síntomas psicóticos pueden
verse en una amplia gama de enfermedades con prevalencia que
varia de 0.2 a 4.7% en la comunidad y hasta 63% en asilos; la
asociación de estos con uso de
esteroides oscila entre 3 y 6%,
siendo mayor su incidencia en
pacientes con lupus eritematoso
sistémico y pénfigo, principalmente en mujeres y en adultos
mayores, debido a factores que
incrementan el riesgo como el
deterioro de la corteza frontal
y temporal relacionada con la
edad, cambios neuroquímicos
y polifarmacia. Descripción
del caso: se presenta el caso
de paciente femenina de 79
años de edad con cuadro de
dermatosis generalizada caracterizada por pústulas y vesículas,
diagnosticada por biopsia como
pénfigo ampolloso, iniciándose
tratamiento con prednisona 50
mg/día. Dos semanas después
inició con ansiedad, irritabilidad, insomnio, hipervigilante,
verborreica, taquilalia y agitación psicomotriz progresando
hasta agresividad. Se inicia
protocolo de estudio, descartándose alteraciones metabólicas,
endocrinológicas e infecciosas
por panel viral y hormonal sin
alteraciones y cultivos negativos
así como causa orgánica por
estudios de imagen sin lesión
estructural. Concluyéndose
psicosis asociada a esteroides,
iniciándose dosis reducción del
mismo hasta retiro, se inició
tratamiento del pénfigo con azatioprina y se asoció quetiapina
para manejo de los síntomas
psicóticos, hasta remisión de los
mismos. Comentarios y Conclusiones: los cuadros psicóticos
inducidos por esteroide tienen
un curso impredecible y en la
mayoría de los casos no siguen
un patrón clínico especifico,
lo que dificulta su diagnóstico
abordaje y tratamiento. El pronóstico es favorable, más del
50% de los pacientes tienen
remisión total de los síntomas
luego de dos semanas de suspensión del esteroide y el 90%
después de las seis semanas.
El conocimiento acerca de las
características de estos cuadros
es importante para prevenir su
aparición por medio del uso
racional de los corticoides.
Síndrome hemofagocítico por
herpes virus humano 8 en paciente inmunocomprometido
Lucía V Maya Piña,1 Edgar E
Medina Murillo, 1 S Martínez
Romero,1 H Infante Sierra,1 V
Ahumada Topete2
1
Servicio de Medicina Interna,
Hospital de Especialidades Dr.
Belisario Domínguez, México,
DF
2
Centro de Investigación en
Enfermedades Infecciosas, Instituto Nacional de Enfermedades
Respiratorias, México, DF
Introducción: la linfohistiocitosis hemofagocítica es
un síndrome poco frecuente
que se caracteriza por activación inmune patológica que
puede presentarse de forma
primaria autonómica recesiva
o secundaria con enfermedades
concomitantes con infecciones virales u hongos; cuadro
clínico caracteriza por una
inflamación desproporcionada
que produce fiebre, citopenias,
esplenomegalia, hemofagocitosis, hipertrigliceridemia e
hipofibrinogenemia; con alta
mortalidad. Descripción del
caso: Paciente de 31 años de
edad originario y residente
del DF, desempleado, soltero,
HSH, inicia cuadro clínico caracterizado por fiebre de 39ºC,
pérdida de peso, linfadenopatía en cuello, evacuaciones
disminuidas de consistencia,
acudiendo a servicio médico,
a su ingreso exploración física:
pálido, cuello con linfadenopatía bilateral de 1 y 2 cm,
abdomen con esplenomegalia
hasta línea media y cresta iliaca
izquierda, hepatomegalia 4cm
S21
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
por debajo del reborde costal, extremidades con edema
(+). Se solicitan paraclínicos
encontrándose pancitopenia,
ELISA positivo para HIV con
carga viral 451 021 y CD4 46,
Anticuerpo HBs, Antígeno HBe
positivos, antígeno de histoplasma positivo, HHV8 positivo,
galactomanano positivo (antígeno de aspergilus), ferritina 3000
mcg/l, trigliceridos 300, TC con
adenopatías en cuello, tórax y
mediastino, hepato-esplenomegalia medida hasta cresta
iliaca. Se efectuó aspirado de
medula ósea y biopsia de hueso
encontrándo: infiltrado histiocitario con hemofagocitosis,
Biopsia de ganglio: hiperplasia
linfoide folicular reactiva plasmo celular. Inicio tratamiento
con CHOPE, progresó a choque séptico, requirió apoyo
vasopresor, ventilación mecánica invasiva, hemotransfusión,
aferesis plaquetaria y tratamiento antibiótico empírico.
Desarrolló falla multiorgánica,
posteriormente se aisló en
hemocultivos P. aeruginosa, C.
freundii iniciándose terapéutica especifica y soporte con
Filgastrim logrando mejoría, se
retiraron aminas y ventilación
a los 7 días iniciando segunda
quimioterapia en mejores condiciones generales y finalmente
logrando mejoría y egreso a
domicilio integrándose síndrome hemofagocítico asociado a
HHV8, SIDA, hepatitis B, que
respondió a quimioterapia.
Comentario y Conclusiones:
en este paciente se logró confir-
S22
mar síndrome hemofagocítico
(criterios clínicos, bioquímicos
e histopatológicos), tuvo una
evolución favorable con el
tratamiento instaurado, es de relevancia dado lo raro del caso.
Complicaciones hematológicas
inducidas por dapsona
L Alcaraz Gaytán, R Gutiérrez
Padilla, J Fernández Hernández,
A Rocha García
Centro de investigación: Servicio de Medicina Interna,
Hospital General de Zona 21,
León, Guanajuato
Introducción: la dapsona es
una sulfona, es antagonista
competitivo del ácido para-aminobenzoico. Es metabolizada
por la isoenzima CYP3A4 y uno
de sus metabolitos, la hidroxilamina, es un poderoso oxidante
responsable de efectos adversos
como: metahemoglobinemia,
hemólisis y agranulocitosis.
Descripción del caso: se analizan en forma retrospectiva 2
fichas clínicas de complicaciones hematológicas en pacientes
que consumían dapsona, en los
últimos 5 años. Masculino de
22 años inicia padecimiento un
día previo a su admisión con
cefalea, disnea de medianos esfuerzos y cianosis distal. Como
antecedente refiere estar en
tratamiento con Dapsona 100
mg cada 24 horas desde hace
dos semanas, incrementando
su ingesta en las últimas 24
horas a 300 mg cada 8 horas.
Presentó TA 130/90 mmHg,
FC 100 lpm, FR 22 rpm, spO2
75%, cianosis peribulcal y
distal. Hb 16.6 g/dL, BT 3.32
mg/dL, BI 2.91 mg/dL. GA con
oxígeno a 6 litros destaca pH
7.52, PaCO2 29.7 mmHg, PaO2
224.1 mmHg, SpO 2 98.6%.
Metahemoglobinemia plasmática 25%. Requirió terapia con
azul de metileno intravenoso.
Femenino de 20 años de edad,
quien como antecedente se
encontraba en tratamiento con
dapsona 100 mg c 24 horas
durante 15 días para tratamiento de acné, sin ninguna
otra patología crónica. Acude
por presentar ictericia de piel
y tegumentos, prurito, astenia,
adinamia, motivo por el cual
acude a valoración. A la exploración física TA 100/60, FC 89,
T 36.5, ictericia de piel y tegumentos, hepatomegalia grado
1, resto normal. Laboratorios
hemoglobina 9, pl 100, BT 5,
BI 3.5, BD 1.5. FA 1000. TGO
80, TGP 90. A su ingreso se le
retira dapsona, se trata con Heparmex, pentoxifilina, hierro.
A las 2 semanas presenta laboratorios normales, con único
tratamiento de hierro. Discusión: la dapsona tiene efectos
hematológicos específicos. La
clínica de ambos casos clínicos corresponde a síndrome
anémico, cada uno producido
por un mecanismo particular,
en el caso 1, resulta funcional
debido a la incapacidad de
metahemoglobina de unirse al
oxígeno. En el segundo caso,
la hemólisis por la N-hidroxi
dapsona induce la destrucción
de eritrocitos por la formación
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de especies reactivas a oxígeno,
con aparición de marcadores
de hemólisis. Conclusión: la
intoxicación por dapsona es
un trastorno poco frecuente,
sub-diagnosticado, que puede
ser reversible, diversas manifestaciones clínicas pueden
surgir, que van desde la cianosis
asintomática hasta la muerte,
dependiendo del grado y el
tiempo en la instauración del
tratamiento.
Púrpura palpable diagnóstico
diferencial. A propósito de 2
casos clínicos
Heidi Hernández Ramírez,1 C
Flores Lorenzo²
1
Médico residente de primer
año de Medicina Interna
2
Médico adscrito al Servicio de
Medicina Interna
Hospital General de Zona núm.
32, IMSS, México, DF
Introducción: las lesiones
purpúricas son extravasación
de eritrocitos en la piel que
se manifiesta por petequias,
equimosis, hematomas y hemorragias. El recuento de
plaquetas puede estar normal
o disminuido. Existe un gran variedad de causas de las lesiones
purpúricas. Caso 1: masculino
de 29 años de edad, con antecedentes; exposición a humo
de combustible de automóviles
hasta la actualidad, etilismo social. Inicia padecimiento dolor
epigástrico, urente, náusea y
vómito, evacuaciones diarreicas
color rojo pardo, poliartralgias
de tipo migratorio (rodillas,
tobillos y codos) y dermatosis
en extremidades inferiores. A
la exploración petequias en
paladar blando, dermatosis
diseminada en extremidades
pélvicas confluentes eritematosas palpables tipo petequias
y púrpura palpable, con fondo
necrótico, respetando cara, tórax y antebrazos. Se manejó con
prednisona 75 mg/día. Caso
2: masculino de 66 años de
edad, Antecedentes: tabaquismo positivo, diabetes mellitus
tipo 2, hipertensión arterial
sistémica, enfermedad pulmonar obstructiva crónica (EPOC)
fibrilación auricular (FA). Inicia
padecimiento con dermatosis
localizada en extremidades
inferiores caracterizada por
petequias y equimosis con
fondo necrótico, artritis y dolor
abdominal acompañantes, a
la exploración lesiones purpúricas confluentes palpables
localizadas en piernas con
predominio en tercio distal y
región maleolar bilateral, algunas con lesiones vesiculosas, de
contenido seroso y hemático,
con algunas costras hemáticas
y mielicéricas. Se inicia manejo
con prednisona vía oral 0.5 mg/
kg/día. Discusión: la púrpura de
Schönlein-Henoch afecta hasta
un 90% de los niños, se pueden
presentar casos en los adultos.
El cuadro es generalmente
limitado hasta en un 94% en
los niños y un 89% en los
adultos. El penfigoide bulloso
es una enfermedad inflamatoria autoinmune caracterizada
por ampollas subepidérmicas.
Predominio en ancianos. Puede
estar relaciona con algunas enfermedades autoinmunes y con
neoplasias hasta en un 5.8-23%
a cáncer gástrico en personas
mayores de 65 años. Conclusiones: Se presentan 2 casos
clínicos de purpura palpable
con etiología diferente.
Hemofilia adquirida tipo A
(AHA) como expresión del
virus de inmunodeficiencia
humana (VIH): reporte de un
rara asociación
E Hernández Núñez, AJ Vargas
Bernal, F Olán
Departamento de Medicina
Interna, Hospital Regional de
Alta Especialidad Dr. Gustavo
A Rovirosa Pérez, Villahermosa,
Tabasco
Introducción: AHA trastorno
hemorrágico poco común,
incidencia de 1.5 casos por
millón. La Federación Mundial
de Hemofilia la define como
condición rara, producción de
autoacs que inactivan factor
VIII y sangrado significativo.
En comparación con hemofilia
clásica, se presenta en edad
media y afecta ambos géneros.
Existe escasa evidencia mundial de esta rara asociación:
AHA secundaria a VIH. Caso
clínico: mujer de 32 años,
toxicomanías negadas, niega
historia de trombosis o abortos, VIH/SIDA de 10 años con
triple antirretroviral. Inicia 4
meses previos con gingivorragia
severa, equimosis en tronco
y extremidades, hemartrosis
S23
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
en rodilla izq. EF neurológico
íntegro, cardiopulmonar sin
alteración, abdomen sin megalias, múltiples equimosis,
monoartritis rodilla izq. Labs:
Hb:8.6 g/dL, patrón crónico,
plaquetas: 301 mil, leucocitos: 5,100. FSP: equinocitos,
glucosa: 88 mg/dL, Cr: 0.6
mg/dL, Coombs directo negativo, TTP: 70 seg, FR, VDRL,
VHB y VHC negativos, factor
VIII: 1%, factor IX: 145.9%,
proteína C: 103.2%. ANA, anticardiolipina y anticoagulante
lúpico negativos. Se sometió
este caso al comité de ética
por riesgo-beneficio del Tx,
uso actual solo esteroides (pdn
0.5 mg/kg/día). Discusión: el
estudio EACH2 reportó las sigs
etiologías: idiopática 51.4%,
autoinmune 13.4%, malignidad 11.8%, embarazo 8.4%,
infecciones 3.8%, fármacos
3.4%. La patogenia de AHA, los
inhibidores de FVIII en su mayoría son autoacs IgG1 e IgG4.
Manifestaciones hemorrágicas
son 80% subcutáneas, 45% intramusculares, 25% GI y 2 a 8%
articulares, solo un 9% suelen
ser fatales. Cursan TTP prolongado y niveles bajos de FVIII.
Como diagnóstico diferencial
están el SAAF y trombofilias
primarias, los cuales fueron descartados en nuestra paciente y
no se pudo determinar autoacs
contra FVIII. El Tx en fase aguda
es evitar episodios de sangrado
con rFVIIa y complejos concentrados de protrombina activada,
a largo plazo erradicación de
autoacs con inmunosupreso-
S24
res combinados (esteroides,
ciclofosfamida y ciclosporina),
IgGIV y en forma rituximab
con respuesta en un 90%.
Conclusión: la paciente cumple
los criterios de una AHA por
edad, manifestaciones clínicas
(equimosis) y hematológicas
(TTP prolongado, depleción de
factor VIII). Se descartó patología autoinmune (LES, SAAF). La
etiología asociada es la expresión de VIH, solo hay 3 casos
informados en la literatura y no
se tiene un tratamiento específico por ese delicado balance
entre coagulopatía, infecciones
y autoinmunidad.
Macroglobulinemia de Waldenström con amiloidosis
secundaria
JO Duarte Flores,1 JA Barrios
González,1 JN López Taboada2
1
Médico residente de segundo
año de Medicina Interna, Centro Médico Nacional La Raza,
Instituto Mexicano del Seguro
Social, México, DF
2
Médico Internista, Hospital
General de Zona núm. 48,
IMSS, México, DF
Introducción: la macroglobulinemia de Waldenström
es un trastorno proliferativo
linfoplasmocitario maligno
crónica, infrecuente, caracterizado por infiltración de medula
ósea y producción monoclonal
de IgM. Objetivo: identificar
criterios diagnósticos de la
macroglobulinemia de Waldenström y presentación de
paciente con amiloidosis secun-
daria. Descripción: femenino
de 50 años de edad con antecedente de Hipertensión arterial
dos meses de diagnóstico. Inicia
cuadro dos meses previos con
gingivorragias, epistaxis, vómito
y cefalea holocranena, documentándose elevación de cifras
tensionales, se inicia manejo
antihipertensivo. Posteriormente evacuaciones melénicas,
dolor abdominal y hematuria
acude a valoración sin referir
tratamiento. Se agrega edema
de miembros inferiores. Por persistencia de hematuria requiere
hospitalización. A su ingreso
con signos vitales dentro de
parámetros normales, cardiopulmonar sin alteraciones,
hepatomegalia y extremidades
con edema ++. Con los siguientes laboratorios urea 92 mg/dL,
creatinina 2.11 mg/dL, triglicéridos 222 mg/dL, proteínas
totales 7.4 g/dL, albúmina 1.8
g/dL, calcio corregido 11.26
mg/dL, hemoglobina 9.3 g/dL,
hematocrito 29%, depuración
de creatinina de 24 horas 33
mL/min, DHL 150 UI/L, panel
viral negativo, inmunoglobulinas séricas con elevación de
IgM 6590, IgG 150, IgA 26. Ultrasonido renal RD 115X54X60
y RI 117X55X62. Se detecta
elevación de IgM, por lo que se
decide realizar aspirado de medula ósea que reporta presencia
de linfocitos plasmocitoides,
se diagnostica macroglobulinemia de Waldenström, se
realiza biopsia renal y se inicia
manejo con Ciclofosfamida por
Síndrome Nefrótico. Cuenta
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
con inmunofenotipo NLADR
27.2%, CD34 2.9%, CD117
9.7%, CDS2 55%, CD7 49.9%,
CD22 19.2%, CD13 18.46%,
CD33 8.36%. Biopsia renal
con tinción rojo Congo positiva.
Comentario: la macroglobulinemia de Waldenström tiene
una incidencia de 6 casos por
un millón de habitantes, las
manifestaciones renales son
infrecuentes y generalmente se asocian a amiloidosis
secundaria. Conclusión: los
criterios para definir una MW
gammapatía monoclonal IgM
>30/L (>20 según la FAB), infiltración de medula ósea por
linfocitos pequeños, células
plasmocitoides y células plasmáticas. Esta entidad, es poco
frecuente, representa el 2% de
las neoplasia hematológicas
con una incidencia de 1 caso
por 200, 000 habitantes al año
y afecta a individuos de edad
avanzada con una media de
55 años.
Inmunodeficiencia común variable como causa de fiebre de
origen desconocido
MA Flores Méndez, F Briceño
Moya, F González Márquez
Departamento de Medicina
Interna, Hospital de Especialidades Dr. Antonio Fraga Mouret,
CMN La Raza, IMSS, México,
DF
Introducción: la inmunodeficiencia común variable es
una deficiencia primaria por
defectos en la fase terminal
de maduración del linfocito
B alterando la producción de
anticuerpos; asociada a fenotipos clínicos: infecciones
recurrentes, autoinmunidad,
gastrointestinales, linfoproliferativo y neoplasias. Descripción
de caso: hombre de 34 años inicia 20 meses previos con fiebre
diaria, síntomas rinofaríngeos,
cefalea y dolor facial, recibiendo manejo hospitalario médico
y quirúrgico por rinosinusitis
sin mejoría; estudiado sin identificar causa. Antecedente de
parálisis cerebral, rinosinusitis
crónica; contactos sexuales
con prostitutas. Exploración
física: fiebre 39ªC, bajo peso,
dolor a la palpación en senos
paranasales frontal y maxilares,
no adenopatías, extremidades
espásticas. Paraclínicos: BH,
QS, PFH, EGO sin alteración;
reacciones febriles negativas,
cultivos sin desarrollo, PPD,
BAAR en expectoración y
cultivo para Micobacterium
negativos; perfil TORCH negativo, VHB, VHC y VIH negativos,
inmunológicos normales; USG
abdominal, radiografía de tórax,
TC cervico-toraco-abdominopélvica sin alteraciones, TC
senos paranasales inflamación
crónica, colección maxilar
compleja, erosión septal; SEGD
reflujo gastroesofágico grado II.
Evoluciona con fiebre a pesar
de tratamiento, ante hallazgo de ausencia de memoria
inmunológica se sospecha inmunodeficiencia, se solicitan
inmunoglobulinas reportándose
muy bajas y subpoblación de
linfocitos TCD4+ disminuidos;
se concluye Inmunodeficiencia
común variable y se propone
manejo con gammaglobulina
pero el paciente no acepta.
Comentario: en la evaluación
diagnóstica de rinosinusitis
crónica deben descartarse factores contribuyentes como
inmunodeficiencia. En este
caso el diagnóstico de inmunodeficiencia común variable
se establece por los criterios
ESID/PAGID: Infecciones bacterianas recurrentes, edad mayor
a 4 años, IgG y otro subtipo de
Ig séricas por debajo del límite
normal, y exclusión de causa
subyacente. La rinosinusitis
crónica se presenta en 47% de
los pacientes. La ERGE es factor
predisponente para cuadros recurrentes. La gammaglobulina
humana IV o SC de 300 a 600
mg/kg/dosis cada 3-4 semanas
es el tratamiento de elección.
Conclusión: la inmunodeficiencia común variable es un reto
en diagnóstico diferencial de
fiebre de origen desconocido,
su desconocimiento lleva a falla
en diagnóstico oportuno y a
complicaciones severas.
Trombosis porto-espleno-mesentérica una condición clínica
poco frecuente
Hugo Millán Aguilar
Residente de primer año de
Medicina Interna, TEC Salud,
Hospital San José, Unidad de
Cuidados Intensivos del Adulto,
Monterrey, Nuevo León
Introducción: la trombosis
porto-espleno-mesentérica es
S25
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
una condición clínica rara, con
alta morbilidad y mortalidad.
Causa del 5-10% de los eventos abdominales isquémicos.
Caso clínico: se describe el
caso de una paciente femenino
de 36 años, con antecedente
de dismenorrea y metrorragia
en tratamiento con levonogestrel/etinilestradiol, tabaquismo
negado. Peso 87 kg, estatura
1.52 m, IMC de 37.7. Con un
mes de evolución con dolor
post-prandial en mesogastrio e
hipocondrio derecho. Se realizó
ultrasonido de abdomen donde
se reporta: vesícula biliar distendida con diámetros de 6.7x3cm,
con lodo biliar y microlitiasis, no
se observó flujo en vena porta
sin datos de hipertensión portal,
bazo de 11 cm. Se realizó colecistectomía por laparoscopia y
es egresada asintomática. Ingresó
1 semana después al presentar
dolor abdominal post-prandial en
mesogastrico, acompañado de
distensión abdominal. Se realizó
US de abdomen con Doppler
color que reporta ausencia de
flujo portal. TAC de abdomen
contrastado muestra trombosis de
vena porta izquierda y derecha,
esplénica, mesentérica superior
e inferior, bazo de 14.3cm,
engrosamiento segmentario de
la pared del tercio medio del
yeyuno. Se realizó portografía
para recanalización mediante
trombectomía y trombolisis directa. Continuó evolución con
dolor, distensión abdominal y
ausencia de evacuaciones, se
agregó inestabilidad hemodinámica, sin requerir vasopresores.
S26
Nuevo TAC de abdomen contrastado con evidencia de hematoma
hepático y compromiso de tercio
medio del yeyuno. Se realizó
laparotomía con resección de
50cm de yeyuno. Posteriormente embolización hepática.
Cursó con evolución clínica
favorable. Se realizarón antianticardiolipinas IgG-IgM, B2
glicoproteína menor de 9, anticoagulante lúpico LA 1 78s, LA
2 52.8s, relación LA1/LA2 1.48.
US pélvico reporta mioma mural,
linea endometrial 7 mm, anexos
normales, ACE menor de 0.5 ng/
mL, CA 19-9 2.42 U/mL. Comentarios: en este caso dentro
de los factores predisponentes
para el desarrollo de trombosis
la paciente contaba con el uso
de anticonceptivos orales, el antecedente de un procedimiento
laparoscópico se ha asociado a
la presencia de trombosis portomesentérica. Sin embargo, no se
debe descartar la presencia de un
estado protrombótico agregado.
Conclusiones: la trombosis
porto-espleno-mesentérica se
presenta con un cuadro clínico
variable que va desde asintomático hasta condiciones graves
con infarto intestinal. El retraso
en el diagnostico determina el
pronóstico clínico.
Coproporfiria hereditaria: reporte de un caso
O Ruvalcaba Pérez, LF Pineda
Galindo
Servicio de Medicina Interna.
UMAE Especialidades Dr. Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: la coproporfiria
hereditaria es la más rara y menos reconocida de las porfiarías
hepáticas. Objetivo: presentar
el caso de una paciente con
coproporfiria hereditaria. Resumen: mujer de 41 años. Historia
familiar de coproporfiria hereditaria. Antecedente a los 13
años de dolor abdominal difuso
de intensidad variable, con
múltiples hospitalizaciones por
sospecha de abdomen agudo,
sin confirmar nunca la causa,
estreñimiento, náuseas y vomito
ocasional. Curso con aparición
de eritema-papulovesicular en
sitios fotoexpuestos. Cuadro
clínico de 1 mes de evolución,
con astenia, adinamia, mialgias
generalizadas, parestesias de 4
extremidades, mareo con los
cambios de posición y dolor
abdominal difuso intermitente.
Fenotipo de piel tipo 1, dermatosis facial con lesiones
maculopapulares eritematosas
en zonas fotoexpuestas, neurológicamente integra, fuerza
muscular 4/5 generalizada,
sensibilidad conservada, sin
cambios en la frecuencia cardiaca o tensión arterial con los
cambios de posición, abdomen
con dolor difuso a la palpación en hipocondrio derecho
sin irritación peritoneal. Resto
normal. A su ingreso leucocitos
de 13,700 (neutrófilos 80.7%),
resto sin alteraciones. Durante
su estancia presento incremento
del dolor abdominal difuso de
intensidad 7/10, se realizo USG
abdomen descartando patología visceral, solo con datos de
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
hepatopatía crónica, se manejó
con soluciones glucosadas
intravenosas, con mejoría de
la sintomatología. Por antecedentes y cuadro clínico, se
solicitó porfirinas reportando:
Acido delta-aminolevulénico:
0.3 mg/L (0-5.0), porfobilinego
en orina: 0.1 mg/24 h (0-2.0),
poproporfirinas en orina 0.4
mg/24 h (0-100), Uroporfirinas
totales 0.1 mg/24 h (0-50),
porfirinas en heces positivo
+++ (negativo), confirmando
el diagnostico de coproporfiria hereditaria, además de
documentar datos de miopatía
generalizada sin inestabilidad
de membrana por electromiografía. La paciente presento
mejoría y continua vigilancia
en consulta externa. Conclusión: la coproporfiria es una
enfermedad hereditaria con
baja incidencia. Para su diagnóstico se debe tener en mente
los principales síntomas (dolor
abdominal sin causa aparente),
aunado a antecedentes familiares, lo que ayuda a reconocer
de forma temprana este tipo de
enfermedad.
Aplasia pura de serie roja por
parvovirus B19 en paciente
con VIH
Beatriz Alejandra Castellanos
Ledesma, Pilar Benítez Cejudo
Servicio de Medicina Interna,
Hospital General Regional
núm. 1 Ignacio García Téllez,
Cuernavaca, Morelos
Introducción: la aplasia pura
de la serie roja asociada a la
infección por parvovirus B19 se
caracteriza por la ausencia de
precursores eritroides en la médula ósea que produce anemia
grave normocítica normocrómica, con un bajo recuento
de reticulocitos. La infección
primaria ocurre generalmente
en la niñez. Infecta eritroblastos
e inhibe su actividad mitósica
provocando un “arresto” en
la eritropoyesis. La forma de
presentación depende estado
inmunológico o hematológico
del paciente. Para el diagnóstico
se usan métodos que detectan
el virus o su ADN (inmunohistoquímica, hibridación in
situ, PCR) o anticuerpos específicos séricos (ELISA) siendo
tratamiento principal uso de
inmunoglobulinas. Descripción: el presente caso de aplasia
pura de la serie roja asociada a
la infección por Parvovirus B19
en un paciente de 29 años con
VIH - en tratamiento con truvada
y efavirenz con CD4 iniciales de
87 células, anemia normocítica
normocrómica reticulocitos
disminuidos, con hemotransfuciones multiples. El aspirado
de medula ósea reportó hipocelularidad con megacariocitos
levemente disminuidos, 2% de
normoblastos, serie linfoide y
granulocitica normales, granulocitos adultos 50% compatible
con aplasia pura de seria roja. La
biopsia de medula ósea reporto
normocitica normocelular con
fibrosis reticulinica grado II-III
multifocal asociada, se realizó ensayo inmunoenzimático
para parvovirus B19 reportando
anticuerpos IgG 3.1 positivo,
anticuerpos IgM <0.9 negativo. Se inició tratamiento con
gammaglobulina hiperinmune
a 400 mg/kg/día por 5 días, con
respuesta favorable. Comentarios: en pacientes con infección
avanzada por VIH-anemia-parvovirus B19 se han descrito
relativamente pocos casos, Sin
embargo es probable que esta
entidad esté sub-diagnosticada
debido a que se requieren estudios moleculares, siendo poco
accesibles estos últimos para la
mayoría de los hospitales públicos. Discusión: Los reportes
de anemia severa secundaria a
infección por parvovirus B19 en
pacientes por VIH se asocian a
inmunodeficiencia avanzada y
bajo recuento de células CD4,
la anemia normocítica normocrómica con reticulocitos bajos
en pacientes con VIH sin disfunción renal sugiere infección
por infección por parvovirus
B19, Las crisis aplásicas son
tratadas con transfusiones a los
enfermos inmunodeficientes se
les administran inmunoglobulinas intravenosas siendo este el
tratamiento indicado.
Síndrome de plaquetas pegajosas tipo II agregado a
trombofilias hereditarias
Christian Gerardo Alfaro Rivera,
Clotilde Guadalupe Ramírez
Barrragán, Miguel Ángel Velázquez Ferrari, Eloy Medina Ruíz
Departamento de Medicina
Interna, Departamento de Hematologia, Hospital Ángeles del
Carmen, Guadalajara, Jalisco
S27
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Introducción: enfermedad infrecuente y poco sospechada
como factor de trombofilia
hereditaria. Provoca eventos
trombóticos arteriales y venosos en sitios poco comunes.
Hay sólo 270 casos reportados
en el mundo, 55 de estos en
México. Descripción del caso:
mujer de 43 años con historia
familiar de trombosis arterial y
venosa, migraña sin aura, hipercalciuria idiopática y epilepsia
parcial. En enero 2014 presenta
tromboflebitis en pierna derecha
después de viaje largo, 3 episodios posteriores relacionados
a sedentarismo. Recibe tratamiento con ASA, flebotónicos
y dabigatrán. Tres semanas
después, a pesar de tratamiento,
presenta TEP subsegmentaria. Al
examen físico poca repercusión
hemodinámica cardiopulmonar,
edema de miembro inferior
derecho, índice tobillo-brazo
normal bilateral y dímeros D
elevados. Posteriormente, se
estudia trombofilia primaria
encontrando: tiempos de coagulación normales, anticuerpos
anticardiolipinas y anticoagulante lúpico, así como serología
para LES negativos, sin resistencia a la proteína C y S y sin
mutación del factor V de Leiden.
La antitrombina III y la homocisteína se reportaron normales.
La agregometría plaquetaria
mostró agregación temprana,
demostrándose mutaciónes
de la metileno tetrahidrofolato
reductasa + protrombina 20210
GA homocigoto + GP GIIIa
plaquetario. Concluyendo así,
S28
que se trataba de un síndrome
de plaquetas pegajosas tipo
II asociado a las mutaciones
descritas. Se trata con ácido acetilsalicílico y rivaroxabán con
mejoría clínica. Comentarios
y Conclusiones: son comunes
en estos pacientes la migraña,
SICA, trombosis retiniana y otros
eventos arteriales y venosos. Las
mutaciones descritas asociadas
a la mutación del factor V de
Leiden tienen un incrementado
importante de riesgo relativo
para trombosis. Llegando a ser
hasta el 15% de las trombofilias
hereditarias. La medición de
homocisteína se debe considerar para decidir el tratamiento.
Siendo la agregometría plaquetaria, como se utilizó en este
caso, el estándar de oro para
el diagnóstico. La terapéutica
es antiagregantes plaquetarios
durante toda la vida.
Trombolisis con alteplase en el
manejo de embolia pulmonar
aguda masiva en embarazo de
11 semanas de gestación
Juan Isaac Reyes Sepeda, Brenda Izuki López Benjume, David
Hernández Pérez, José Juan
Ceballos Macías, Arturo Javier Cervantes Ramos, Jessica
Martine Tebar, Laura Álvarez
Gutiérrez, Enrique Figueroa
Genis
Hospital Central Militar, Escuela
Militar de Graduados de Sanidad, Área de Medicina Interna
Introducción: el embarazo es
un estado procoagulable que
minimiza la pérdida de sangre
durante el parto, pero aumenta
la tasa de eventos tromboembólicos, su incidencia varía de
0,3 a 1/1 000 partos y una de
cada 100 000 embarazadas
mueren por esta causa. Descripción del caso: femenina de
36 años, multigesta, cesárea
previa con embarazo de 11
semanas de gestación, IMC
24.4 kg/m2 acude a urgencias
por: disnea, dolor torácico
y hemoptisis, con taquicardia (116 lpm), taquipnea (28
rpm), SO2 89% e hipotensión
(95/50 mmHg), presenta; plétora yugular, disminución del
sonido respiratorio en bases
pulmonares, con estertores finos, y miembros inferiores con
insuficiencia venosa crónica,
Homans negativo, probabilidad clínica alta para TEP por
escala de Wells, gasometría
arterial con datos de hipoxemia electrocardiograma con
inversión de las ondas T en cara
anteroseptal y bloqueo de rama
derecha, radiografía de tórax
con derrame pleural bilateral
del 10%, péptido natriurético
tipo B 435, dímero D 5000,
doppler de miembros inferiores
sin trombosis venosa profunda,
y ecocardiograma con movimiento paradójico septal,
angiotomografía de tórax, con
tromboembolia pulmonar aguda
segmentaria y subsegmentaria
bilateral. Se tromboliza con
Alteplase 50 mg con mejoría
clínica, presentó epistaxis,
quedando con Anticoagulación
profiláctica durante todo el embarazo, con heparina de bajo
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
peso molecular, finalizando embarazo con cesárea electiva con
producto femenino pretérmino,
CAPURRO de 36 semanas,
Apgar 8-9, peso de 2570. Comentarios: esta paciente se
estatificó como TEP masiva por
compromiso hemodinámico
y disfunción de ventrículo
derecho, debido a la escasez
de estudios clínicos realizados
en pacientes embarazadas y
que en las guía clínicas de TEP
no se mencionan algoritmos
para pacientes embarazadas
cada caso se aborda de forma
individual, esta paciente fue
manejada con trombolisis con
altaplase sin presentar complicaciones fetales y con buena
respuesta clínica para la madre.
Conclusiones: el diagnóstico
y tratamiento de la TEP en el
embarazo es complicado por
los cambios fisiológicos en el
embarazo, se pueden utilizar
diferentes modalidades diagnósticas, incluida la TC ya que
se encuentran por debajo de
la dosis límite de peligro de
daño al feto (50,000 Gy), el
tratamiento trombolítico no se
debe impedir por el solo hecho
del embarazo.
Aplasia pura de células rojas
como causa infrecuente de
anemia en lupus
Eugenia Saldarriaga, 1 Carlos
Escalante Penagos, 2 Cinthia
Álvarez Sánchez,2 Darío Aguirre
Hernán,1 Andrés Felipe Posada1
1
Medicina Interna, Hospital
de La Samaritana, Bogotá,
Colombia
Servicio de Reumatología,
Hospital General de México
2
Introducción: la aplasia pura
adquirida de células rojas es
una causa infrecuente de anemia. Se caracteriza por un
descenso grave de reticulocitos
en sangre periférica y ausencia
de precursores eritroides en
médula ósea. Es común su
asociación con neoplasias,
infección por parvovirus B19
y enfermedades autoinmunes.
Descripción del caso: mujer
de 32 años de edad con lupus
eritematoso sistémico (LES)
con actividad mucocutánea y
articular en tratamiento con
antimalárico y prednisona.
Ingresó a hospitalización por
cuadro de fatiga y disnea que
empeoró hasta ser de pequeños
esfuerzos, previamente tratada
como ambulatorio con suplemento de hierro y ácido fólico.
Se documentó anemia de 3.4 g/
dL, normocítica normocrómica
(VCM 96, HCM 33) sin evidencia de sangrado a nivel de
mucosas, tracto gastrointestinal
ni urinario, con bilirrubina indirecta y lactato deshidrogenasa
dentro de parámetros normales,
prueba Coombs directa negativa, índice reticulocitario en
0.5%, hierro sérico, niveles de
vitamina B12 y folatos elevados. Por lo anterior se realizó
aspirado de médula ósea que
reporta depresión severa de la
serie eritroide con el resto de
líneas celulares sin alteraciones.
Inició tratamiento con pulsos de
metilprednisolona sin respuesta
por lo que se indicó ciclosporina-A con evolución parcial a
la mejoría. Conclusión: A pesar
de ser una causa poco común,
se han descrito pacientes con
lupus eritematoso sistémico y
aplasia pura de células rojas.
Esta condición se atribuye a la
presencia de autoanticuerpos
contra eritropoyetina aunque
el mecanismo fisiopatológico
parece ser más complejo. El
pronóstico de estos pacientes
es malo debido a que no hay
tratamiento específico por lo
que requieren transfusiones
repetidas.
Mielofibrosis primaria expresada como fiebre de origen
desconocido
Leslie Moranchel García, Brenda Grisel Rodríguez Corchado,
Sergio Alberto Mendoza Álvarez
Servicio de Medicina Interna,
UMAE-Especialidades Dr. Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: en la etiología de
la fiebre de origen desconocido
(FOD) las principales series
muestran cambios en la distribución de las distintas causas.
Las neoplasias hematológicas
ocupan del 6 hasta un 15%
del total de los casos. La mielofibrosis primaria (MF) es una
causa poco común de fiebre y
forma parte de los síndromes
mieloproliferativos crónicos.
Se caracteriza por una proliferación clonal, esplenomegalia
y anemia. Objetivo: presentar
S29
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
el caso de un paciente con
fiebre como síntoma principal
de su padecimiento. Después
de un protocolo de estudio
sistematizado y orientado que
concluyó en la realización de
una laparotomía protocolizada
se llegó al diagnóstico de MF.
Resumen clínico: masculino
de 56 años. Debutó con fiebre
durante 6 meses, diaforesis
nocturna, pérdida de peso,
artralgias e ictericia. Se realizó
un estudio que abarcó las 5
fases propuestas, descartando las causas infecciosas e
inflamatorias. Destacaba la
hepato-esplenomegalia, anemia y trombocitopenia por lo
que se propusieron: Biopsia de
médula ósea: MO hipercelular
con hiperplasia de series mieloide y eritroide. Biopsia de
hueso: Celularidad global del
80%, presencia de las 3 series
hematopoyéticas. Fibrosis reticulínica Grado I-II focal, MO
hipercelular con hiperplasia de
serie mieloide y eritroide. Ante
reportes poco concluyentes
y persistencia de la fiebre se
programó laparotomía protocolizada que reportó ascitis,
conglomerados ganglionares,
hígado congestionado y bazo
con zonas fibrinopurulentas. El
reporte histopatológico de las
muestras obtenidas sumado a
la fibrosis reticulínica en MO,
hiperplasia de series mieloide y
eritroide, apoyaron la sospecha
de un trastorno mieloproliferativo como etiología de la FOD. Se
cumplieron 2 criterios mayores
y 3 menores de MF. Comenta-
S30
rio y Conclusión: la MF es una
causa excepcional de FOD que
se diagnóstica con base en una
serie de criterios y alteraciones
hematológicas. Para establecer
una etiología certera debe seguirse un protocolo de estudio
ordenado y sistematizado conforme a los recursos de cada
hospital.
Hemofilia adquirida posparto:
reporte de caso y revisión de
la literatura
Ana Lucia Diez de Sollano Basila, Jesús Martínez Gutiérrez,
Cristina Moreno del Castillo,
Luis Antonio Meillon García
Medicina Interna, Centro Médico ABC Santa Fe, México, DF
Se trata de una paciente de 25
años sin antecedentes médicos
de importancia a excepción
de haber sido sometida a una
cesárea tres meses antes del
inicio del cuadro sin complicaciones. Inició 4 meses previos
a su llegada con la aparición
de equimosis espontáneas en
brazos y región inguinal de
aparición intermitente que
remitían espontáneamente.
Posteriormente presentó aumento de volumen en muñeca
derecha, con dolor intenso
que limitaba la movilidad de
la mano así como cambio de
coloración a tono violáceo que
remitió sin tratamiento en 2 semanas, sin embargo 2 semanas
después presentó aumento de
volumen con dolor y limitación en movilidad de rodilla
izquierda, por lo que acude
a hospital donde sospechan
trombosis venosa profunda y
administran enoxaparina por 5
dosis. Secundario a esta acción
aparecen nuevos hematomas
en todo el cuerpo, así como
empeoramiento del aumento
de volumen en rodilla izquierda
por lo que es trasladada a nuestra institución. A la exploración
física se encontraba con signos
vitales normales, con múltiples
hematomas extensos en extremidades superiores e inferiores,
así como aumento de volumen
en rodilla izquierda con coloración violácea de la piel y
dolor intenso a la movilidad
sugerente de hemartrosis. En el
abordaje inicial se encontró una
prolongación del tiempo parcial
de tromboplastina activado en
67 segundos que no corregía
con diluciones 1:1 con plasma
fresco posterior a 2 h de incubación, el resto de los tiempos de
coagulación y la biometría hemática fueron normales. Por lo
que se midió actividad de factor
VIII la cual fue menor a 1% y
medición de inhibidor de factor
VIII el cuál fue positivo con lo
que se confirma el diagnóstico
de hemofilia A adquirida. Se
inició tratamiento con factor
VII recombinante para control
de síndrome hemorrágico y se
descartaron causas autoinmunes y neoplásicas que pudieran
estar asociadas. Se inició tratamiento inmunosupresor con
Prednisona y ciclofosfamida en
espera de disminución de los
niveles del inhibidor de Factor
VIII. La Hemofilia A adquirida
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
postparto es una entidad rara y
grave que debe ser identificada
para evitar complicaciones fatales ya que es potencialmente
reversible. Las causas más
frecuentes son el posparto, las
enfermedades autoinmunes,
neoplasias o fármacos.
Anemia hemolítica autoinmune como presentación clínica
de síndrome crioglobulinémico
Alejandra Ruiz Fuentes, Luis
Carlos Álvarez Torrecilla, Pamela Teresa Mendoza Barradas,
Ivette Denisse Bonilla Gudiño
Hospital Regional 1º de Octubre, ISSSTE, México, DF
Introducción: las crioglobulinas son inmunoglobulinas
que precipitan cuando el suero
se incuba a una temperatura
inferior 37ºC. La clasificación
se basa en la composición del
crioprecipitado, compuesto
por única clase de inmunoglobulinas en la crioglobulinemia
simple o tipo I y por dos clases distintas (IgG e IgM) en la
crioglobulinemia mixta (CM),
que engloba los tipos II y III. La
mayor parte de las CM se asocian a diversos procesos como
infecciones, enfermedades
autoinmunes o síndromes linfoproliferativos. Descripción del
caso: femenino de 77 años hipertensión arterial sistémica 10
años de evolución entratamiento con felodipino y metoprolol.
Padecimiento actual, astenia,
adinamia, hiporexia. ataxia y
disestesias de miembros inferiores se realiza biometría con
anemia grado III, normo normo,
reticulocitosis. VSG elevada,
hiperbilirrubinemia a expensas de indirecta, el frotis con
poiquilocitosis, eliptocitosis,
células en diana, anisocitosis,
hipocromía. Inmunoglobulinas:
IgG aumentada: 1970, resto
IgA, IgM, IgE en valores normales. Panendoscopia: esofagitis
grado A de los Ángeles, gastropatía atrófica antral, con reporte
histopatológico: gastritis crónica atrofica. COOMBS directo:
positivo, anticuerpo encontrado
anti-E y crioaglutininas. TORCH
memoria para CMV y rubeola.
Se concluyó un síndrome de
aglutininas frías (por crioaglutininas) idiopático, el cuadro
clínico de presentación fue una
anemia hemolítica autoinmune,
la paciente fue citada a la consulta externa de hematología, se
dio tratamiento con prednisona.
Esta condición debe considerarse en el diagnóstico diferencial,
al enfrentar un caso de anemia
hemolítica. Comentarios: la
crioglobulinemia de tipo I se
asocia fundamentalmente a discrasias de células plasmáticas
y procesos linfoproliferativos.
La existencia de crioglobulinas
circulantes (crioglobulinemia)
no siempre se asocia a la presencia de sintomatología y se
utiliza el término “síndrome
crioglobulinémico” cuando los
pacientes con crioglobulinemia presentan manifestaciones
clínicas. En ellos se observa un
proceso vasculítico sistémico
que implica a vasos de pequeño
y mediano calibre de diversos
órganos, especialmente la piel,
sistema nervioso periférico y riñón. Conclusiones: a diferencia
de lo que ocurre con el resto de
las enfermedades autoinmunes
sistémicas, en la crioglobulinemia aún no se han definido los
criterios para su diagnóstico,
y generalmente se llega a una
sospecha clínica que se confirma con la determinación de las
crioglobulinas.
Abscesos hepáticos múltiples
asociados con cáncer de colon
como causa de fiebre de origen
oscuro
ED Zavala Álvarez, JM Sánchez
Sánchez
Servicio de Medicina Interna,
Hospital Regional de Ciudad
Madero, PEMEX, Ciudad Madero, Tamaulipas
Introducción: los abscesos
hepáticos son reconocidos
desde el tiempo de Hipócrates,
corresponden al 43% de los
abscesos en viseras. Hasta el
40% se asocia con neoplasias.
Existen casos documentados
de metástasis complicadas con
abscesos hepáticos, así como
su asociación a otros tipos de
cáncer. Dentro de las causas
de fiebre de origen oscuro
dentro del contexto de neoplasias, encontramos al cáncer
de colon como la cuarta causa
en frecuencia. Ficha de identificación: Originario de Ciudad
Madero, casado, obrero, jubilado. Antecedentes personales:
tabaquismo actualmente suspendido. Apendicectomía hace
S31
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
8 meses, grado II. Constipación
y dolor abdominal difuso de 10
meses de evolución. Evolución:
Inicia padecimiento al presentar
cuadro de dolor abdominal y
disuria de 8 días de evolución, 2
días previos con T: 38.5° con los
siguientes datos de laboratorio:
leu 23, hb 9.5 plt 341 amilasa
24 Na 135 K 4.4 CL93. EF: abdomen dolor a la palpación en
hipocondrio derecho, Murphy
+, se solicita ultrasonido abdominal reportando 2 imágenes
en lóbulo derecho con ecogenicidad heterogénea de 7 y 8 cm.
Se realiza diagnóstico de abscesos hepáticos, se brindan 6 días
de esquema con ceftriaxona y
metronidazol sin mejoría, us
de control con progresión. Se
decide modificar a meropenem. Se evidencia progresión
del cuadro por ultrasonido y
tac con hígado con múltiples
lesiones hipodensas en la mayor
parte del lóbulo derecho, liquido libre subhepático y derrame
pleural, colon con ángulo hepático, pared engrosada y edema
de tejido graso adyacente. Se
realiza laparoscopia obteniendo líquido purulento sin aislar
patógenos. Clínicamente sin
mejoría, se investiga causa de
persistencia de fiebre, marcadores tumorales negativos, control
de ultrasonido y punción de
absceso aislándose en tinción
bacilos gram -, y nueva tac
con crecimiento de plastrón
en pared colónica y edema de
tejido graso adyacente. Se decide colonoscopia encontrando
tumor exofítico en región distal
S32
de colon ascendente, cerca de
ángulo hepático. Biopsia reporta neoplasia maligna epitelial.
Tratamiento: hemicolectomía.
Por tamaño del tumor primario
(15 cm) corresponde a un T3,
ganglios negativos N0, y metástasis no demostradas M0,
corresponde a una etapa II, con
abscesos hepáticos resueltos,
cuadro febril remitido.
Tuberculosis ovárica y peritoneal simulando malignidad
ovárica y carcinomatosis peritoneal
JAJ Batún Garrido, N Valencia
Serrano, F Olán, E Hernández
Núñez
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa
Pérez, Villahermosa, Tabasco
Introducción: la tuberculosis
peritoneal es una afectación
poco común de infección extrapulmonar causada por M.
tuberculosis, constituye el 1-3%
del total de la enfermedad
tuberculosa. El diagnóstico de
tuberculosis genital es un reto,
debido a las manifestaciones
clínicas inespecíficas y a que
puede simular un cáncer de
ovario por sus síntomas vagos
y hallazgos radiográficos y
bioquímicos inespecíficos,
como la presencia de tumoración anexial, carcinomatosis
peritoneal y la elevación del
marcador CA 125. Descripción
del caso: Femenino 52 años.
Inicia su padecimiento hace 12
meses, al presentar aumento del
perímetro abdominal y dolor
de intensidad 8/10 de EVA en
fosa ilíaca derecha, tipo cólico,
intermitente, pérdida de 5 kg de
peso, USG el cual reporta quiste
ovárico izquierdo y miomatosis
de medianos y grandes elementos, con seguimiento trimestral
por USG, presentando aumento del tamaño de las lesiones
por lo que se hospitaliza para
intervención quirúrgica. EF: abdomen con dolor a la palpación
superficial y profunda generalizada. TAC abdominopélvica:
tumoración dependiente de
útero con involucro de ambos
ovarios y recto, grasa peritoneal
con aumento en su densidad
con múltiples imágenes nodulares dispersas. Se realiza LAPE
encontrándose tumoración bilateral de ovario de 10 x 10 cm de
consistencia pétrea e implantes
en útero, mesenterio, intestino
delgado, peritoneo parietal
y vesicouterino, tomándose
biopsias respectivas, reportando
reacción inflamatoria crónica
granulomatosa con células
gigantes multinucleadas tipo
Langhas con necrosis caseosa,
tinción de Ziehl-Neelsen con
presencia de bacilos ácidoalcohol resistentes, se inicia
DOTBAL. Radiografía de tórax
normal, BAAR seriado en esputo y orina negativos, ELISA para
VIH negativo. Se egresa con
manejo y seguimiento por la
consulta externa. Comentario
y Conclusiones: la tuberculosis peritoneal y ovárica son un
reto diagnóstico, debido a su
presentación inespecífica, en
ocasiones confundiéndose con
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
carcinoma de ovario, sometiendo a las pacientes a cirugías
innecesarias realizándose el
diagnostico en el transoperatorio, como fue el caso de nuestra
paciente. Es importante realizar
el diagnóstico oportuno ya que
de ello depende su pronóstico.
Aspergilosis y nocardiosis en
una paciente con tuberculosis
pulmonar
JAJ Batún Garrido, N Valencia
Serrano, E Hernández Núñez,
F Olán
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa
Pérez, Villahermosa, Tabasco
Introducción: la tuberculosis
pulmonar produce lesiones
en el parénquima pulmonar
como bronquiectasias y cavitaciones las cuales son un
factor de riesgo para la nocardiosis pulmonar. Un porcentaje
importante de pacientes con
cavernas tuberculosas residuales inactivas pueden desarrollar
aspergilomas, principalmente
por A. flavus. La aspergilosis,
nocardiosis y tuberculosis pulmonar suelen presentarse en
pacientes inmunodeprimidos
y tienen características radiológicas y presentación clínica
similar. Descripción del caso:
femenino 23 años, COMBE
positivo. Inicia su padecimiento presentando tos con esputo
amarillento, acompañada de
disnea MRC 2, progresa a disnea MRC 3, incremento de tos,
acompañada con expectoración
hemoptoica, diaforesis noctur-
na, pérdida de peso, niega
fiebre, por lo que se hospitaliza.
EF mal estado general, polipneica, taquicardia, amplexión
y amplexación disminuida,
hipoventilación bibasal, estertores crepitantes, pectoriloquia
áfona. Paraclínicos leucocitos
33.2 x 103/µL, neutrófilos 29.8
x 103/µL, linfocitos 2.4 x 103/
µL, Hb 10.4 g/dL, PCR 15.2 mg/
dL, ELISA para VIH negativo.
Radiografía de tórax múltiples
zonas cavitarias, zona de condensación basal izquierda. Se
inicia cefalosporina de tercera
generación. TAC de tórax con
afectación del espacio intersticial de tipo reticulonodular
con predominio izquierdo,
cavernas en pulmón izquierdo
de localización principalmente
apical con probable fístula al
espacio pleural, zona de condensación bilateral. Se solicita
BAAR en esputo donde se observa bacilos alcohol resistente
compatible con M. tuberculosis
y estructuras filamentosas y
ramificadas compatibles con
Nocardia, se inicia DOTBAL y
TMP SMZ. Se solicita cultivo
de esputo el cual presenta crecimiento de Aspergillus, por lo
cual se administra voriconazol
con adecuada evolución, se
egresa con seguimiento en la
consulta externa. Comentario
y Conclusiones: se presenta
el caso de una paciente con
tuberculosis pulmonar, la cual
debido a las lesiones pulmonares que produce crea un
ambiente adecuado para el desarrollo de otras enfermedades
oportunistas como Aspergillus
y Nocardia. La paciente no
presentaba ningún factor de
riesgo para el desarrollo de
infecciones oportunistas, más
que el COMBE positivo.
Megacolon tóxico: Reporte de
un caso
JAJ Batún Garrido, E Hernández
Núñez, F Olán
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa
Pérez, Villahermosa, Tabasco
Introducción: el megacolon
tóxico se caracteriza por la
aparición de dos componentes
simultáneos: un cuadro tóxico
sistémico y dilatación aguda del
colon, total o segmentaria (> 6
cm), no obstructiva, debida a
la inflamación aguda de todas
las capas con necrosis de la
mucosa. Su incidencia en la
CUCI es < 5%. Con una mortalidad del 19%. Descripción
del caso: Masculino 45 años,
antecedente de estreñimiento
crónico, inicia su padecimiento
10 días previos al presentar evacuaciones diarreicas con moco
y sangre, 10 al día, dolor abdominal tipo cólico, generalizado,
continuo, distención abdominal, alteración del estado de
alerta y datos de deshidratación
por lo cual acude a hospitalización. Paraclínicos leucocitos
8.3 x 103/µL, neutrófilos 5.8 x
103/µL, Hb 19 g/dL, Hto 56.7%,
Cr 2.44 mg/dL, PCR 31.7 mg/
dL. EF: abdomen con dolor a
la palpación superficial y profunda generalizada, peristalsis
S33
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
ausente, distención abdominal. Rx simple de abdomen:
dilatación del colon > 7cm a
expensas de colon transverso,
se realiza LAPE encontrándose
colon sigmoides aumentado de volumen, mucosa con
parcheado necrótico, se toma
biopsia, se realiza colectomía
izquierda, y colostomía, presenta choque hipovolémico grado
III por lo cual ingresa a la UCI,
para reposición de líquidos.
Presenta compromiso vascular
de colostomía, realizándose
segunda LAPE encontrándose
mucosa de colon necrótica,
con parches hemorrágicos y
necróticos hasta íleon terminal
se realiza colectomía de ascendente y transverso e ileostomía.
Presenta choque séptico requiriendo manejo antibiótico y con
aminas vasoactivas. Reporte
histopatológico colitis ulcerosa
crónica inespecífica, sin datos
de atipia celular ni granulomas.
Se mantiene con tratamiento
antibiótico y se revierte la sepsis, se realiza traqueostomía por
intubación prolongada y posterior a 30 días de estancia en UCI
debido a evolución y mejoría
clínica satisfactoria se egresa.
Comentario y Conclusiones: se
debe sospechar en los pacientes
que presenten sintomatología al
menos una semana previa con
más de 6 evacuaciones sanguinolentas, dolor abdominal
y ausencia de ruidos peristálticos. Es importante realizar una
búsqueda intencionada en estos
pacientes ya que pone en riesgo
la vida al presentar una elevada
S34
mortalidad, siendo necesario
realizar estudios de imagen y
un manejo oportuno.
Abscesos paravertebrales secundarios a tuberculosis. A
propósito de un caso
Hugo Alberto Arellano Sotelo,
Kristian Javier Navarrete Becerra, Nallely Sandoval García,
Priscila Alejandra Hernández
Cortés, Dea Sosa Gaona, Erica
García Valadés
UMAE núm. 1, Hospital de Especialidad, CMN Bajío, IMSS,
León, Guanajuato
Introducción: los abscesos
paravertebrales son poco frecuentes en países desarrollados
sin embargo representan la
primera causa de TB extrapulmonar en los países en
desarrollo. El cuadro clínico es
insidioso caracterizado por dolor lumbar con distintos grados
de afección medular así como
extensión del absceso por contigüidad con un desenlace fatal
de no tratarse. Descripción del
caso: paciente femenina de 59
años con antecedente de diabetes mellitus tipo 2 de 12 años
de diagnóstico en tratamiento
con insulinoterapia. Inicia en
mayo 2013, con dolor en región
lumbar y fosa iliaca derecha
tipo pungitivo, con irradiación
a miembro pélvico derecho sin
desencadenantes y remite con
la administración de AINES. El 9
de mayo se reactiva dolor lumbar de mismas características,
alzas térmicas no cuantificadas
y sintomatología urinaria por lo
que acude al servicio de urgencias donde es valorada y tratara
por pielonefritis aguda así como
cetoacidosis diabética severa,
con posterior mejoria clínica y
bioquímica. En junio del 2013
acude a urgencias por presentar
dolor lumbar tipo punzante así
como parestesias de miembros
inferiores ocasionando limitación en la deambulación con
valoración por Traumatología
donde reportan disminución
bilateral de fuerza muscular 4/5 bilateral de miembros
pélvicos con alteración en sensibilidad. Se realiza TAC reporta
absceso de psoas izquierdo,
absceso paravertebral derecho
con volumen aproximado de
184cc. Se reporta resonancia
magnética un absceso paravertebral derecho con dimensiones
105x47x42mm y otro en psoas
82x23x23mm. Se realiza drenaje con cultivo donde se reporta
bacilos acido alcohol resistente
con inmohistoquímica positiva
para TB. Comentarios: Es importante la descripción tanto
diagnostica, como terapéutica
de los abscesos paravertebrales.
Ya que aun en países como el
nuestro la incidencia a comparación del resto del mundo
desarrollado aun es alta y como
vemos en nuestro caso clínico
se trata de un cuadro insidioso que se presenta en meses
con un dolor lumbar crónico,
mismo que puede confundir al
clínico ocasionando retraso en
el diagnóstico que ocasionara
un tratamiento inoportuno y
desenlace fatal. Conclusiones:
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
el diagnóstico y tratamiento
es multidisciplinario que debe
incluir la interpretación de la
sintomatología, evolución así
como interpretación de estudios
de gabinete para sospechar de
la patología y tomar la decisión
en conjunto con el quirúrgico
de la intervención para así
realizar el cultivo y llegar al
diagnóstico definitivo.
Reporte de caso: endocarditis
infecciosa con absceso-vegetación y lesión mitral por Kocuria
rosea
José Antonio Espino Moreno,1
Leonel Olivas Salazar,2 José Ángel Ramírez Rodríguez,3 Israel
Guerrero Díaz4
1
Residente de tercer año de
Medicina Interna
2
Jefe de Cardiología
3
Jefe de Medicina Interna
4
Titular del curso
Servicio de Medicina Interna,
Hospital Universitario de Saltillo, Ciudad de Saltillo, Coahuila
Introducción: la endocarditis
es la colonización bacteriana
de la superficie del endocardio y/o área valvular, esto por
alteración microscópica en
endocardio lo que permite la
adhesión bacteriana tras una
bacteremia. Sin diagnóstico y
tratamiento temprano tiene una
mortalidad de 15 a 20 % y que
alcanza una mortalidad al año
de 40%. Como muchos otros
síndromes no ha escapado a la
nueva aparición de cepas resistentes a antibióticos. Plantea
un reto diagnóstico y una par-
ticipación multidisciplinaria.
Descripción del caso: masculino de 70 años con antecedente
de hospitalización por cuadro
de suboclusión intestinal con
internamiento de 4 días, inicia
su padecimiento posterior a
su egreso con síndrome febril
(temperatura de hasta 39º), la
cual se presentaba de forma
intermitente y sin predominio
de horario acompañado con
ataque al estado general todo
esto de 2 meses de evolución.
Al cuadro inicial se agrega
dolor lumbar el cual llega a ser
incapacitante por lo que acude
a valoración médica donde se
realiza TAC de abdomen con
datos de osteomielitis lumbar,
se presenta hemocultivo positivo para Kocuria rosea y se
realiza ecocardiograma transtorácico donde se observa una
vegetación en anillo mitral, la
cual se corrobora con ecocardiograma trasesofágico. Se
trata con antibioticoterapia a
base de linezolid, fluconazol y
amikacina, se agrega ampicilina
y vancomicina al suspender
linezolid. Se realiza cirugía
cardiaca donde se encuentra
endocarditis con vegetación y
ulceración den valva posterior
y porción de anillo mitral en
P3. Se coloca válvula mitral
protésica biológica. Se pasa a
UCIA y posteriormente a piso y
es egresado 12 días posteriores
a cirugía con buena evolución. Comentario: el paciente
no presentaba un foco infeccioso etiológico, se presentó
solo un hemocultivo positivo.
Conclusiones: la presencia de
endocarditis en >60 años es
frecuente por la presencia de
degeneración valvular y/o la
calcificación de las mismas
agregada a un cuadro de bacteriemia. En algunos pacientes no
se identifica un foco infeccioso
etiológico. Un buen abordaje
y pronto diagnostico previene
complicaciones y mejora el
pronóstico, un manejo multidisciplinario médico/quirúrgico es
importante.
Coccidioidomicosis pleural
José Luis Ramos Martínez, Melissa Hughes García, Carlos
Alberto Hernández Osorio
Departamento de Medicina
Interna, Hospital Universitario,
UANL
Introducción: la coccidioidomicosis es una micosis
sistémica causada por los hongos dimorfos Coccidioides
immitis o C. posadasii. Se
adquiere por inhalación de
artroconidias y aunque es una
infección usualmente benigna, puede llegar a ser fatal en
pacientes inmucomprometidos. Además de enfermedad
pulmonar, puede diseminarse
y causar infecciones que con
mayor frecuencia invaden
sistema nervioso central, huesos, tejido subcutáneo y piel.
Descripción del caso: paciente
femenina de 43 años, sin antecedentes relevantes, quien
ingresa por un cuadro de 6
semanas con dolor abdominal
en epigastrio, intensidad 6/10,
S35
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
tipo opresivo, agravado con
los alimentos, presente durante todo el día, fluctuando en
intensidad, se acompañó de
disnea de esfuerzo al caminar
aproximadamente dos cuadras
y dolor torácico izquierdo generalizado, además de plenitud
postprandial rápida y disfagia
gastroesofágica, 3 semanas
previas a su ingreso se agrega
escalofrío y diaforesis, diaria,
de predominio vespertino,
sin cuantificar temperatura.
La disnea se incrementan de
tal manera que se presenta en
reposo, además de pérdida de
peso de 6 kg aproximadamente en estos 2 meses, plenitud
postprandial y disfagia. EF.
Síndrome de derrame pleural
izquierdo. Rx tórax derrame
pleural masivo izquierdo. Se
realiza broncoscopia y toracocentesis con toma de biopsia
pleural con aguja COPE resultando coccidioidomicosis. Se
inicia tratamiento y cita por
la consulta para seguimiento.
Conclusiones: la semejanza
clínica y radiológica entre la
coccidioidomicosis y la tuberculosis pulmonar nos forza a
incluir esta última en el diagnóstico diferencial. Aunque se
puede presentar la coccidioidomicosis pulmonar acompañada
de derrame pleural en hasta
20% de los casos, la forma primaria pleural es menos común.
Esta enfermedad puede confundirse con otros diagnósticos
por lo que su reconocimiento y
diagnóstico de forma oportuna
es importante.
S36
Polirradiculopatía desmielinizante como presentación
clínica de enfermedad de Lyme
JP Carrizales Luna, MT Sánchez
Ávila, A Suárez Zaizar, S Fonseca Martínez
Servicio de Medicina Interna,
Hospital San José TecSalud,
Monterrey, Nuevo León
Introducción: la enfermedad de
Lyme una enfermedad adquirida por mordedura de garrapata,
la especie más común es Borrelia burdogferi. La enfermedad
de Lyme neurológoca se presenta con la tríada: meningitis
linfocítica, neuropatía craneal y
radiculoneuritis. La enfermedad
se diagnostica con anticuerpos IgM contra Borrelia. El
tratamiento de elección es
doxiciclina y según el sistema
afectado, se agrega cefalosporina. Descripción del caso:
femenino de 34 años que acude
por debilidad progresiva en las
4 extremidades. Antecedentes:
viaje a zona rural 2 semanas
previas al cuadro; resto de antecedentes negados. Inicia su
cuadro 5 días previos a su ingreso con debilidad y parestesias
en miembro torácico derecho,
después se generaliza a las 4
extremidades, dificultando la
marcha. Un día previo se agrega
exantema cutáneo generalizado
y fiebre. Ingresa al hospital con
fiebre de 38.4°C y taquicardia.
A la exploración neurológica:
sin alteración en pares craneales, sin datos de síndrome
cerebeloso ni meningismo,
extremidades hipotónicas, sen-
sibilidad conservada, respuesta
plantar flexora, reflejos miotácticos 1/4 en las 4 extremidades,
fuerza en miembros torácicos:
derecho e izquierdo 3/5 y en
miembros pélvicos: derecho e
izquierdo 2/5. En piel y tegumentos dermatosis generalizada
con placas eritematosas de
bordes irregulares. No se palpan adenomegalias. Resto de
la exploración normal. En sus
laboratorios de ingreso con
leucocitosis (11, 500) a expensas de neutrofilia (8,900),
función renal conservada, sin
elevación de transaminasas,
DHL elevada (701), EGO no patológico y urocultivo negativo.
Tele de tórax, resonancia magnética de cráneo y tomografía
computarizada de columna
normales. Electromiografía y
estudio de conducción nerviosa
con patrón de polirradiculopatía desmielinizante, predominio
en lado derecho, peroneo y
sural. Punción lumbar normal,
con BAAR, Gram, cultivo y
tinta china negativos. Hemocultivos negativos. Canditest
negativos y anticuerpos IgM
para citomegalovirus negativos.
Anticuerpos IgM contra Borrelia
burgodorferi por Western Blot
positivos. Se inicia tratamiento
con inmunoglobulina IV por 5
días y doxiciclina 100 mg cada
12 horas y cefuroxima 500
mg cada 8 horas, con mejoría
progresiva del cuadro febril,
exantema y debilidad de extremidades. Se egresa por mejoría
con tratamiento por 21 días.
Conclusiones: se sospecha la
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
enfermedad por el viaje a zona
rural, fiebre y el exantema. Se
confirma el diagnóstico con serología y se inicia el tratamiento
sugerido por la CDC, con lo
remite sus síntomas.
Síndrome oculoglandular de
Parinaud: reporte de un caso
José Mauricio Cedillo Fernández, Diego Sarre Álvarez, María
José Pardinas Llergo, Enrique
Juan Díaz Greene, Federico
Leopoldo Rodríguez Weber,
Ricardo Cabrera Jardines
Hospital Ángeles Pedregal,
México, DF
El síndrome de óculo glandular
de Parinaud es una conjuntivitis
granulomatosa, poco frecuente, aun que muy aparatosa,
que se manifiesta con fiebre,
adenopatía regional (pre auricular, submandibular o cervical),
enrojecimiento de los ojos,
sensación de cuerpo extraño
y lagrimeo. Fue descrito por
primera vez en 1989 por Henri
Parinaud como una conjuntivitis
folicular, granulomatosa (con
o sin ulceraciones) asociada
con adenomegalia visible, pre
auricular o submandibular
ipsilateral. Se han descrito varias causas como tularemia,
esporotricosis, tuberculosis,
coccidioidomicosis, sífilis e
infecciones virales, aunque la
enfermedad por arañazo de gato
(Bartonella henselae) es la causa
más común del síndrome, se
presenta en aproximadamente
el 3 al 7% de las infecciones y
se cree que se debe a la inocu-
lación en la conjuntiva, la piel
o las membranas mucosas que
ocurre en alrededor del 76% de
pacientes. Caso clínico: femenino de 34 años, quien niega
contacto con animales, así como
antecedentes personales patológicos. Padecimiento actual:
inicia 3 días previos al ingreso
con fiebre no cuantificada, hiperemia conjuntival , sensación
de cuerpo extraño en ojo derecho y epifora, agregándose al
cuadro odinofagía y adenomegalia dolorosa móvil cuello. EF:
eritema conjuntival importante,
con folículos en conjuntiva
tarsal inferior, epifora, edema
peri orbitario ipsilateral que
compromete la apertura ocular, adenomegalia dolorosa en
región cervical anterior de lado
derecho de aproximadamente 2
cm, dolorosa a la palpación de
consistencia blanda. Se inicia
tratamiento con ciprofloxacino,
amoxicilina con clavulanato
y aciclovir. Presenta remisión
progresiva de los síntomas, se
egresa al tercer día por mejoría
clínica. Conclusiones: el síndrome oculoglandular de Parinaud
es una forma de conjuntivitis
granulomatosa poco frecuente,
de etiología infecciosa y multifactorial. Se presenta un caso
de síndrome oculoglandular de
Parinaud en el que no se logró
identificar un agente etiológico
específico con adecuada respuesta al tratamiento.
Piomiositis tropical. Uso de la
resonancia magnética, a propósito de un caso
Ana Margarita García Ortíz,
Juan Carlos Salas Ruiz, Mónica
Arenas Ceja
Hospital Regional ISSSTE, Veracruz
La piomiositis tropical, es una
infección primaria del sistema
musculo esquelético de alta incidencia en regiones tropicales,
con un incremento en el número de casos especialmente
asociada a inmunosupresión. La
forma clásica de presentación
incluye fiebre y dolor muscular sin embrago la integración
diagnóstica no es sencilla por
ello, el uso de auxiliares radiológicos, desempeña un rol
fundamental para el diagnóstico oportuno. Caso clínico:
femenino de 43 años, originaria
de Veracruz, AR hace 5 años.
Acude a Urgencias, tras tres
semanas de evolución con
fiebre de 38.5 grados y dolor
de muslo derecho, sin antecedente traumático. Ingresa con
temperatura de 39°, extremidad
pélvica derecha con aumento
de volumen, hiperemia y masa
blanda, irregular, móvil y dolorosa. Resto de la exploración
física normal. Exámenes de laboratorio con Hb de 12.6 g/dL,
Leu 17,400/mm3, Neu 15,500/
mm3, Linf de 1,100/mm3, Plaq
de 501,000. VSG 60 mm/h,
PCR: +, factor reumatoide +.
Cultivos y prueba de VIH negativos. Ultrasonido doppler:
normal. Gammagrama óseo,
negativo. Anticuerpos anti-CCP
+. Hemocultivo con Staphylococcus aureus. Ecocardiograma
S37
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
trastorácico y transesofágico
normal. La RM muestra en
T2 imagen hiperintensa que
infiltra cuádriceps, se correlaciona con imagen de baja
intensidad en T1 que refuerza
a la aplicación de gadolinio.
Drenaje quirúrgico de 500 cc
de material seroso, con cultivo
Staphylococcus aureus, recibió
linezolid 600 mg cada 12 h
por 21 días, con remisión de la
fiebre y la lesión. Discusión: se
denomina piomiositis primaria
a la infección aguda del musculo estriado, caracterizada
por mionecrosis y formación
de abscesos. Existe un aumento de frecuencia en personas
inmunocomprometidas. Predomina en hombres jóvenes,
entre 30-40 años. La fisiopatología, no está bien clara. El
agente etiológico más común
es Staphylococcus aureus. La
presentación clínica se divide
en tres fases: invasiva, sólo 2%
de los casos se diagnostica en
este estadio, la fase purulenta,
se produce 10-21 después del
inicio; 90% de los pacientes
acude en esta etapa. En la fase
séptica, hay complicaciones
graves y es la más mortal. Los
músculos más afectados son
cuádriceps, glúteos, pectorales
y bíceps. El diagnóstico se realiza mediante cultivo, biopsia o
por imagen. La RM se reconoce
actualmente como el estándar
de oro, porque permite la
identificación precoz de las lesiones, el sitio y tamaño preciso
y el diagnóstico diferencial con
patologías subyacentes.
S38
Leishmaniosis cutánea diseminada con manifestaciones
neurológicas, en un paciente
inmunocomprometido
Francisco Ruiz Pons,1 M Muñoz Campos,2 JM Vasconcelos
Rueda3
1
Médico adscrito al servicio de
Medicina Interna
2
Neurocirujano
3
Médico General
Clínica Santa Elvira, Cunduacán, Tabasco
Introducción: la leishmaniosis constituye un espectro de
enfermedades causadas por
especies del protozoo flagelado
Leishmania. Se manifiesta a nivel cutáneo (cutánea localizada
(LCL), diseminada (LCD), mucocutáneo (LMC) y visceral (LV o
Kala-azar). Sus métodos diagnósticos pueden ser: raspado,
biopsia, impronta; ELISA, IFAT,
inmunofluorescencia directa,
prueba de aglutinación directa.
intradermorreación de Montenegro y PCR. Tratamiento:
meglumina y estibogluconato,
anfotericina B y pentamidina.
Descripción del caso: masculino inicia con náuseas y
vómitos asociado con vértigo, inestabilidad a la marcha,
cefalea holocraneana y deterioro de funciones superiores.
TA160/80, FC70, FR18, Temp.
38oC. Desgaste, Glasgow 14
con paresia de predominio derecho (3/5), compromiso de IV
par craneal izquierdo, nistagmo
horizontal, lesiones lupoideas
algunas ulceradas, polimorficas de diferentes tamaños,
en oreja izquierda, tronco y
extremidades. Hb. 11.6, Leuc.
3,259, Plaq. 112,000, Gluc 88,
Cr 0.9, Na 141, K 3.7, Cl 106,
Elisa VIH positivo, impronta
positiva. Tc: lesión de fosa posterior de predominio vermiano,
que obstruye cuarto ventrículo produciendo hidrocefalia
supratentorial. Evolucionó al
deterioro y 5 días después
falleció. Comentarios: la leishmaniosis produce lesiones
destructivas, incapacitantes,
incluso la muerte. Usualmente
es localizada (LCL); el inmunocompromiso celular (VIH y
trasplantados) tiene injerencia
en la presentación clínica. CD4
<300 cel/mm3 y <50 cel/mm3
se asocian a LV y LCD respectivamente. Su neurotropismo
es poco común; no hay reporte
en México, este caso derivó en
manifestación dermatológica
generalizada, datos viscerales
y manifestación neurológica.
Sólo se reportan casos en la
literatura de la India, Nepal,
Bangladesh y Sudán. Se genera
por contigüidad a senos paranasales en la LMC; también se
presenta disfunción de nervio
craneal y meningitis, sin evidencia franca de lesión en Tc
(nuestro caso presentó hidrocefalia); se ha reportado parálisis
de tipo Guillain-Barré (a causa
de desmielinización). El diagnóstico principalmente es por
PCR de liquido cefalorraquídeo.
Conclusiones: 1) la leishmaniosis se debe poner énfasis en
su prevención y control. 2) El
VIH/SIDA condiciona cambios
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
en su presentación clínica y la
evolución. 3) La manifestaciones neurológicas pueden ser
neuritis, neuropatía periférica,
meningitis e hidrocefalia. 4) Es
evidente la función de la inmunidad celular en control innato
de la leishmaniasis.
Tuberculosis peritoneal simulando adenocarcinoma
mucinoso de ovario. Reporte
de un caso
Israel Sánchez Álvarez, Marisol
Hernández López, Yolanda
Gálvez Molina, Darío Vargas
Torres, Federico William Von
Son De Fernex
Servicio de Medicina Interna,
Hospital General de Cuernavaca Dr. José G. Parres,
Cuernavaca, Morelos
Introducción: la infección pulmonar ocupa la primera causa
de infección por tuberculosis en
el mundo con una incidencia
de 8.6 millones y 1.3 millones
de muertes en el 2012. La tuberculosis pulmonar representa el
80% de los casos mientras que
la tuberculosis extrapulmonar
peritoneal tan solo ocupa el
1 a 3% de los casos siendo
la sexta causa de tuberculosis
extrapulmonar en el mundo.
Caso clínico: femenina de 19
años COMBE negativo. Inicia
15 días previos a su ingreso con
aumento brusco del perímetro
abdominal, astenia, adinamia,
diaforesis nocturna, elevación
térmica no cuantificada, perdida ponderal de 5kg, cambios
en los hábitos intestinales.
Paraclínicos con anemia leve
microcítica, normocrómica,
DHL 499 U/L, prolongación
de los tiempos de coagulación,
VSG 53 mm/h, PCR 114.2
mg/L, elevación de IgG 248.73
U/L, IgM 167 U/L e IgE 309.90
U/L. Se realiza paracentesis
diagnóstica obteniendo líquido
de características exudativas
sin células malignas, tinción
de Gram y Ziehl Neelsen negativas. Rx torax normal, USG
y TAC abdominal reportaron
tumoración septada a nivel de
mesogastrio, flancos, y cavidad
pélvica que involucra útero y
ovarios con aproximadamente
3000cc de volumen. Se realiza
laparotomia exploradora encontrando datos de abdomen
congelado y carcinomatosis y
5000cc de ascitis. Las muestras
de cápsula tumoral, fimbria
izquierda y epiplón reportaron fimbria con congestión y
granulomas caseificantes, epiplón con inflamación crónica
granulomatosa y cápsula de
tejido fibroconectivo sin revestimiento epitelial con extensa
inflamación granulomatosa
compatibles con tuberculosis,
tinción Ziehl Neelsen positiva. Se egreso por mejoría tras
iniciarse tratamiento antituberculoso. Comentarios: la
tuberculosis peritoneal es rara
y suele confundirse con procesos neoplásicos de origen
ovárico, el cuadro clínico puede imitar al cáncer de ovario
debido a sus síntomas vagos y
signos inespecíficos, por ello
es importante tomar en cuenta
dicha entidad como diagnóstico
diferencial ya que el tratamiento
y el pronóstico y tratamiento
difiere de manera importante. Conclusiones: la certeza
diagnostica mediante estudios
histopatológicos es importante
para normar la conducta terapéutica otros estudios con PCR
y ADA pueden orientar hacia la
etiología que en general debe
ser tomada en cuenta en todo
proceso abdominal con ascitis,
dolor abdominal y fiebre.
Falla orgánica múltiple secundaria a fiebre Q: reporte de
caso
María Cristina Moreno del
Castillo, Javier José Hernández
Buen Abad, Fernando Magaña
Campos, Luis Espinosa
Servicio de Medicina Interna,
Centro Médico ABC Campus
Observatorio, México, DF
Reportamos el caso de un paciente masculino de 71 años de
edad originario y residente de
Zitácuaro, Michoacán, que fue
trasladado a nuestro hospital
por cuadro de falla orgánica
múltiple de 10 días de evolución caracterizado en un inicio
como pérdida del estado de
alerta. El paciente cuenta con
antecedente de hipertensión
arterial sistémica, diabetes
mellitus, y cardiopatía isquémica. Se documenta en otra
institución neumonía e infección de vías urinarias cursando
con sepsis grave. Se le inició
en ese entonces cobertura con
imipenem, moxifloxacino y
S39
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
oseltamivir. Posteriormente le
documentan elevación de transaminasas y prolongación de
tiempos de coagulación además
de falla renal aguda que requirió terapia de sustitución renal
con hemodiálisis. A su llegada
al servicio de urgencias de esta
institución se le encuentran
signos vitales con saturación
88%. Clínicamente con cuadro de encefalopatía hepática,
con estudios paraclínicos de
laboratorio con elevación de
transaminasas, hiperbilirrubinemia trombocitopenia en 52 mil.
Además, elevación de azoados,
elevación de enzimas pancreáticas y anemia con leucocitosis
de 19 mil con bandemia. Se
inicia cobertura antibiótica
con Meropenem y linezolid.
Desde un inicio se tuvo la
sospecha de causas infecciosas por lo que se realizaron
cultivos sanguíneos, urinarios
de catéter en los que no hubo
crecimiento y se solicitaron estudios serológicos para diversas
etiologías entre ellas para fiebre
Q, ya que, el paciente contaba
con antecedente de trabajar y
estar en contacto directo con
animales de granja. Durante
su estancia intrahospitalaria
desarrolló como complicación
insuficiencia cardiaca secundaria a miocarditis. A los 10 días
de su ingreso se encuentra con
serología positiva para Coxiella
fase II IgM 1:128 por lo que se
ajusta esquema antimicrobiano
con doxicilcina, posterior a lo
cual presenta mejoría clínica
y bioquímica. Se ajusta trata-
S40
miento antibiótico a doxiciclina
y por mejoría clínica es dado
de alta domiciliaria. Comentario: la infección por Coxiella
burnetti, tiene un componente
epidemiológico importante, en
el caso que se presenta, un interrogatorio dirigido nos ayudó
a revisar los antecedentes y
dilucidar la etiología de la falla
orgánica múltiple, ya que esta
solo se presenta en <1% de los
pacientes con fiebre Q, que al
obtenerse el resultado, se ajustó
el manejo a base de doxiciclina, presentando adecuada
evolución.
Autoinmunidad vs infección en
una paciente con meningitis
aséptica: ¿ANAS útiles o distractor?
Aldo Esteban Torres Ortiz, María Teresa Sánchez Ávila
Departamento de Medicina Interna, Hospital San José Tec de
Monterrey, ITESM, Monterrey,
Nuevo León
Introducción: el diagnóstico de
meningitis aséptica puede llegar
a ser un reto. Los ANAs pueden
ser inducidos por infecciones
por lo que su interpretación
debe tomarse con cautela.
Descripción del caso: femenino
de 32 años originaria de Mty,
sin antecedentes de importancia. Inicia 15 días previos con
cefalea intensa. 7 días después
se agrega fiebre intermitente.
Se ingresa al hospital donde se
documenta ligera cervicalgia y
fiebre, TAC de cráneo normal y
se realiza punción lumbar con
pleocitosis de 457 con 68%
linfocitos, glucosa 61, proteínas
22.6. Tinciones y cultivo son
negativos. Se solicita panel viral
en LCR y se egresa por mejoría
con AINES y esteroides. 24 h
después, la fiebre reinicia hasta
40 ºC por lo que reingresa. Al
examen físico no hay signos
meníngeos y resto de exploración es normal. Rx de tórax es
normal. Presenta leucocitosis
de 14 mil con neutrofilia, VSG
44. Panel viral inicial para
30 virus solo cocksackie 1
débilmente positivo. Se inicia
empíricamente ceftriaxona,
vancomicina, dexametasona.
72 hrs después cae Glasgow
a 4, se toma TAC que revela
hidrocefalia a tensión y zonas
de infarto en ganglios basales.
Se coloca ventriculostomía,
se solicita serología para VIH,
hepatitis B y C que son negativos. En LCR se solicita PCR
para Tb, HSV 1 y 2, IgM e IgG
para borrelia todos negativos.
PPD y coccidioidina negativos.
VDRL sérico es positivo, FTAABS negativo. Se solicita panel
reumatológico que revela ANAS
positivos 1:640 patrón moteado
espicular. Anti Ro, La, DNA
RNP negativos. Anticoagulante
lúpico y anticardiolipinas positivo débil. C3, C4, CH50, p
y c ANCAS negativos. Se hace
diagnóstico de neurolupus y se
pulsa con metilprednisolona,
se inician ciclos de CFM y
posteriormente gamaglobulina. La paciente persiste febril,
se agrega meropenem y antifímicos de manera empírica,
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
pero continúa con datos de
SIRS. Leucocitos caen a 1,700.
Nueva Rxtx presenta infiltrados
micronodulares bilaterales con
deterioro respiratorio, se realiza
lavado broncoalveolar y biopsia
que revela coccidioides y 24
h posteriores cae en choque
séptico y fallece. Conclusiones: sólo se han reportado 10
casos de neurolupus debutando
como meningitis aséptica en el
mundo. La meningitis por cocci
es más compatible con ésta
paciente. Los ANAs son útiles
sólo ante un cuadro altamente
sospechoso, de lo contrario
pueden terminar en un diagnóstico erróneo y mortal.
Tétanos generalizado. A propósito de un caso
Claudia Luna Maya, 1 David
Añorve Clavel,2 Eduardo Cabrera Figueroa2
1
Residente de cuarto año de
Medicina Interna
2
Médico internista adscrito al
servicio de Terapia Intensiva
Hospital General de Acapulco,
Secretaría de Salud, Acapulco,
Guerrero
Introducción: el tétanos es
una enfermedad del sistema
nervioso caracterizada por
espasmos musculares, causada
por Clostridium tetani. Incidencia aproximada: 1 millón
de casos por año en todo el
mundo. Ocurre cuando las
esporas de Clostridium tetani,
ingresan por tejido dañado,
produciendo neurotoxina que
inhibe las neuronas que mo-
dulan los impulsos excitadores
motores, resultando aumento
del tono muscular e inestabilidad autonómica. La mayoría de
pacientes carecen de historial
de inmunización con toxoide
tetánico. Cuatro presentaciones
clínicas: generalizada, local,
cefálica y neonatal. Signos clínicos más frecuentes: trismo,
rigidez cervical, risa sardónica, obstrucción de vía aérea
y opistótono, acompañados
de síntomas de hiperactividad
autonómica. El diagnóstico
suele ser clínico y los objetivos
del tratamiento: Detener la
producción de toxina, control
de espasmos musculares y
disautonomías, proporcionar
medidas generales de sostén.
Caso clínico: masculino de
63 años, inmunización incompleta con toxoide tetánico,
5 días previos a su ingreso
sufre herida en planta de pie
derecho con clavo oxidado,
tres días después presentando
datos de inflamación local y
trismo acudiendo a nuestra
unidad, donde ingresa con
tetania generalizada, posición
de opistótonos frente a mínimos
estímulos, proporcionándose
VMI por disnea. Ingresó a la
UCI cursando con disautonomías y tetania requiriendo
sedación, relajantes musculares, inmunoglobulina humana
antitetánica, toxoide tetánico y
penicilina G, lográndose en la
cuarta semana, retiro de sedación y relajante muscular sin
evidencia de tetania y destete
ventilatorio, con posterior egre-
so. Comentarios: el tétanos es
considerado infrecuente en el
mundo desarrollado, sin embargo sigue siendo una amenaza
para toda persona no vacunada,
especialmente en países en
vías de desarrollo, por lo que
la inmunización y tratamiento
adecuado de heridas y lesiones
traumáticas son cruciales. La
evolución del caso presentado
es compatible con la descripción clásica de tétanos grave,
ya que tiene el antecedente de
herida contaminada, sin adecuada inmunización, tiempo
de incubación corto y clínica
representativa, afortunadamente la evolución fue favorable.
Conclusiones: en nuestro medio seguimos teniendo casos
potencialmente mortales de
tétanos, por lo que es importante la sospecha y conocimiento
de la patología siendo de vital
importancia considerar la relevancia que tienen los programas
preventivos.
Nefritis tubulointersticial aguda
secundaria a virus de inmunodeficiencia humana
XL Alvarado-Sánchez,1 JA ReyesLoaeza,2 G Pérez-Bustamante,1
J Canseco-González2
1
Servicio de Medicina Interna
2
Servicio de Nefrología
Hospital Regional de Alta Especialidad de Oaxaca, Oaxaca de
Juárez, Oaxaca
Introducción: la nefritis tubulointersticial aguda (NTIA) es
una causa subdiagnosticada de
lesión renal aguda. La etiología
S41
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
obedece en su mayoría a fármacos pero también a infecciones
y enfermedades sistémicas.
Descripción: mujer de 45 años.
Inició el 28 de enero de 2014
con disminución del volumen
urinario y edema periférico. Fue
referida al hospital de Puerto
Escondido donde documentaron creatinina de 3.07 mg/dL,
nitrógeno ureico (BUN) de 67
mg/dl, proteinuria, eritrocituria
y cilindruria al azar y ELISA
para virus de inmunodeficiencia humana (VIH) reactivo. A
su ingreso al Hospital Regional
de Alta Especialidad de Oaxaca, el 10 de febrero, resaltaba
en la exploración física edema
+++ en miembros inferiores
y mucosas subhidratadas; se
obtuvo creatinina sérica de 5.5
mg/dL, BUN de 63 mg/dL, tasa
de filtrado glomerular calculada
en 9 ml/min, sodio urinario en
15 mmol/L y fracción excretada
de sodio en 0.74%. Se inició
reto con líquidos parenterales
durante 24 horas y se documentó uresis de 230 ml/día;
se administró un bolo de 100
mg de furosemide, sin efecto.
Los paraclínicos reportaron:
ultrasonografía renal sin alteraciones; acidosis metabólica de
anion gap elevado, proteinuria
de 6.4 g/día y 5% de eosinófilos
urinarios. El 12 de febrero inició
hemodiálisis (HD) por anuria
y acidosis persistente, el 14
de febrero se practicó biopsia
renal percutánea, la cual reveló
NTIA. Inició tratamiento con
esteroide con nula respuesta y
más tarde terapia antirretroviral
S42
altamente activa, tras lo cual
presentó mejoría progresiva
de la función renal que finalmente permitió descontinuar
la hemodiálisis. Comentarios:
presentamos el caso de una
paciente con manifestaciones
poco comunes de NTIA como
proteinuria nefrótica, sin exposición previa a AINES u otros
fármacos y VIH como único
agente causal documentado. Se
iniciaron esteroides como tratamiento por ausencia de fibrosis
en la biopsia, sin embargo la
mejoría franca de la función
renal se documentó tras iniciar
la terapia antirretroviral, por
lo que se deduce que la causa
precipitante fue el VIH. Conclusión: la proteinuria nefrótica se
presenta en un 2.5% de los casos de NTIA. La biopsia renal es
el estándar de oro para el diagnóstico. El tratamiento consiste
en descontinuar la exposición
al agente nocivo, medidas de
soporte y esteroides, con bajo
nivel de evidencia. El fracaso
renal agudo por NTIA representa el 5% en pacientes con VIH.
Neuroborreliosis con parálisis
del VI y VII nervios craneales.
Caso clínico
Verónica Leonor Bracamonte
Curiel, David Joel Guerrero Vázquez, Luis Javier Jara Quezada,
José de Jesús Peralta Romero
Centro Médico Nacional La
Raza, IMSS, México, DF
Hospital General Regional
núm. 25, IMSS, México, DF
Centro Médico Nacional Siglo
XXI, IMSS, México, DF
Introducción: la neuroborreliosis es la enfermedad transmitida
por vector más frecuente de
Estados Unidos y Europa. En
México en 1999 se detectó una
prevalencia de infección por
mordedura de garrapatas (género Ixodes) y su agente causal
Borrelia burgdorferi del 1.1%
en la población general, su reservorio más común el venado
cola blanca fue del 3% en el
noreste del país. En 2003 la seroprevalencia de B. burgdorferi
en la población del noreste de
la República Mexicana fue del
6.3% y el Distrito Federal fue
de 3.43%. La neuropatía craneal
(parálisis periférica del VII par
craneal) se presenta en 25 a 50%
de casos, puede ser bilateral y
acompañarse de parálisis del
III, IV, V y VI nervios craneales.
Descripción del caso: hombre
de 23 años sin antecedentes de
importancia. Inicia su padecimiento posterior al acampar en
sureste montañoso de Canadá y
estar en contacto con venados
hace 4 meses. Dos semanas
posteriores al viaje inicia con
cefalea temporal izquierda,
opresiva 10/10 y una semana
posterior presencia de parálisis
del VI nervio craneal izquierdo,
manejado con esteroide y adecuada respuesta a tratamiento.
Dos meses posteriores inicia
nuevamente con cefalea en
zona temporal derecha, parálisis
del VI nervio craneal derecho
y parálisis periférica del VII
nervio craneal derecho. A la
exploración funciones mentales
conservadas, parálisis del VI
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
nervio derecho con limitación
para abducción ocular derecha,
asimetría facial en reposo y a la
gesticulación, disminución de
los pliegues frontales y pliegue
nasogeniano derecho y desviación de la comisura labial
hacia la izquierda. Estudio de
líquido cefalorraquídeo y resonancia magnética nuclear de
encéfalo sin alteraciones. SPECT
cerebral reporta hipoperfusión
frontal izquierda. ELISA para
VIH negativo. Western Blot,
IgG positivo para B. bugdorferi
en líquido cefalorraquídeo y
suero. Se maneja como neuroborreliosis con afección de
nervios craneales. Se comienza
con cetfriaxona intravenosa por
14 días remitiendo parálisis del
VI. Comentarios: el tratamiento
con antibioticoterapia tiene por
objetivo aliviar los síntomas y
prevenir las secuelas. Conclusiones: es necesario identificar
probables casos y confirmar
diagnostico apoyado por ELISA
y western blot. La presencia de
garrapatas Ixodes y Amblyomma
infectadas en el noreste y centro
de México representa un riesgo
de transmisión de B. burgdorferi
al humano.
Colitis pseudomembranosa
en paciente sin enfermedades
crónicas previas, no asociada
con clindamicina
Antonio Cruz Estrada, Diana
Castellanos Rodríguez, Johanna Elizabeth Paredes Sánchez,
Alicia Elizabeth Navarro Estrada
Hospital General de México Dr.
Eduardo Liceaga, México, DF
Introducción: C difficile, bacilo
anaerobio grampositivo causa
30% de diarreas asociadas a
antimicrobianos. Cuando se
altera la microbiota intestinal,
esporas de C. difficile germinan,
colonizan el tracto gastrointestinal y producen toxinas
generando inflamación y daño
al epitelio intestinal. Son patógenas las cepas productoras de
enterotoxina A y citotoxina B.
Factores de riesgo: edad avanzada, inmunosupresión, cirugía
gastrointestinal, quimioterapia,
tratamiento con clindamicina,
quinolonas y cefalosporinas
capaces de modificar la microbiota intestinal. Descripción del
caso: masculino 56 años, sin enfermedades crónicas, con sepsis
grave por pielonefritis, inició
terapia con aminoglucósidos
8 días. Desarrolló neumonía
nosocomial tratada con piperazilina/tazobactam 7 días
y posteriormente bacteremia
demostrada por hemocultivos
con E. coli BLEE tratada con
ertapenem 9 días. Al terminar
antimicrobianos, con fiebre
>38.5°C, dolor y distención
abdominal, más de 5 evacuaciones diarreicas en 24 horas,
leucocitosis 26,700 y sepsis
grave. Coprológico con leucocitos y sangre oculta en heces.
Tomografía abdominal con distensión de todos los segmentos
del colon y adelgazamiento de
la mucosa. Colonoscopia con
edema y eritema de la mucosa,
placas amarillentas adheridas a ella que se desprenden.
Toxina A y B positiva en heces.
Inició vancomicina por sonda
nasogástrica (125mg cada 6
horas por 10 días), con evolución favorable. Comentarios:
paciente con colitis pseudomembranosa por C. difficile con
exposición a antimicrobianos,
todos intravenosos, sin uso de
clindamicina ni cefalosporinas.
Con criterios de gravedad, estadificándolo en un alto riesgo
de mortalidad, pero con buena
respuesta al tratamiento. Con
riesgo de recaídas en 1 a 5
semanas mayor al 20%. Sin
datos de la enfermedad a los
5 meses posteriores al diagnóstico. Conclusiones: dada
la gravedad y alto riesgo para
la vida, en todo paciente con
exposición a antimicrobianos
(orales o intravenosos) que inicie con diarrea, es importante la
sospecha diagnóstica, para así
ofrecer un tratamiento oportuno
y evitar las complicaciones. Su
incidencia en pacientes hospitalizados es cada vez mayor,
por lo que se considera necesario implantar una política de
uso racional de antibióticos y
establecer las medidas necesarias al detectarse un caso, para
prevenir su contagio.
Mucormicosis en un paciente
sin factores de riesgo
Melissa Guadalupe Rodríguez
González, Zeithel Kareli Verdugo Zazueta, Miriam Tamara
Matus Román, Carlos Alberto
Kawano Soto
Servicio de Medicina Interna
del Hospital Civil de Culiacán,
Culiacán, Sinaloa
S43
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Introducción: la mucormicosis
es una infección oportunista,
causada por hongos zygomicetos del orden de los mucorales,
es la tercera micosis invasiva
más común. Representa del 8.3
al 17% de todas las micosis.
La mortalidad y morbilidad es
grave. Se clasifica de acuerdo
al sitio anatómico como sinusal, rinocerebral, pulmonar,
cutánea, gastrointestinal, diseminado y lesiones viscerales
profundas solitarias extrapulmonares. Las comorbilidades
subyacentes son determinantes
en la presentación clínica y el
pronóstico de la mucormicosis
invasiva, siendo su presentación
más prevalente en pacientes
con diabetes mellitus (hasta
33%). La infección diseminada se desarrolla hasta en un
23% de los casos, con una
tasa de mortalidad del 96%.
Para esta infección micótica el
tratamiento de elección es la
anfotericina. Descripción del
caso: masculino de 50 años
de edad, sin comorbilidades,
recolector de guano, ingresó
luego de referir cuadro febril de
7 días de evolución, acompañado de mioartralgias, cefalea
y disnea progresiva hasta la
ortopnea. Bajo el diagnóstico
de neumonía atípica inició
antimicrobiano y antiviral, y
debido a su evolución tórpida
requirió ventilación mecánica. Posteriormente, con falla
multiorgánica (hepática, renal,
hemodinámica), iniciando terapia de sustitución renal y
aminas vasoactivas para sopor-
S44
te. Presentó opacidad corneal
y equimosis frontonasal que
progresó a necrosis, además
de hundimiento en globos
oculares y depresión de tabique
nasal, por lo que se realizó
tomografía de cráneo y senos
paranasales, posteriormente
se realizó biopsia de mucosa
nasal, y se instauró manejo
con anfotericina por sospecha
de mucormicosis. La biopsia
reportó hifas de paredes gruesas compatibles con Mucor
spp. Sin embargo, persiste con
deterioro clínico y fallece el día
21 de estancia intrahospitalaria.
Comentarios y Conclusiones:
a pesar de ser una infección
micótica reconocida hace más
de dos siglos, aún sigue siendo
difícil su manejo, debido a que
su presentación es más frecuente
en pacientes inmunocomprometidos y a la alta mortalidad
(hasta 96%) registrada en formas
diseminadas. Reportamos una infección oportunista localizada a
nivel rinosinusal en un individuo
inmunocompetente, probablemente condicionada por su
estado crítico, así como el uso de
antibióticos de amplio espectro,
favoreciéndose la presentación y
diseminación de la micosis, con
una evolución fulminante.
Neurosífilis y polineuropatía
inflamatoria desmielinizante
crónica en paciente con VIH
Tannya Velázquez Gaspar, José
Nazario López Taboada, Juan
Ramón García Díaz, José Octavio Duarte Flores, Dalia María
Dueñas Tamayo
Servicio de Medicina Interna,
Hospital General de Zona 48,
Instituto Mexicano del Seguro
Social, México, DF
Introducción: la manifestación
neurooftalmológica como la
pupila de Argyll-Robertson
es común en etapas tardías
de sífilis. La polineuropatía
inflamatoria desmielinizante
(PID) se puede presentar en
forma aguda o crónica siendo
la complicación neurológica
mas frecuente en el VIH. Resumen: masculino de 49 años,
sin antecedentes patológicos.
Inicia un año previo con debilidad de miembros inferiores,
se agregan parestesias distales
con alteraciones en la sensibilidad de manera ascendente,
evoluciona con imposibilidad
para la marcha, posteriormente percibe parestesias en
miembros torácicos de manera
bilateral. A su ingreso se encuentra integro con palidez,
caquéctico, EFNL: funciones
mentales conservadas, NC;
NCII agudeza visual OD 20/70,
OI 20/70, fondo de ojo con
papila pálida de bordes bien
delimitados. III, IV, VI; Pupilas
isométricas 6mm con pupila
de Argyll Robertson bilateral.
Sistema motor: hipotonía e
hipotrofia generalizada, fuerza
3/5 generalizada, reflejos de
estiramiento muscular 0/++++
generalizado. Sensibilidad
superficial mal sistematizada,
sensibilidad profunda ausente,
marcha tabética. Paraclínicos:
Gluc 128, Cr 1.0, Na 135, K
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
4.1, Hgb 10.3, Leuc 4.9, Pqt
320. LCR: Gluc 53.0, LDH 36,
PT. 120 mg/dl, leuc 15 mm3.
IgM CMV 0.28, IgM Herpes
<0.50, IgM rubeola 0.1, Anti
HCV 0.05, Anti HBc 0.09, Ag
HBs 0.17, PCR VIH 132 000
Copias, Linfocitos CD4 41
cel/mcl, VDRL 1:128, VDRL
en LCR 1:16, FTA-ABS 29.1
positivo, APE, ACE, Ca 19.9
negativos. BAAR negativo,
Electromiografía: neuropatía
motora con degeneración axonal severa y desmielinización
segmentaria. TAC de cráneo y
columna normal. Conclusión:
el compromiso del SNC por
Treponema pallidum es más
frecuente en pacientes con
VIH, por lo que ante manifestaciones clínicas como la
pupila de Argyll-Robertson el
diagnóstico debe de ser buscado de manera dirigida. CIDP se
ha asociado con enfermedades
infecciosas como VIH, está
inversamente relacionada con
el conteo de CD4, por lo que
se produce en un contexto de
conserva de recuento de CD4,
VIH sigue siendo uno de los
factores de riesgo mas importantes en todo el mundo para
el desarrollo de neuropatías.
Absceso pulmonar por Kocuria
varians en paciente inmunocomprometido
Alberto Suárez Zaizar,1 S Fonseca Martínez,2 J Carrizales Luna,3
J Paredes Vázquez,4 L Lunares
Dueñas,5 G López Bernal6
1
Residente de segundo año de
Medicina Interna
Residente de segundo año de
Medicina Interna, Programa del
Multicén
TEC Salud, Hospital Metropolitano Dr. Bernardo Sepúlveda,
Departamento de Medicina Interna, San Nicolás, Nuevo León
2
I nt r o d u cci ó n: l o s a b s c e sos pulmonares suelen
presentarse en pacientes inmunocomprometidos o con
riesgo de broncoaspiración; teniendo alta mortalidad. Kocuria
varians, coco gram (+), estrictamente aerobio, formado por 18
especies, 5 de ellas causantes
de infecciones en humanos:
Kocuria rosea, K. kristinae, K.
varians, K. palustris y K. rhizophila. Son considerados como
patógenos emergentes en inmunocomprometidos. Sólo existen
reportes de casos de abscesos
intracraneales, aunque su incidencia está subestimada.
Descripción del caso: se trata
de un paciente masculino de 25
años de edad, con historia de
tabaquismo y etilismo intenso,
toxicómano y con prácticas
sexuales de riesgo, que acude
por presentar ataque al estado
general, disnea de medianos
esfuerzos, tos productiva, dolor
torácico tipo pleurítico, pérdida
de peso y fiebre de predominio
nocturno en los últimos 4 meses. A su ingreso con criterios
de sepsis. Abordaje diagnóstico
con sospecha de broncoaspiración a descartar tuberculosis
pulmonar por área endémica.
Rx postero-anterior y lateral
de tórax con radiopacidad en
lóbulo medio de pulmón derecho con nivel hidroaéreo,
sugestivo de absceso pulmonar. Se solicitan baciloscopías
seriadas con resultado negativo; y previo consentimiento
informado se realiza prueba de
ELISA para VIH con resultado:
Positivo, corroborado posteriormente por Western-blot.
Se inicia antibioticoterapia
cubriendo flora polimicrobiana con pobre mejoría clínica.
Se toman hemocultivos y se
decide drenaje percutáneo de
absceso pulmonar para estudio
microbiológico. Tanto los hemocultivos como la secreción
de absceso reportaron: Kocuria
varians. Se cambia antibiótico a
Vancomicina, logrando mejoría
clínica y egresando al paciente
para continuar con vigilancia
en el Centro Ambulatorio de
Prevención y Atención en SIDA
e ITS (CAPASITS). Comentarios:
los reportes de caso clínicos por
Kocuria varians en pacientes
inmunocomprometidos son
pocos, ninguno relacionado
con sepsis secundaria a absceso pulmonar. En este paciente
el drenaje del absceso ayudó
al diagnóstico y tratamiento.
Conclusiones: el 11-20% de
los abscesos pulmonares no
mostrarán mejoría con la antibioticoterapia empírica, por lo
que requerirán de drenaje percutáneo. No hay guías clínicas
para el manejo de la infección
por Kocuria varians, se refiere
en la literatura utilizar la susceptibilidad conocida para el
Staphylococcus spp.
S45
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Fiebre de origen desconocido
por citomegalovirus
Mario Alberto García Esquivel,
Hiram Vela, Carlos Lenin Pliego,
Martín Peña Collazo
Medicina Interna, Hospital Regional Licenciado Adolfo López
Mateos, ISSSTE, México, DF
El síndrome mononucleósico
es un conjunto de síntomas y
signos, que responden a variadas etiologías, caracterizado
por cuatro manifestaciones
clínicas: fiebre, faringitis, poliadenoesplenomegalia y erupción
cutánea y un elemento paraclínico: leucocitosis mononuclear
con linfocitosis atípica. Las
manifestaciones clínicas anteriormente mencionadas
no siempre están presentes,
siendo el criterio diagnóstico
fundamental la presencia de
más de 50% de células mononucleares. Descripción del
caso: masculino de 50 años,
paramédico. Índice tabáquico
15. Niega alcoholismo y toxicomanías. Diabetes mellitus
2 de 5 años de diagnóstico.
Acude a urgencias con Fiebre,
vespertina, diaforesis nocturna
y perdida de peso de 1 mes de
evolución. A su ingreso destaca
ausencia de piezas dentales,
de adenopatía cervical anterior derecha de 2 cm, movible
no dolorosa, abdomen con
maculas violáceas irregulares,
hepatoesplenomegalia resto sin
alteración, laboratorios con Hb
10.9 Htco 32.2, VCM 76.29,
HCM 25.7, Leucocitos 13.7,
linfocitos 9.10%, TGO 49 TGP
S46
98, DHL 881. Radiografía de
tórax sin alteraciones. Durante
estancia hospitalaria paciente
que se diagnostica con fiebre
de origen desconocido. Endoscopia alta y baja sin sangrado,
BAAR negativo, frotis de sangre
periférica, linfocitos 10%, marcadores tumorales negativos,
VIH , VHC,VHB negativo IgG
CMV 139, IgM 29.6, VSG 29 ,
PCR 72 VDRL negativo , perfil
reumatológico negativo, PCR
para Tb y Epstein Barr negativos, anticuerpos heterofilos
negativo. Paciente que presenta
elevación de aminotransferasas,
TGO 148, TGP 75, FA 321, GGT
468. TAC : hepatoesplenomegalia ,y ganglios mediastinales y
axilares, de aspecto benigno.
PCR para CMV el cual reporto 124 copias/mL. Se inicia
tratamiento con ganciclovir
obteniendo respuesta clínica en
48 h. Conclusiones: se trata de
paciente que por antecedentes
de importancia contaba con
factores de inmunosupresión así
como actividad laboral de riesgo con fiebre de larga evolución
y un síndrome mononucleósido
“like” por lo que la intención
del abordaje era llegar a causa
precipitante de síndrome mononucleósico, se obtuvo en una
primera instancia negatividad
para virus de Eipstein Barr por lo
que continuamos protocolo con
la búsqueda intencionada de
CMV l sin antes descartar otras
posible causas que originaran la
fiebre , se pudo realizar el diagnóstico de manera oportuna y
el paciente pudo ser egresado,
con control de forma ambulatoria y sin complicaciones.
Reporte de caso: Rickettsiosis
José Antonio Espino Moreno,1
José Ángel Ramírez Rodríguez,2
José Luis Pacheco Hernández3
1
Residente de tercer año de
Medicina Interna
2
Jefe de Servicio de Medicina
Interna
3
Médico de Base de Unidad de
Terapia Intensiva
Hospital Universitario Saltillo,
Ciudad Saltillo, Coahuila
Introducción: bacterias de la
familia Rickettsiaceae, intracelular obligada, cocobacilos,
Gram (-), trasmitido por la
picadura de artrópodo (Rhipicephalus sanguineus). Se
multiplica en células endoteliaes de vasos sanguíneos,
causan necrosis y aumento de
la permeabilidad capilar. Periodo de incubación de 7 a 14
días. Los principales factores de
riesgo son contacto con áreas
endémicas, rara vez se confirma
el contacto con el vector. Presentacion del caso: masculino
de 59 años, residente de Ramos
Arizpe, Coahuila, trabajador
de limpieza pública, zoonosis
de 3 perros, tabaquismo 3 paq/
año, diabetes mellitus 2 de 10
años, control irregular. Inicio 3
días previos a su ingreso con
dolor abdominal en epigastrio
e HCD, intensidad 6/10, acompañado de náuseas y vomito.
Se agrega astenia, adinamia,
mialgias, artralgias, hiporexia
e ictericia. Fiebre no cuantifi-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
cada refractaria a tratamiento,
marcha atáxica, paraparesias,
visión borrosa. Valoración inicial con SRIS sin foco infeccioso
aparente. Piel con maculas bien
definidas en tórax, fuerza 3/5,
distres respiratorio, no se integra síndrome pleuropulmonar.
Dolor a la palpación media
y profunda de marco colonico, no irritación peritoneal,
llenado capilar de 3 segundos. Hiponatremia, anemia,
bandemia, trombocitopenia,
hiperazoaemia, hipertransaminasemia, prolongación de
tiempos de coagulación, hiperbilirrubinemia directa. Se
agrega deterioro neurológico y
ventilatorios, requiriendo VM
ACV, presentando choque refractario, bradicardia y asistolia,
declarando su defunción 24 h
posteriores a su internamiento.
Se reportan PCR de sangre total
positivo para Rickettsias spp.
Comentario: la evolución tan
rápida de paciente se presenta
en un porcentaje mínimo en
esta patología, siendo lo más
común la afección leve y autolimitada caracterizada por
dolor abdominal fiebre y conjuntivitis. La terapia de soporte y
prevención de complicaciones
es prioritario así como el tratamiento antibiótico una vez
establecida la patología. En los
casos severos la evolución es
tórpida y en su gran mayoría la
defunción es inevitable. Conclusiones: esta enfermedad se
presenta de forma emergente y
el aumento presentaciones letales en nuestro medio requiere
una sospecha clínica oportuna
y conocimiento de la población
sobre los síntomas iniciales para
evitar presentaciones letales y
dar tratamiento específico.
Abscesos hepáticos tuberculosos como presentación
infrecuente de tuberculosis
extrapulmonar. Reporte de
un caso
Sandra Ivet Domínguez Valdez,
Estrellita Cortez Carrera, Flor
Elena Rojas Terrazas, Ulises
Emmanuel Guadalupe Mouret
Hernández, Fernando Villalobos
Guerrero, Ivonne García López,
Rocío Mendoza Chávez
Servicio de Medicina Interna,
Hospital de Especialidades de la
Cuidad de México Dr. Belisario
Domínguez, Secretaría de Salud
del Distrito Federal, México, DF
El absceso o abscesos hepáticos
tuberculosos es una patología
infrecuente y rara de tuberculosis extrapulmonar, aparece
en el 0.34% de los casos de
tuberculosis hepática, la forma
de presentación mas común es
granulomatosa, existen reportes
nacionales de los casos nuevos
de tuberculosis con 11% de
localización extrapulmonar, sin
embargo no hay reportes de presentación hepática. La literatura
internacional reporta mayor incidencia en Asia. Femenino de
16 años, en condiciones de higiene y alimentación deficiente.
Inicio con dolor abdominal en
hipocondrio derecho y fiebre,
automedicándose sin mejoría,
acudió a nuestro nosocomio
con exacerbación del cuadro,
agregándose, taquicardia e
hipotensión, se realiza ultrasonido (USG) con presencia
de hepatoesplenomegalia y 2
lesiones redondeadas en hígado de 6.7x7.0 y 5.0x4.3cm sin
vascularidad, compatible con
abscesos hepáticos, recibió
manejo con triple esquema
antimicrobiano, persistió con
fiebre, leucocitosis y neutrofilia,
se realiza segundo USG abdominal de control reportando,
parénquima hepático con 2
lesiones mal delimitadas con
aumento de tamaño respecto
al estudio previo, se solicitó
serología amebiana y hemocultivos siendo negativos, se
descartó infección por virus de
inmunodeficiencia adquirida,
se escaló esquema antimicrobiano sin respuesta clínica. Se
realizó tomografía axial computada (TAC) abdominal que
evidencio derrame pleural derecho y múltiples colecciones
hepáticas, la evolución ulterior
fue tórpida, presentando disnea
e hipoxemia, por lo que se
realizó toracocentesis evacuando material serohemático, el
citoquímico e histopatológico
reportó exudado con abundantes linfocitos, se practicó
reacción en cadena de polimerasa y adenosina desamina
que fueron positivos para tuberculosis, se inició manejo
antifímico. Presentó mejoría clínica a los 15 días, los estudios
radiológicos con disminución
del tamaño de las lesiones descritas a las 30 días. El cultivo
S47
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
confirmo presencia de Mycobacterium tuberculosis. Se dio
seguimiento con remisión del
cuadro clínico a los 4 meses.
La presentación de absceso hepático tuberculoso es difícil de
distinguir de absceso hepático
piógeno o amebiano. El 80%
de los casos presentan afección a otros órganos, en este
caso inicialmente sin afección
pulmonar, posteriormente se
complicó con derrame pleural,
las características bioquímicas
de éste llevaron al diagnóstico
etiológico y con ello se pudo
iniciar tratamiento específico.
Micetoma torácico con afección visceral: Presentación de
un caso clínico
Diana Sarai López González,
Karina Teresita González Rodríguez, Ulises Hernández
Rolon, Leticia Ramírez García,
Enrique Rodríguez Franco, Luis
Javier Castro D´ Franchis, Dulce
Valeria Copca Nieto, Dinorah
Alemán Domínguez, Maricarmen Lagunas Alvarado
Hospital Regional Petróleos
Mexicanos, Poza Rica, Veracruz
Introducción: el micetoma es
una lesión inflamatoria crónica,
granulomatosa de piel y tejido
celular subcutáneo causada por
actinomicetos en el 90% y eumicetos en el 10%. Inicialmente
es indoloro lesionando piel,
partes blandas y posteriormente
hueso. Las extremidades inferiores se afectan en 70%, tórax
14%, extremidades superiores
11% y 5% cabeza. El micetoma
S48
torácico con afección visceral
tiene baja prevalencia en México. Descripción del caso:
masculino de 45 años, originario y residente de Veracruz, con
presencia de lesiones dérmicas
nodulares en tórax posterior,
secreción seropurulenta desde
hace 5 años y tratamiento inespecífico. Acude por cuadro de
3 semanas de evolución con
disnea, fiebre, diaforesis de predominio vespertino y pérdida
de 16 kg en un año. Tomografía
de tórax con lesiones en región
dorsolumbar de aspecto líquido
con reacción inflamatoria perilesional, colecciones pleurales
bibasales encapsuladas de pared gruesa con reforzamiento
al medio de contraste. Biopsia
de piel con gránulos azurófilos
compatibles con micetoma
y cultivo con Actinomyces.
Tratado inicialmente con imipenem, Amikacina, dapsona y
trimetoprim/sulfametoxazol. A
los 4 meses presenta afección
visceral con conglomerado de
abscesos confluentes en región
raquimedular a nivel L3-L4, se
agrega amoxicilina/clavulanato. Actualmente tratamiento
con dapsona y trimetoprim/
sulfametoxazol con evolución favorable de las lesiones
pulmonares. Comentarios: el
micetoma torácico desarrolla
enfermedad diseminada con
afección al sistema nervioso
central en un 28-50%, complicándose hasta en un 40%
con abscesos cerebrales. La
capacidad de penetración y
osteólisis de los agentes del mi-
cetoma cobran importancia en
localizaciones como la espalda
por su invasión a las vértebras,
con destrucción y compresión
medular, fenómenos parapléjicos, severas complicaciones
y muerte. La mayor parte de
los casos responde satisfactoriamente a combinaciones con
trimetropim/sulfametoxazol y
Diaminodifenilsulfona. Para
las localizaciones de mal pronóstico, daño óseo o visceral se
debe agregar amikacina, amoxicilina/clavulanato e imipenem.
El micetoma diseminado tiene una mortalidad del 44%,
incrementándose en inmunocomprometidos al 85%.
Conclusiones: el micetoma
torácico con afección visceral presenta una evolución
insidiosa con complicaciones
letales por lo que es importante establecer un diagnostico y
tratamiento oportuno.
Tularemia ulceroglandular:
reporte de caso
Juan Carlos Lara Castañeda,
Daniel Iván Arroyo Espinosa,
Ernesto Eduardo Echeagaray
Guerrero, Rodrigo Torres Baranda
Unidad Medica de Alta Especialidad, Centro Médico
Nacional de Occidente del
Instituto Mexicano del Seguro
Social, Guadalajara, Jalisco
Introducción: tularemia, infección causada por el agente
Francisella tularensis, se ha
convertido en un problema de
salud pública debido a su alto
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
potencial infeccioso y mortalidad, por lo que el aumento en
su vigilancia epidemiológica
ha contribuido a identificar
mejor la aparición continua de
infecciones naturales en todo
el mundo. Descripción del
caso: hombre de 17 años de
edad que el 9 de mayo de 2014
fue mordido por garrapatas en
ambos muslos y dorso del pie izquierdo. 2 días después presentó
fiebre de 39°C, astenia, disnea,
vómito y dolor epigástrico que
continuaron 7 días. Presentó
anuria y se trasladó al HGZ #10
en Manzanillo. Tuvo agitación
psicomotriz e insuficiencia
respiratoria aguda requiriendo
ventilación mecánica. Requirió
hemodiálisis y aminas vasoactivas. Se le tomó biopsia de piel
de la pierna derecha donde fue
mordido y el 24 de mayo ingresó a Infectología de CMNO
encontrándose hepatomegalia
de 4x4x4 cm, adenomegalias
induradas y móviles en región
inguinal bilateral de 1.5 cm de
diámetro, axilares de 1.5 cm,
epitroclear izquierdo de 10x6
cm, región poplítea derecha de
2x2 cm. Úlceras cutáneas en
sitios de inoculación, de bordes
elevados y eritematosos con
centro necrótico: occipital de
7x7 cm, parte interna de pierna
derecha en número de 3 y de
0.7 cm, maléolos externos de
4x3 cm, dorso externo de ambos
pies de 2x2 cm, talones de 5x3
cm. Se inició Estreptomicina 1
gr intravenoso cada 24 horas. El
10 de junio se obtuvo biopsia de
piel: infiltrado inflamatorio de
linfocitos y polimorfonucleares;
tinción de gram: Colonias bacterianas bacilares gramnegativas
compatibles con Francisella tularensis. Reacción en cadena de
la polimerasa de nueva biopsia
de piel: positiva para Francisella
tularensis. Comentario: a pesar
de la preocupación por el uso
de Francisella tularensis como
arma biológica en la actualidad,
no es frecuente encontrar tularemia ulceroglandular por lo que
este caso típico representa una
oportunidad para identificar sus
manifestaciones y el tratamiento
adecuado. En este caso se utilizó
el tratamiento de primera línea
por 3 semanas, con remisión
de fiebre, lesiones cutáneas
y adenopatías. Fue egresado
a continuar vida productiva.
Conclusión: las consecuencias
clínicas dependen de la virulencia del microorganismo, su
extensión y la inmunidad del
huésped por lo que es imprescindible el diagnóstico oportuno
logrado con PCR y el comienzo
de la antibioticoterapia para un
mejor pronóstico.
Abscesos cerebrales por Listeria monocytogenes: reporte
de caso y revisión de literatura
Antonio Jordan-Ríos, 1 Paola
Estefanía Bermúdez-Bermejo,1
Laura Elena Jáuregui-Camargo,2
Marco Antonio Alegría-Loyola3
1
Residente de Medicina Interna
2
Servicio de Medicina Interna
e Infectología
3
Servicio de Neurología
Centro Médico ABC, México,
DF
Introducción: Listeria monocytogenes, como infección del
sistema nervioso central (SNC)
ha sido reportada en pacientes
inmunocomprometidos. Diabetes mellitus es factor de riesgo
para contraer la infección. Su
presentación se manifiesta
como meningitis y en menor
frecuencia como absceso. El
cuadro clínico con abscesos cerebrales múltiples ha sido poco
reportado. Presentamos el caso
de un paciente diabético, con
abscesos cerebrales múltiples
por Listeria monocytogenes.
Descripción del caso: Hombre
de 79 años de edad, diabético
tipo 2. Quince días previos
a su internamiento presentó
crisis parcial simple motora
del miembro pélvico izquierdo
y bradilalia. A su ingreso con
signos vitales normales. Exploración física con parálisis facial
central izquierda, hemiparesia
fasciocorporal ipsilateral e
hiperreflexia. El precordio
rítmico sin soplos agregados.
Resto de la exploración normal.
Se inició protocolo de estudio
destacando 11,200 leucocitos,
glicemia 84 mg/dL, proteína C
reactiva 5.61, VIH negativo.
Punción lumbar: de aspecto
turbio, pH 8.0, eritrocitos 1300
y leucocitos 735 a expensas
de polimorfonucleares (75%),
glucosa 29 mg/dL, proteínas
86 mg/dL. Los cultivos del LCR
fueron negativos. La resonancia
magnética mostró múltiples
lesiones ovoidales con realce
periférico en la región parietal
derecha. Se administró vanco-
S49
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
micina, ceftriaxona, ampicilina,
metronidazol y aciclovir. Dos
días después se documentó
Listeria monocytogenes en
hemocultivos tomados a su
ingreso ajustando cobertura
con ampicilina y gentamicina.
Su evolución clínica fue hacia
la mejoría neurológica recuperando ad integrum estado
neurológico basal. Comentario: Listeria monocytogenes es
un microorganismo colonizador del tracto gastrointestinal,
del 1 al 10% de la población
en general esta colonizada,
la listeriosis invasiva depende
del estado inmunológico del
hospedero. En revisiones de
series de listeriosis hasta el 28%
ha sido reportada con manifestaciones al SNC, sólo un 7%
como absceso cerebral único y
1% como múltiples. Conclusiones: En este caso describimos
un paciente con abscesos cerebrales múltiples por listeria;
un caso poco frecuente. Los
factores de riesgo para esta
enfermedad son descontrol
glucémico, diabetes mellitus y
edad avanzada. Es un ejemplo
de listeriosis esporádica con
manifestaciones del SNC no
asociado al uso de esteroides
ni inmunosupresores lo que
confiere un mejor pronóstico.
Tuberculomas cerebrales que
simulan meningiomas en un
paciente inmunocompetente
con tuberculosis miliar
Sergio Alberto Mendoza Álvarez, Fabiola González Márquez,
Citlalli Fernández Vivar
S50
UMAE Hospital de Especialidades, Centro Médico La Raza,
México, DF
Introducción: la tuberculosis (TB) es una enfermedad
cuya presentación miliar representa menos del 2% en
inmunocompetentes y 20%
de la TB extrapulmonar cuya
afección al SNC representa
5%. Una forma poco común
de presentación son los tuberculomas. Descripción del caso:
mujer de 47 años con anemia,
pérdida de peso 26 kg y crisis
convulsivas cuya TAC de cráneo
concluyó meningioma frontal
derecho de 48x28x26 mm y
parietal bilateral de 26x5 mm
programada para manejo quirúrgico por neurocirugía. Se
valoró por medicina interna por
anemia refractaria a tratamiento
con reporte de Hb 9.4, AMO:
médula reactiva. LCR: glucosa
59, proteínas totales 0.100 g/
dL, acelular, agua de roca, PCR
en LCR para M. tuberculosis
negativo, PPD negativo, cultivos negativos para bacterias y
micobacterias. TAC abdomen:
hepatomegalia, adenomegalias
retroperitoneales, axilares e
inguinales. Biopsia de hueso:
infiltración por proceso linfoproliferativo. Biopsia hepática:
infiltrado inflamatorio mixto
portal leve, sin necrosis. Se
realizó laparotomía protocolizada que reportó hepatitis
granulomatosa multifocal no
casificantes, Ziehl-Neelsen
negativa. Después de haber
descartado causas neoplásicas,
inflamatorias no infecciosas e
infecciosas y debido a que los
granulomas por TB extrapulmonar pueden ser no caseificates y
ZN negativo, se decidió prueba
terapéutica con antifimicos y se
observó RM de cráneo reducción significativa del tamaño
de la lesiones después de 3
semanas de tratamiento, sin
embargo, presentó neutropenia severa por lo que se repitió
AMO que se reportó nuevamente reactivo y mielocultivo
sin desarrollo de micobacterias;
se decidió continuar antifímicos
hasta que presentó mejoría
paulatina de los neutrófilos y
hemoglobina a las 7 semanas
de tratamiento. Comentario
y Conclusión: se concluyó
tuberculosis miliar con afección atípica a SNC, medular y
hepática. La tuberculosis miliar
requiere de alta sospecha clínica ya que son paucibacilares
y los análisis bacteriológicos
usualmente son negativos como
sucedió en esta paciente. En el
LCR la tinción ZN se encuentra
en <5%, el cultivo con desarrollo en el 18-60%, y la PCR en
68%. La presentación de este
caso fue inusual ya que los
hallazgos neuroradiológicos no
eran compatibles con TB pero
debido a la sospecha clínica e
histopatológica a nivel hepático
se decidió evaluar la respuesta
con antifímicos con resultado
favorable.
Histoplasmosis diseminada
como presentación de deficiencia de mieloperoxidasa
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Álvaro López Iñiguez, Aldo Olmedo Gaytán, Amado Jiménez
Ruíz, Israel Anaya Silva, Ezequiel Vélez Gómez, Alejandro
Bravo Cuellar
Hospital Civil de Guadalajara
Fray Antonio Alcalde, Guadalajara, Jalisco, México
Hospital Civil de Guadalajara
Juan I Menchaca, Guadalajara,
Jalisco, México
Introducción: la deficiencia de
mieloperoxidasa es un trastorno del metabolismo oxidativo
que predispone a infecciones
micóticas sistémicas. Presentamos el caso de una joven que
se presenta con Histoplasmosis
diseminada como primera manifestación. Descripción del
caso: se trata de femenina de
20 años sin antecedentes de
relevancia. Refiere su familiar
que inicia un mes previo con
odinofagia, disfagia, astenia
y adinamia, recibiendo tratamiento para faringoamigdalitis
sin tener mejoría. Se agregan
alteración del estado de alerta,
alucinaciones y fiebre. En la valoración inicial se documenta la
presencia de sepsis severa con
hiperlactatemia y pancitopenia
severa con ausencia total de
neutrófilos. En la exploración
física se documenta la presencia de ulceras orales dolorosas,
estertores en hemitórax derecho, taquicardia sin soplos y un
puntaje de coma de Glasgow de
12 (04 M5 V3), sin focalización
o meningismo. En la radiografía
de tórax se evidencia infiltrado
intersticial bilateral y zona de
consolidación en base derecha.
Se descartó infección por VIH,
VHB y VHC así como neuroinfección con cultivo de LCR y
PCR para herpes tipo 1 y 2.
Se realiza AMOH en la que se
reporta la presencia de aplasia
medular con escasas células retículo histiocitarias fagocitando
levaduras. Se inicia tratamiento
con anfotericina B y antibióticos
de amplio espectro. La paciente
mejora progresivamente, sin
embargo presenta diarrea y dolor abdominal evolucionando
a abdomen agudo quirúrgico.
En la cirugía se documentan
múltiples perforaciones colónicas por lo que se realiza
hemicolectomia derecha. El
estudio histopatológico reporta
la presencia de abundantes histiocitos fagocitando levaduras.
El cultivo reporta Histoplasma capsulatum. Se realiza
determinación de capacidad
de fagocitosis, opsonización,
niveles de mieloperoxidasa y
prueba de nitroazul de tetrazolio reportándose disminuidos.
La paciente evoluciona favorablemente egresándose con
protocolo para trasplante de
medula ósea. Comentarios:
se trata de un caso de una
enfermedad rara que se manifiesta con una histoplasmosis
sistémica severa en una zona
endémica. Conclusiones: la
deficiencia de mieloperoxidasa
predispone a infecciones micóticas siendo la más común la
candidiasis, sin embargo otros
hongos como Histoplasma capsulatum deben ser considerados
por su agresividad y la necesidad de tratamiento oportuno.
Hepatoesplenitis granulomatosa como presentación de fiebre
de origen oscuro en paciente
inmunocompetente. Reporte
de un caso
JE Hernández Utrera, 1 SA
Mendoza Álvarez,2 LLL Navas
Alemán3
1
Residente de tercer año de
Medicina Interna
2
Médico adscrito al Servicio de
Medicina Interna
3
Residente de segundo año de
Anatomía Patológica
UMAE Hospital de Especialidades Dr. Antonio Fraga Mouret,
Centro Médico Nacional La
Raza, IMSS, México, DF
Introducción: el protocolo
de estudio de la Fiebre de
origen oscuro incluye causas
infecciosas, inflamatorias no
infecciosas, neoplásicas y misceláneas; cuya causa infecciosa
más común es la tuberculosis y
la presentación miliar oscila en
el 20% y su presentación como
hepatoesplenitis granulomatosa
no caseificante ZN negativo en
paciente inmunocompetente
es rara y de difícil diagnóstico.
Descripción del caso: masculino de 39 años con odinofagia,
fiebre de 38.5 de 3 meses
de evolución con pérdida de
peso del 15%; recibió múltiples antibióticos sin remisión
del cuadro. A la exploración
física con hepatomegalia sin
adenopatías. Exámenes de
laboratorio: Hb 9.95, TORCH
S51
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
con memoria inmunológica.
Serología para hepatitis y VIH
no reactiva. Reacciones febriles
con Tifico O <1:20, Tifico H
1:40 Brucela < 1:20, Rosa de
Bengala negativo, anti proteus
OX19 < 1:20. BAAR en esputo
negativo, Urocultivos, Mielocultivos y Hemocultivos para
bacterias y micobacterias sin
desarrollo, Antimitocondriales
1:160, Anticuerpos antinucleares 1:80 (moteado fino).
TC abdominal: hemangioma
hepático y esplenomegalia.
Se realizó laparotomía protocolizada que reportó bazo
de 18x20 cm y hepatomegalia con múltiples lesiones
blanquecinas con reporte histopatológico de hepato-esplenitis
granulomatosa inespecífica con
inflamación crónica, granulomas no caseificantes, sin
células multinucleadas y con
linfocitosis sinusoidal leve
multifocal, tinción de Ziehl
Neelsen (ZN), PAS, Warthin
Starry y Grocott negativos. Se
solicitó inmunohistoquímica
y se descartó linfoma. Comentario y Conclusiones: la
hepatoesplenitis granulomatosa
es una entidad rara sobretodo
en individuos inmunocompetentes cuya etiología incluye
la tuberculosis en primer lugar
(55-90%), linfomas e infecciones por Bartonella y fúngicas.
En las biopsias hepáticas que
se reportan granulomas, el 50%
son caseificantes y entre el 1050% son ZN positivo aunque
en otras series el ZN positivo
es raro. La esplenitis granulo-
S52
matosa se presenta en el 10%
de los casos de TB abdominal
y la mayoría de las veces se
relaciona con la afección hepática y su manifestación más
común es la esplenomegalia.
Las formas extra pulmonares
de la Tb son paucibacilares y
por tanto difícil de demostrar
el bacilo por lo que decidimos
iniciar manejo con antifímicos
en base al contexto clínico e
histopatológico con respuesta
satisfactoria.
Reporte de caso: pericarditis
por virus de Epstein-Barr en
paciente inmunocompetente
Carlos Martínez Zavala, Alejandro Rivera Mora, Stephanie
Anely Rodríguez Fabián
Medicina Interna, Centro Médico ISSEMyM Ecatepec, Estado
de México
Introducción: el pericardio es
un saco fibroelástico que rodea
el corazón compuesto por capas visceral y parietal separadas
por un espacio virtual con un
ultrafiltrado de plasma. Las
enfermedades del pericardio
son relativamente comunes en
la práctica clínica y pueden
tener diferentes etiologías, ya
sea como enfermedad aislada
o una manifestación de una
enfermedad sistémica. Las principales manifestaciones de la
enfermedad pericárdica son pericarditis y derrame pericárdico.
Descripción del caso: paciente
femenino de 51 años, sin antecedentes de importancia. Inicia
padecimiento octubre 2013 con
cuadro gripal tratada con antibioticoterapia por 15 días, con
mejoría parcial; persistencia
de síntomas, se agrega disnea,
dolor pleurítico. A su ingreso
a urgencias se encuentra neurológicamente integra con TA:
132/80 mmHg; FC: 90 lpm;
Fr 18 rpm, SaO2 89%. tórax
murmullo vesicular disminuido,
vibraciones disminuidas bibasales, con síndrome derrame
pleural bilateral. Restos sin
patología. Se estudia por serositis: BH: leucocitos 7.600 (N:
3251; L: 2100). QS: normales;
ES normales. EKG con elevación del segmento ST en V2 a
V5. Ecocardiograma derrame
pericárdico de 1100 cc, FEVI
conservada; TAC tórax corroborándose derrame pericárdico,
derrame pleural bilateral de
predominio derecho masivo;
se realiza toracocentesis con
resultado de trasudado por criterios de Light. Por antecedentes
y cuadro clínico se sospecha
de lupus con resultados de
anticuerpos negativos. Se realiza ventana pericárdica con
estudio citológico, cultivos de
bacterias, hongos, pyogenos,
ADA, negativo. En el panel viral
con amplificación por PCR para
complejo herpes positivo para
Epstein Barr, corroborándose
con anticuerpos heterófilos.
Conclusiones: la importancia
de la revisión del caso clínico,
radica en que la pericarditis es
un trastorno común en varios
entornos clínicos, donde puede
ser la primera manifestación
de una enfermedad sistémica
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
o ser un proceso primario con
diferentes etiologías, en quien
no se identifica ninguna causa
(pericarditis idiopática), se presume con frecuencia ser viral,
pero la evidencia de esto a menudo no se busca por los gastos
que implica, la inaccesibilidad
al tejido pericárdico, liquido, el
tiempo y la inexactitud de los
títulos virales. Es probable que
muchos casos no se justifique la
búsqueda de origen viral. Una
excepción clínica es la ausencia
de mejoría clínica.
Hipertensión arterial pulmonar
asociada a infección por VIH.
Revisión de un caso
Ariadna Aguíñiga Rodríguez,
Laura Castro Castrezana, Rogelio David Castro Vallejo, Yazmín
Moctezuma Montaño, Laura
Torres Rosas, María Fernanda
Espeso Robles, Carlos Márquez
García
Servicio de Medicina Interna,
Hospital General de Zona núm.
48, IMSS, México, DF
Introducción: describir la relación de VIH con hipertensión
arterial pulmonar, la fisiopatología es desconocida. Se
cree que el virus podría actuar
a través de la liberación de
mediadores (endotelina 1). Se
ha descrito mayor prevalencia
de HLA-DR6 y HLA-DR52 en
pacientes con VIH. La incidencia de hipertensión pulmonar
asociada en pacientes positivos
para el VIH es desconocida, no
se ha relacionado con el grado
de inmunodepresión ni con el
recuento de células CD4,se
estima en 1/200 pacientes
VIH positivos, a diferencia de
1/2000 encontrado en la población en general. Descripción
del caso: masculino de 28 años
de edad. Tabaquismo: positivo,
drogadicción: cocaína y piedra.
Prácticas sexuales de riesgo.
Ingresa por presencia de disnea
de medianos esfuerzos que
progreso a pequeños esfuerzos, acompañada de ortopnea
y disnea paroxística nocturna;
tos con expectoración hialina
y malestar general. Exploración
física: ingurgitación yugular
grado II. Sin compromiso respiratorio. Ruidos cardiacos de
adecuada intensidad, con soplo
tricuspídeo grado IV/V, rítmicos.
En la auscultación pulmonar no
se objetivaron hallazgos patológicos. Estudios de laboratorio:
biometría hemática: leucocitos:
1100 células, linfocitos: 2000
células y plaquetas: 73,000
células. Reactivo a VIH, en
dos determinaciones ELISA y
confirmatorio Western-Blot.
Ecocardiogramas: disfunción
sistólica severa del ventrículo
derecho, derrame pericárdico
e hipertensión arterial pulmonar severa (PSAP: 88 mmHg).
Radiografía y TC de tórax descartan patología pulmonar. Se
inició manejo con retrovirales
y antagonistas de canales de
calcio, los cuales suspendió y
falleció. Comentarios: conocer complicaciones asociadas
a VIH poco frecuentes, cuyo
síntoma principal es la disnea
no relacionada a patología
pulmonar, para poder realizar
un diagnóstico oportuno, debido al alto riesgo de mortalidad
asociado a Hipertensión arterial
pulmonar (81%). Conclusiones:
la hipertensión arterial pulmonar relacionado a VIH a pesar
de su baja incidencia requiere
de un alto grado de sospecha
clínica, con una anamnesis
que incluya factores de riesgo:
drogas por vía parenteral, la
hepatopatía crónica y las alteraciones de la coagulación,
cuyo diagnóstico debe ser de
exclusión con otros trastornos
(pulmonares, trastornos infiltrativos, cardiacos, autoinmunes,
trombo-embólicos, hematológicos y farmacológicos), para
poder realizar tratamiento oportuno y mejorar la supervivencia
en el paciente con VIH.
Retención urinaria aguda: debut de encefalomielitis aguda
diseminada posinfecciosa.
Reporte de caso
Diana Arlett Herrera Madrid,
Nerina del Carmen Fernández
Martínez, Verónica Montes
Martínez
Hospital de Alta Especialidad
de Veracruz
Introducción: la encefalomielitis aguda diseminada (EMAD) es
una enfermedad inflamatoria,
mediada inmunológicamente
del sistema nervioso, resultando
en lesiones desmielinizantes
multifocales que afecta a la sustancia gris y blanca del cerebro
y medula espinal. Incidencia
de 0.4 caso por 100,000 por
S53
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
año, en pacientes mayores de
20 años. Descripción del caso:
Antecedentes: psoriasis diagnosticada hace 5 años en cuero
cabelludo leve en tratamiento
con esteroides tópicos, dismenorrea. Femenino de 26 años
con cuadro de gastroenteritis
que duro 5 días, remisión del
mismo con ampicilina, 3 días
después cefalea holocraneana
pulsátil, fiebre, nausea, vomito, mialgias severas, inicio de
ceftriaxona, 2 días después
retención aguda de orina- 24
horas después, con hiperreflexia
patelar izquierda, rigidez de
nuca, parestesias en ambas manos y disminución de la fuerza
4 de 5 en miembros inferiores,
se realiza tac de cráneo simple
y contrastada- normal, punción
lumbar-aspecto transparente,
agua de roca, células- 160
leucocitos, linfocitos 76%,
neutrófilos- 24%, glucosa 53,
proteínas- 50 , se inicia manejo para menigitis, sin embargo
progresión de la debilidad 2 de
5 en extremidades superiores,
y 1 de 5 en inferiores además
se integra síndrome medular
completo a nivel de T8 posteriormente evolución en horas
a somnolencia, bradicardia,
hipotensión, se inician pulsos
con metilprednisolona 1 gr
cada 24 h, y se solicita resonancia magnética de columna
y cráneo en la cual se observa:
imágenes hiperintensas en T2 y
flair sin realce de gadolinio, en
regiones talámicas, cerebelo y
base de cráneo, en columna de
cervicales a torácicas lesiones
S54
en parche hiperintensas en T2
sin realce de gadolinio. Por lo
que el cuadro de somnolencia,
síndrome medular completo
y alteraciones en resonancia
magnética, nos llevo a pensar
en EMAD, 2 días después del
inicio de los pulsos, mejoría
del cuadro remisión de la somnolencia y reversión progresiva
de fuerza y sensibilidad, actualmente con cateterismo vesical
intermitente. Comentario y
Conclusión: adulto joven, con
antecedente infeccioso previo,
que presenta somnolencia y
síndrome medular completo de
instauración progresiva, en un
inicio por la rigidez meníngea
y la pleocitosis se considero
meningitis, sin embargo la progresión del cuadro y el patrón
de la distribución de las lesiones en la resonancia nos llevo
al diagnóstico de EMAD.
Mucormicosis postraumática
en un paciente inmunocompetente: osteomielitis craneal,
una manifestación insual
Román Zamora Gómez, Isaías
Ceballos Arellano, Ramón Oscar René Villegas Loera, Karla
García Osuna
Hospital General de Culiacán
Dr. Bernardo J Gastelum, Culiacán, Sinaloa
Introducción: las mucormicosis
son infecciones poco frecuentes
en pacientes inmunocompetentes. Hongos de la clase de
Zygomycetos, orden Mucorales,
causan infecciones profundas
que se adquieren a través del
aire; la infección primaria se
inicia en la parte superior o
inferior vías respiratorias y se
asocia con el desarrollo clínico
de sinusitis, mucormicosis rinocerebral o infección pulmonar.
Otras formas de presentación,
tienen relación con el mecanismo de entrada del patógeno; el
pronóstico esta relacionado al
diagnóstico oportuno, y al tratamiento tanto quirúrgico como
farmacológico. Descripción
del caso: se trata de paciente
masculino de 25 años de edad,
jornalero, el cual niega antecedentes de enfermedades crónico
degenerativas así como infecto
contagiosas. Niega consumo de
tabaco, alcohol o drogas ilícitas.
Con el antecedente de sufrir el
día 31 de diciembre del 2012
traumatismo cráneo-encefálico secundario a accidente
automovilístico de tipo motocicleta, presentando múltiples
abrasiones y excoriaciones en
cráneo; tres meses después
inicia con crisis convulsivas,
cefalea, fiebre de predominio
nocturno; se realiza TAC de
cráneo, en donde se encuentra
área de hipodensidad frontal
izquierda, sin reforzamiento,
sugiriendo una cerebritis; a la
exploración física de cráneo
se encuentra induración y aumento de volumen en región
frontoparietal izquierda con
dolor a la palpación; el día 3 de
abril, se realiza desbridamiento
con curetaje óseo, durante el
procedimiento hay salida de
material purulento caseoso, en
el área afectada, con toma de
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
biopsia de tejido epicraneal y
de hueso. El resultado reporta
reacción granulomatosa con
células gigantes multinucleadas, con abundantes hifas de
base ancha en ángulo recto,
con áreas extensas de necrosis,
asociada a infección micótica
profunda por Zygomicetos,
con tinción de PAS +. Se inicia
tratamiento con anfotericina
B, sin afectación renal, control
tomográfico con disminución
de las zonas osteolíticas; biopsia de tejido óseo con escasa
presencia de hifas y datos de
inflamación crónica. Comentario: el mecanismo de entrada en
este caso fue a través de la perdida de continuidad, siendo la
osteomielitis una complicación
poco frecuente. Conclusión: el
pronóstico depende del diagnostico oportuno, así como de
un tratamiento agresivo, con
lavado quirúrgicos y tratamiento
farmacológico.
Tuberculosis pancreática en
una paciente con síndrome de
inmunodeficiencia adquirida.
Reporte de un caso
Yesenia Ortiz Montaño,1 Jesús
Ojino Sosa García,2 Teresa de
la Torre León2
1
Centro Nacional de Excelencia Tecnológica en Salud
(CENETEC), Hospital General
Dr. Manuel Gea González,
México, DF
2
CENETEC, Médica Sur, México, DF
Introducción: la tuberculosis
pancreática es una enfermedad
muy rara aún en pacientes con
el síndrome de inmunodeficiencia adquirida (SIDA), con una
incidencia de 0.46% basada
en los hallazgos por ultrasonido. Caso clínico: femenino
de 34 años con antecedente
de hiperreactividad bronquial.
Posoperada de colecistectomía
con subsecuente realización
de CPRE. Su padecimiento de
6 meses de evolución caracterizado por dolor abdominal
postprandial inmediato de tipo
cólico 6/10, sin irradicaciones
asociado a diarrea, disestesias y
pérdida de peso. Fue valorada
y tratada de diferentes formas.
Se agregó fiebre persistiendo
la misma sintomatología. Se
realizó prueba de ELISA para
VIH la cual fue positiva, una
carga viral de 375,000 copias
y CD4+ 37 células. Se realizó
una tomografía en la cual se
evidenció una imagen quística
a nivel de páncreas. Se procedió
a puncionar el líquido el cual
resultó Ziehl-Neelsen positivo.
Se confirmó con cultivo positivo
para Mycobacterium tuberculosis. Se inició tratamiento
antituberculoso sin éxito ya
que la paciente falleció 3 semanas posterior al inició del
tratamiento. Comentarios: la
tuberculosis es una enfermedad
extremadamente rara y es un
reto diagnóstico ya que esta
enfermedad puede simular un
carcinoma, linfoma, tumores
retroperitoneales, pancreatitis,
entre otras. Conclusiones: es
de suma importancia la sospecha clínica de la tuberculosis
pancreática ya que el inicio
oportuno del tratamiento con
drogas antituberculosas ofrece un mejor pronóstico a los
pacientes con SIDA que la
padecen.
Infección masiva por Leptospira en una paciente con
leucemia mieloide crónica:
reporte de un caso
Jorge García-Méndez, 1 Daniel Atilano-López, 2 Ericka
Carrillo-Casas,3 Eduardo Cervera-Ceballos4
1
Departamentos de Posgrado
y Educación Médica Continua,
Instituto Nacional de Cancerología (INCan), Microbiología
y Parasitología, Facultad de
Medicina, UNAM
2
Laboratorio de Diagnóstico-Bacteriología, Sección
Leptospira, Facultad de Medicina Veterinaria
Introducción: la leptospirosis
es una zoonosis causada por
espiroquetas (Leptospira) y
transmitido por orina de animales infectados, asociada también
a inundaciones. El cuadro
clínico habitual es leve y autolimitado; con ictericia, daño
renal y hemorragia como los
datos de mayor riesgo –síndrome de Weil–. Aunque de
predominio rural, su aparición
en áreas urbanas obliga a la
búsqueda de contactos con
animales. Caso clínico: acudió
a la Urgencia de Hospital de
Referencia, mujer de 65 años,
antecedentes de púrpura trombocitopénica idiopática (PTI)
S55
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
a los +/-18 años –tratada con
éxito en E.E.U.U. (esplenectomía) – y leucemia mieloide
crónica desde los 60 años;
suspendió imatinib seis meses
atrás por disminución de la
“agudeza visual”. En esta ocasión, acude por insuficiencia
respiratoria: radiológicamente
neumonía de focos múltiples y
clínica de bacteriemia. Los hemocultivos (+) a Leptospira por
serovar inusual (L. bratislava)
diferente a L. interrogans, L. icterohaemorrhagiae, L. pomona
y L. canicola (las más comunes en humanos). No se aisló
ningún otro microorganismo.
Tras iniciar penicilina I.V. más
doxiciclina, reducen los títulos
de L. bratislava, desaparece la
fiebre y mejora el cuadro de
uveítis asociadas a la infección
por Leptospira. No presenta
recaída en seguimiento de 10
meses. Discusión: se reporta
el caso de una paciente con
leucemia crónica mieloide en
progresión por abandono de
Imatinib, con leptospirosis diseminada: bacteriemia, uveítis,
neumonitis. Aunque el curso
aún en pacientes muy enfermos
no es fatal ya que responde
bien al tratamiento; se destaca
la importancia de reconocerla
ya que representa riesgo para
la vida, especialmente en pacientes inmunocomprometidos.
Conclusión: el diagnóstico no
fue sospechado hasta tener los
hemocultivos (+) cuya visualización directa en campo oscuro
fue clave. La asociación rural
> urbana (ratas en indigentes
S56
citadinos de E.E.U.U.); en México puede ser endémico por
áreas de fácil inundación y
pobre sanidad. Los títulos más
altos fueron para L. bratislava
una especie asociada a perros
y cerdos, lo cual enfatiza la
necesidad de vigilancia de esta
zoonosis en inmunocomprometidos.
Síndrome de uñas amarillas
asociado a síndrome nefrótico
JAJ Batún Garrido, E Hernández
Núñez, F Olán
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa
Pérez, Villahermosa, Tabasco
Introducción: el síndrome de
uñas amarillas descrito por primera vez por Samman y White
en pacientes que presentaban
cambios en la morfología de
las uñas y linfedema. Emerson
añadió el derrame pleural,
Bower sugiere la bronquiectasia, estableciéndose la tríada
de uñas amarillas, linfedema y
manifestaciones pleuropulmonares, el diagnóstico se realiza
con la presencia de dos de
estos síntomas. La patogénesis
está asociada principalmente a
la insuficiencia linfática. Descripción del caso: femenina de
60 años. Hace 4 años presenta
edema en miembros inferiores,
elevación de azoados, depuración de Cr 32,8 mL/min y
proteínas 3777 mg en orina
de 24 hrs, colesterol 246 mg/
dL, triglicéridos 398 mg/dL,
diagnosticándose síndrome
nefrótico. Ac. antinucleares
negativo, ANCA C y P negativos, complemento C3 y C4
normales, Ac antimembrana
glomerular basal negativo, Ac
antiSM negativo, AC antiDNA
nativo 4 UI/mL, complemento
hemolítico al 50% 265 U/mL
y factor reumatoide negativo.
Hace 3 años presenta fiebre,
accesos de tos con hemoptisis,
PPD positiva, BAAR seriado
en esputo negativos, PCR en
sangre y de mucosa bronquial para M. tuberculosis
negativos. TAC de tórax con
bronquiectasias bilaterales.
Actualmente presenta fiebre,
tos con esputo mucopurolento, cultivo de expectoración
Pseudomonas aeruginosa, Klebsiella sp, Staphylococcus sp,
se inicia cefepime ajustado a
función renal, EF murmullo
vesicular disminuido, pectoriloquia áfona, uñas en miembros
superiores con melanoniquia,
uñas en miembros inferiores de color amarillo-verdoso
oscuro, engrosamiento de la
curvatura transversal y longitudinal, ausencia de cutícula y
lúnula, diagnosticándose SUA.
Paraclínicos BUN 33.6 mg/dL,
Cr 2.14 mg/dL, Urea 71.9 mg/
dL, depuración Cr 36.8 mL/
min y proteínas 4928 mg en
orina de 24 h, colesterol 258
mg/dL, triglicéridos 414 mg/
dL. TAC de tórax con múltiples
bronquiectasias quísticas y
granulomas calcificados. Se
inicia tratamiento con vitamina
E, y seguimiento por la consulta
externa. Comentarios y Conclusiones: Se presenta el caso
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de una paciente con el diagnostico de síndrome nefrótico,
en quien se había descartado
proceso fímico y enfermedades
autoinmunes, se hospitaliza por
la presencia de bronquiectasias
infectadas, diagnosticándose
SUA. Existen pocos casos asociados entre SUA y el síndrome
nefrótico.
Nefropatía por depósitos de
C1q: reporte de caso y revisión
Triana Gabriela Salgado Muñoz,
Isaac Morones Esquivel, Teresa
Ivonne Gonzaga López, Adriana Paula Matamoros Mejía,
Maricarmen Lagunas Alvarado,
Diana Sarai López González,
Dinorah Alemán Domínguez,
Araceli Cruz Rodríguez, Luis
Javier Castro D’Franchis
Servicio de Medicina Interna de
Hospital Central Norte de Petróleos Mexicanos, México, DF
Introducción: la nefropatía por
C1q es una glomerulonefritis
poco frecuente caracterizada
por depósitos mesangiales de
C1q que histológicamente es
similar a la nefritis lúpica. La
presentación más común es
el síndrome nefrótico. Caso
clínico: masculino de 54 años,
con carga genética para cáncer
vesical y lupus eritematoso
sistémico. Niega tabaquismo
o exposición a tóxicos. Adenocarcinoma de próstata
diagnosticado en marzo del
2011 tratado con cirugía radical actualmente en remisión.
Inicia en Julio del 2013 con
disnea progresiva, tos seca y
edema palpebral, evoluciona
con edema de extremidades
y pared abdominal, ortopnea,
diaforesis nocturna, disminución de volúmenes urinarios,
mialgias, artralgias y aumento
de 8 kg. Leucocitos 7400,
hemoglobina 17.10, plaquetas
336,000, creatinina 1.09 mg/dl,
urea 58.6mg/dl, colesterol 556
mg/dl, triglicéridos 284 mg/dL,
albúmina 1.3 g/dL, EGO eritrocitos 150 por campo, proteínas
500 mg/dL, leucocitos 68 por
campo, bacterias moderadas.
Hepatitis B, C y VIH(-), proteinuria 14.32 g/24 horas, C3 141
mg/dL, C4 42 mg/dL, ANA(-),
anti DNAds(-), depuración de
Cr 89.64 mL/min. Ultrasonido
riñones de tamaño y forma normal, edematosos con perdida
de relación cortico medular con
prominencia piramidal. Biopsia
renal: nefropatía por c1q con
patrón de esclerosis focal y
segmentaria, cambios regenerativos epiteliales tubulares.
Iniciando metilprednisolona 1
gr por 3 días continuando con
prednisona. Presenta recaída y
es tratado con micofenolato de
mofetilo y rituximab, mostrando mejoría. Actualmente con
depuración de creatinina en
70.36ml/min y proteínas de 24
horas en orina de 0.12 gr/24 horas. Comentario y Conclusión:
la nefropatía por C1q es una
patología subdiagnosticada,
con una prevalencia en biopsias renales de 0.2 al 6%. En el
pasado la nefropatía por C1q
fue mal diagnosticada y tratada
como una nefritis lúpica sero-
negativa, habitualmente eran
pacientes con características
histológicas sugerentes de lupus
pero sin manifestaciones típicas
ni anticuerpos para confirmar
diagnóstico. En la actualidad
la literatura ha documentado
más casos por lo que es importante tenerla en mente para
solicitar inmunofluorescencia
en búsqueda de depósitos de
C1q. Su tratamiento es con
corticoterapia, sin embargo se
ha documentado resistencia
por lo que han surgido nuevas
propuestas terapéuticas con
ciclofosfamida, azatioprina,
micofenolato de mofetilo y
rituximab mostrando buenos
resultados.
Síndrome de Alport. Reporte
de un caso
Jessica Noriega Flores, María
Elisa González Renteria, Roxana
Villca González
Medicina Interna-Nefrología,
Hospital Regional Lic. Adolfo
López Mateos, ISSSTE, México, DF
Introducción: el síndrome de
Alport, enfermedad hereditaria,
afecta las membranas basales,
por alteraciones en el colágeno
tipo IV. Se caracteriza por nefropatía con hematuria persistente
asociada a sordera neurógena y
alteraciones del tipo oftálmico
y en ocasiones leiomiomatosis.
Existen tres formas: ligado al
cromosoma X, mutaciones en
el gen COL4A5. Autosómico
recesivo, mutaciones en ambos
alelos de los genes COL4A3 o
S57
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
COL4A4, ubicado en el cromosoma 2q35-37. Autosómico
dominante, mutación heterocigota de los genes COL4A3
o COL4A4. Se ha reportado
en todos los grupos étnicos y
geográficos. La incidencia es
desconocida, en Estados Unidos representa el 3% de los
niños con enfermedad renal
terminal y 0,2% de los pacientes adultos, las mujeres pueden
ser asintomáticas. Caso clínico:
masculino de 19 años, del Distrito Federal. Madre finada de
49 años por enfermedad renal.
Niega toxicomanías. Inicia su
padecimiento en mayo del 2009
con hematuria macroscópica
Paraclínicos Examen general
de orina 250 eri/mL, proteínas 25 mg/dL, C3 normal, C4
bajo, Cr 1 mg/dL, ultrasonido
renal normal. Biopsia renal 16
glomérulos, espacios urinarios
conservados, atrofia+, fibrosis+
inmunoflorescencia negativa.
Diagnóstico: enfermedad de
cambios mínimos, tratado con
micofenolato y prednisona. Persiste con hematuria-proteinuria,
es enviado a nuestro hospital
en octubre 2013. Asintomático,
TA 110/80, FC 65x’,Peso 82
kg, exploración física normal.
Manifiesta disminución de la
audición. Paraclínicos examen
general de orina con proteínas
25 mg/dL, 250 eri/mL, proteínas en orina de 24 horas 500
mg/24 h, Cr 0.8, BUN 13,
Anti-DNA 3.1, C3 130, C4
18, ultrasonido renal normal,
audiometría normal. Biopsia
renal cambios glomerulares, al-
S58
teraciones estructurales, fibrosis
intersticial Grado I, microscopia
electrónica: membrana basal laminada con zonas entretejidas,
Inmunofluorescencia negativa.
Comentarios: el paciente no
presenta alteraciones auditivas
pero las formas autosómicas
pueden cursar sin sordera El
paciente se encuentra en tratamiento antiproteinúrico y
consejo genético. La probabilidad de desarrollar enfermedad
renal antes de los 40años es
del 10-12% en mujeres y en
hombres homocigotos del 90%.
Conclusiones: se sospecha por
historia familiar de enfermedad
renal y sordera, se confirma
por biopsia de piel o renal, el
hallazgo es la división longitudinal de la lámina densa de la
membrana basal glomerular por
microscopía electrónica. Diagnóstico diferencial enfermedad
por membrana basal adelgazada y la nefropatía por IgA.
Rabdomiólisis secundaria a
fenoverina y nefritis tubulointersticial difusa por quinolonas:
una asociación infrecuente
Diana Garnica Chávez, María
Augusta Pacheco Arias, Roberto
Andrés B
Servicio de Medicina Interna,
Hospital Regional Licenciado
Adolfo López Mateos, ISSSTE,
México, DF
La rabdomiolisis, caracterizada por necrosis muscular y
liberación de constituyentes
intracelulares a la circulación
se debe a múltiples causas, en
el caso en cuestión se plantean
infrecuentes factores asociados
como son fenoverina, y la exposición a toxinas de pescado. Así
mismo se identifica virtualmente a cualquier fármaco como
causante de Nefritis intersticial
siendo las quinolonas un grupo
poco reportado y postulado
a continuación. Se presenta
el caso de mujer de 44 años
sin comorbilidades a quien se
prescribe ciprofloxacino por
sintomatología urinaria. Cursa
sin mejoría y se agrega además dolor lumbar intenso por
lo que se añade fenoverina al
manejo iniciando con astenia,
adinamia y edema. Como dato
relevante la paciente refiere
ingesta de pescado y mariscos
a la par del inicio de su cuadro. Se admite en Urgencias
15 días de iniciado el padecimiento por exacerbación de
sus síntomas documentándose
hiperazoemia, retención hídrica, hipertensión arterial, dolor
y debilidad muscular generalizada, cilindros granulosos,
hematuria microscópica y proteinuria leve en el uroanálisis,
importante elevación de enzimas musculares, hipocalcemia
e hiperkalemia estableciéndose
el diagnóstico de lesión renal
aguda de etiología a determinar iniciándose reposición
hidroelectrolítica. Debido a
hipercalemia y acidemia metabólica refractaria así como
anuria asociada a anasarca
se inicia hemodiálisis en un
total de siete sesiones y ante
la sospecha de nefritis tubu-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
lointersticial paralelamente se
inician bolos de esteroide con
buena evolución. Al no establecerse el promotor de injuria
renal tras la investigación de
sus múltiples causas se decide
realizar biopsia renal por punción: nefritis túbulointersticial
activa difusa y rabdomiólisis
focal. La biopsia estableció el
diagnóstico y los antecedentes
orientan hacia una toxicidad
inducida por fármacos y posible por alimentos. Entre los
medicamentos señalados en
la literatura como causa infrecuente de Nefritis intersticial
figuran las quinolonas y por otro
lado la fenoverina y una toxina
en el pescado como desencadenantes de Rabdomiólisis. El
caso descrito destaca debido a
que representa la conjunción de
dos mecanismos de daño renal
añadidos cuya causa es poco
común. La paciente evolucionó
favorablemente tras un curso
de esteroides recuperando la
función renal basal.
Glomerulonefritis focal y segmentaria asociada a virus de
inmunodeficiencia humana
Rubén Antonio Gómez Mendoza,1 Ericka Carrillo Velázquez2
1
H. Consejo Técnico, IMSS
2
Jefa de la División de Medicina, UMAE Hospital de
Especialidades del CMN La
Raza, México, DF
Masculino de 36 años de
edad, niega antecedentes de
importancia para su padecimiento actual. Ingresa al
Servicio de Medicina Interna
por padecimiento de 3 meses
de evolución, con astenia,
adinamia, ataque al estado
general, náuseas sin llegar al
vómito y perdida de peso de
10 kg y edema de extremidades inferiores Ef: Emaciado,
palidez de tegumentos, a nivel
a cardiopulmonar con soplo
holosistólico plurifocal GII/IV.
CsPs sin alteraciones, abdomen
plano sin datos de hepatoesplenomegalia. Extremidades
con edema hasta tercio medio
de piernas, godete positivo.
Lab: Anemia normocítica, normocrómica, glucosa 100 mg/
dL, creatina 5.6 mg, urea 180
mg, Na 138 meq, K 5.6 meq.
Examen general de orina: ph
normal, albuminuria cualitativa+++, cilindros granulosos
albumina 3.0 g/dL. depuración
en orina de 24 h ajustada a talla
de 15 mL/min, 2.4 g proteínas.
Ultrasonido renal: Relación
córtico-medular conservada,
de forma y tamaño normal.
Perfil TORCH negativo, Elisa
para VIH y Western Blott positivo. Inmunológicos negativos.
Panel viral para hepatitis B y C
negativos. Se realiza biopsia
renal percutánea compatible
con glomerulonefritis focal
y segmentaria, con 11 de 18
glomérulos alterados. Los glomérulos presentan incremento
de volumen, uno de ellos con
área de esclerosis periférica y
adherencia a la cápsula fibrosa,
otro con hiperplasia focal de
células epiteliales viscerales
y tendencia a adherirse a la
cápsula de Bowmann; engrosamiento segmentario de asas
capilares. Túbulos con degeneración turbia, ocasionalmente
túbulos atróficos. Intersticio y
vasos sanguíneos normales. Se
inicia tratamiento médico con
terapia HAART. con normalización progresiva de la función
renal hasta la normalidad. En
1984 Rao y cols. describieron
por primera vez un patrón de
glomerulopatía esclerosante
que fue más tarde denominado
nefropatía asociada al VIH (HIVAN) y que se caracteriza por
un colapso glomerular y una
afectación tubulointersticial
severa Es la causa más común
de afectación renal en los pacientes VIH y se caracteriza
por proteinuria, generalmente
severa y una rápida evolución
hacia la insuficiencia renal. El
presente caso nos documenta
la capacidad de afectación del
VIH a nivel renal.
Calcinosis tumoral urémica-hiperfosfatémica en enfermedad
renal crónica e hiperparatiroidismo. Serie de casos
Guillermo Flores, Martín Armado Ríos Ayala, Paolo Alberti
Minutti, José Fabián Martínez
Herrera, Francisco Javier Ramos Aguilar, Christian Martínez
Pérez
UMAE Centro Médico Nacional
Siglo XXI, IMSS, México, DF
Introducción: la calcinosis
tumoral es una forma rara de
calcificación extraosea, caracterizado por depósitos de
S59
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
fosfato de calcio en tejidos
blandos periarticulares previamente sanos y bajo un ambiente
químicamente alterado. Generalmente se presenta como una
complicaciones de la enfermedad renal crónica en pacientes
sometidos a diálisis, aun que
también puede ser hereditaria,
familiar o presentarse en forma
aislada sin causa aparente.
Clínicamente se caracteriza
por el desarrollo progresivo de
tumoraciones calcificadas de
cualquier localización, aunque
con mas frecuencia en la proximidad de grandes articulares.
Aunque es una complicación
rara, su detección y manejo
oportuno impactan fuertemente
en el pronostico funcional del
paciente. Material y métodos:
se analizaron retrospectivamente 7 casos de calcinosis
tumoral documentados durante el periodo 2013-2014. Las
datos se obtuvieron de fuentes
primarias a través de la revisión
de expedientes clínicos. Se
utilizo estadística descriptica
con calculo de frecuencias y
proporciones. Resultados: se
describen 7 casos de calcinosis tumoral en pacientes con
enfermedad renal crónica e
hiperparatiroidismo, el 85 %
de los casos correspondieron al
sexo femenino, la localización
de la lesión tumoral fue 85% en
grandes articulaciones (codo,
rodilla, hombro, y cadera), 85%
se encontraba en terapia de sustitución renal a base de diálisis
peritoneal, 100% por un periodo mayor a 5 años, todos los
S60
pacientes presentaban anemia
severa y el 71.4% resistencia al
manejo con eritropoyetina, el
valor promedio de PTH libre fue
de 2370 ng/dL, el mínimo 1385
y máximo de 3822, el producto
calcio-fosforo fue > 45 en el
100% de los casos, solo el 85
% de los pacientes presentaba
hiperfosfatemia con calcio normal o discretamente elevado.
Los azoados se encontraban
francamente incrementados en
todos los casos. El 57% de los
paciente sometidos a resección
y paratiroidectomia evolucionaron en forma satisfactoria.
Conclusiones: la calcinosis tumoral es infrecuente y puede
ser una rara complicación del
hiperparatiroidismo secundario,
terciario y de la enfermedad
renal crónica. El sexo femenino
se mayormente afectado, principalmente aquellos pacientes con
diálisis peritoneal con mas de 5
años de inicio, los tejidos blandos
periarticulares de grandes articulaciones son la localización mas
habitual, la PTH generalmente
es > 2000 ng/dL, el producto
calcio-fósforo es > 45, y mas de
la mitad de los casos respondió
al manejo quirúrgico.
Esclerosis lateral amiotrófica:
reporte de caso
José Ángel Ramírez Rodríguez,
Esteban Monroy Barrera, Francisco Israel Guerrero Díaz
Servicio de Medicina Interna,
Hospital Universitario de Saltillo
Dr. Gonzalo Valdés Valdés, Saltillo, Coahuila. Hospital General
de Occidente, Zapopan, Jalisco
Introducción: padecimiento
degenerativo de motoneurona,
a diferentes niveles del sistema
nervioso central; cuadro clínico
variable, por lo cual es un reto
diagnóstico. Descripción del
caso: masculino de 57años,
antecedente de etilismo. Inicia con debilidad progresiva
de extremidades inferiores,
limitando actividades diarias
de 3 meses de evolución. A
su ingreso con fasciculaciones
e hipotrofia de extremidades
inferiores. Fuerza muscular 4/5
en extremidades superiores y
3/5 en inferiores, rigidez e hiperreflexia. Funciones mentales
superiores íntegras, no alteraciones en pares craneales ni
déficit sensitivo. Laboratorios:
WBC 9.03 10e3/uL, Hgb 15.2
g/dL, PLT 323 10e3/uL, Na 140
mmol/L, K 3.8 mmol/L, Ca 8.2
mg/dL, Mg 1.8 mg/dL, Glu 106
mg/dL, Cr 0.7 mg/dL, Alb 2.5
g/dL, CPK 31UI/L, mioglobina
<30 ng/mL, TSH 1.76 uUI/
mL, VSG 20 mm/s, PCR <0.3
mg/dL, factor reumatoide y
AAn (-). Vit B12 1392 pg/mL.
VIH, VHB y VHC (-). LCR normal, sin bandas oligoclonales.
RMN de encéfalo, columna
cervical, dorsal y lumbar con
protrusión de L4-L5, sin compromiso de canal medular.
EMG y potenciales evocados
con desnervación e inestabilidad en membrana celular
neuropática. Se inició Riluzol
100mg/día. Evolucionó a las 6
semanas con disfagia, disartria
y pérdida de peso de 6 kg.
Presentó neumonía por bron-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
coaspiración con insuficiencia
respiratoria, culminando en el
fallecimiento. Comentarios:
la ELA es la enfermedad más
importante de la motoneurona
superior e inferior. Se presenta
entre los 55 y 75 años, frecuente en hombres, con una
incidencia de 2.4 casos/100
000 habitantes/año. El cuadro
clínico es variable y progresivo.
Los síntomas más comunes
dependen de la afección de las
astas anteriores de la medula
espinal, núcleos motores del
tronco encefálico y corteza
motriz. Las principales complicaciones son la neumonía por
broncoaspiración e insuficiencia respiratoria por afección del
tronco encefálico. Se debe tener un alto índice de sospecha
para diagnosticarla, apoyado
de EMG con datos objetivos de
desnervación muscular extensa
no circunscrita a territorio de
nervios periféricos. El LCR es
normal. Se necesita RMN para
descartar otras lesiones neurológicas. El Riluzol reduce la
muerte excitotóxica neuronal
lo que puede extender la supervivencia en un 12% a 18
meses. Conclusiones: la ELA se
debe considerar como diagnostico diferencial en trastornos
neuropáticos rápidamente
progresivos. A pesar del tratamiento el pronóstico es malo.
Secuestro pulmonar en un
paciente adolescente. Reporte
de un caso
Luis Francisco Valdés Corona,1 P
Soberanis Piña,1 J Pedroza Gra-
nados,2 C Del Bosque Patoni,3 F
Videgaray Ortega4
1
Servicio de Medicina Interna
2
Servicio de Neumología
3
Servicio de Radiología
4
Servicio de Infectología
Hospital Ángeles Lomas, Huixquilucan, Estado de México
Introducción: el secuestro pulmonar es un padecimiento que
rara vez se diagnostica en el
adulto. Es una malformación
congénita poco frecuente, caracterizada por un segmento
anormal de tejido broncopulmonar irrigado por una arteria
anómala de origen sistémico.
Presentamos el caso de un paciente adolescente que ingresó
al hospital con diagnóstico de
absceso pulmonar, se realizaron
estudios de imagen en donde
se demostró la presencia de
un secuestro pulmonar, que
fue resuelto quirúrgicamente.
Caso clínico: paciente masculino de 15 años de edad, sin
antecedentes médicos. Acudió
al servicio de urgencias por tos
con expectoración purulenta de
5 días de evolución, asociado a
cefalea, fiebre, artralgias y debilidad generalizada. A su ingreso
se encontró temperatura de 39º,
taquipnéico, diaforético y con
precordio hiperdinámico. A la
exploración física se encontró
un síndrome de derrame pleural
izquierdo y algunos estertores
crepitantes. En los estudios de
laboratorio e imagen se encontró leucocitosis con neutrofilia,
elevación de la proteína C y
una opacidad bien delimitada
en la base pulmonar izquierda.
Con objetivo de caracterizar la
lesión, se realizó una tomografía
en donde se reportó inicialmente una imagen sugerente
de absceso pulmonar. Ante la
sospecha de secuestro pulmonar
se realizó una angioresonancia
magnética en donde observó
un vaso anómalo transdiafragmático originado en la aorta
abdominal, que irrigaba la imagen consolidada y cavitada
sugerente de absceso. Se realizó resección de la lesión, sin
complicaciones durante su procedimiento, recibió tratamiento
con ceftriaxona y clindamicina y
fue egresado diez días después.
Evolucionó a la mejoría, con
espirometría normal a los 3
meses de operado. Discusión:
el secuestro pulmonar, ya sea
intralobar o extralobar, es un padecimiento raro, que se puede
presentar en distintas etapas de
la vida sin dar manifestaciones
clínicas. Es habitualmente diagnosticado en la infancia y menos
frecuente en el adolescente y
adulto. Esta patología se debe
considerar ante la presencia de
neumonías recurrentes o abscesos pulmonares en pacientes sin
factores de riesgo o neumonías
no resueltas.
Síndrome de Hammans con
compromiso a canal raquídeo.
Revisión de un caso
Ariadna Aguiñiga Rodríguez, Joel
Alonso Cortez Sarabia, Czestochowa Del Moral Stevenel,
Yazmin Moctezuma Montaño,
José Guadalupe Hidalgo Delga-
S61
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
do, Ramón García Díaz, Octavio
Duarte Flores, Dalia María Dueñas Tamayo, Tannya Velázquez
Gaspar
Medicina interna, Hospital General de Zona 48 San Pedro
Xalpa, IMSS, México, DF
Introducción: el síndrome de
Hammans se define como la
presencia de aire en el mediastino, no asociada a causa
traumática, iatrogénica o enfermedad pulmonar subyacente,
poco frecuente. Edad media
de presentación: 25 años. subdiagnosticado en pacientes con
dolor agudo torácico o cervical
en forma aislada. Descripción
del caso: femenino de 16 años
de edad. Realiza actividad física
moderadas desde hace un mes,
alcohol ocasional. Niega drogas
ó tóxicos, Inicia dos días previos
a su ingreso con: odinofagia,
tos, no cianozante, emetizante ni disneizante, recibiendo
por facultativo antimicrobiano
sin mejoría. Evoluciona al día
siguiente con aumento en la
intensidad de la tos, constante y
disneizante por alrededor de 4
a 5 horas. Media hora después
presenta enfisema subcutáneo
en región paraesternal, que abarca la cara anterior de tórax; por
la tarde involucra cuello hasta
borde inferior de mandíbula,
acude al servicio de urgencias
en donde se realiza radiografía
de tórax PA y lateral de cuello,
descartando neumotórax. A la
exploración física resalta chasquido pericárdico de Hammans,
con Tomografía de tórax que
S62
muestra aire en tejido celular
subcutáneo de región temporal
derecha, regiones cigomáticas
y maseteros, en cuello, tórax,
axilas, miembros torácicos y
conducto raquídeo, así como
neumomediastino y enfisema
en lóbulos superiores de ambos pulmones. Es tratada de
manera conservadora oxígeno
suplementario con mejoría del
cuadro a las 78 horas desde su
inicio, corroborando remisión
del mismo a los 15 días por tomografía, sin evidencia de aire
en estructuras mencionadas.
Comentarios: realizar la revisión
de una patología de exclusión,
de menos de 200 casos en
américa, resaltando la espectacularidad de las imágenes
del caso dado que involucran
estructuras poco comunes(canal
raquídeo). Conclusiones: síndrome de Hammans requiere
diagnóstico clínico y radiológico, se exige evidencia radiología
de presencia de mediastino y la
exclusión de cualquier causa de
neumomediastino espontaneo.
Tiene una buena evolución con
resolución por lo general dentro
de los primeros 5 días con tratamiento conservador.
Síndrome de Osler Weber
Rendu
Evelín García Barboza, Roberto
Rivelino López Anguiano, Fernando Flores Trujillo
Instituto Nacional de Enfermedades Respiratorias, México, DF
Introducción: el síndrome
de Osler Weber Rendu es un
padecimiento multiorgánico
autosómico dominante causado por defecto en la proteína
transformadora del factor de
crecimiento, resultando en
una displasia fibrovascular con
telangiectasias y malformaciones arteriovenosas. Prevalencia
de 10-20 por cada 100,000
individuos en la población
general. Descripción del caso:
femenino de 17 años, sin antecedentes heredofamiliares
de importancia. Inicia hace 4
años con hemoptisis en 2 ocasiones de aproximadamente
250 ml cada una, de un año
de diferencia con remisión
aparente; disnea progresiva
hasta MRC 3; dos meses previo
a su ingreso expectoración con
estrías sanguinolentas y dolor
de miembro pélvico izquierdo; un mes después caída de
su plano de sustentación con
contusión en región frontal,
epistaxis, nausea, vómito y
deterioro neurológico requiriendo VMA por 10 días por
EVC hemorrágico. Es referida
al INER al ingreso cianosis peribucal, telangiectasias en vía
aérea superior, disminución de
ruidos respiratorios en región
infraescapular izq, extremidades hipotróficas, acropaquias.
Saturación 87% con mascarilla
facial a 5 lts/min. Se realiza
angioTAC de tórax con malformación arteriovenosa en
lóbulo inferior izq, TAC de
cráneo con trombosis venosa
longitudinal superior y US
Doppler de miembro pélvico
izq: TVP. Ecocardiograma: FEVI
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
48% y cortocircuitos, trombo
adherido móvil en aurícula derecha; Cateterismo evidencia
fístula arteriovenosa pulmonar
de gran magnitud, severa dilatación de la vena pulmonar
inferior izq. La difusión de
monóxido de carbono (DLco)
20 ml/mmHg/min, gammagrafía V/Q; ventilación: izq. 35%,
der. 64.93%, perfusión: izq.
31.95%, der. 68%. Cerebro con
positividad para fístula arteriovenosa. Se realizó lobectomía
izq. inferior para corrección de
fístula. Comentarios: Paciente
que presenta telangiectasias,
acropaquias, desaturación y
malformación arteriovenosas,
con complicaciones de sangrado y trombosis; cumpliendo
3 de los 4 criterios para enfermedad de Rendu-Osler-Weber.
Conclusiones: aunque es una
enfermedad infrecuente el
impacto que tiene en el estilo
de vida del paciente es importante, considerando que
el inicio de la enfermedad es
entre los 20 y 40 años. Debe
sospecharse ante sangrado de
mucosas recurrente, espontáneo o por traumatismo menor,
siendo la epistaxis la forma más
frecuente 80%, seguida de la
hemorragias gastrointestinales
10 a 40%, genitourinarias,
pulmonares e intracraneales
<10%. Asociado con fístulas
arteriovenosas.
Síndrome de encefalopatía
posterior reversible (PRES)
asociado a inmunosupresores.
Reporte de un caso clínico
Jaime Enrique Hernández Utrera, Claudia Monreal Alcántara,
Devora Adalid Arellano
Servicio de Admisión Continua,
UMAE Hospital de Especialidades Dr. Antonio Fraga Mouret,
Centro Médico Nacional La
Raza, México, DF
Introducción: el PRES es una
entidad descrita por Hinchey
en 1996, que tiene manifestaciones neurológicas en grado
variable asociados a edema
cerebral posterior hemisférico
transitorio, visible en las imágenes neurológicas. Descripción
del caso: paciente femenina de
46 años de edad, con antecedente de portadora de leucemia
mieloide aguda M4. Inicia
padecimiento al continuar con
protocolo de trasplante de medula ósea con presencia de un
cuadro de neumonía adquirida
a la comunidad y datos de sepsis, con estudios de imagen de
consolidación basal, así como
derrame pericárdico mínimo,
se inicia esquema ARC y etopósido sin embargo con presencia
de colecistitis edematosa aguda
decidiéndose colecistectomía,
con evolución favorable continuando con protocolo se
decide radioterapia corporal
total y realizándose trasplante
de medula ósea haploidentico,
se maneja además con factores
estimulantes de colonias de
tipo filgastrim y tacrolimus,
sin embargo con presencia de
alteración del estado de alerta
así como aumento de cifras tensionales, presentando además
cuadro de crisis convulsiva de
tipo tónico-clónicas generalizadas que no remiten con
benzodiacepinas por lo que se
decide manejo avanzado de
la vía área, estudio de imagen
con zona de hipodensidad a
nivel occipital izquierdo así
como RMN con datos de edema posterior bilateral así como
micro hemorragias parietales
de menos de 5 mm. Discusión
y comentario: dentro del contexto de esta paciente como
observamos la presencia de
un síndrome de PRES dentro
de las múltiples agentes causales pueden ocasionarlo es
el trasplante de medula ósea,
inmunosupresores (tacrolimus,
micofenolato), quimioterapia a
dosis altas, como vemos nuestra paciente reúne varios datos
que favorecen la presencia de
dicha situación, manejándose
cifras tensionales, edema y
convulsiones, y lo más importante suspender fármacos
causales obteniendo respuesta
inmediata ante dicha suspensión así como reversibilidad,
aunque depende del tiempo
de establecimiento y accionar
ya que las reversibilidad a
veces no es total y teniendo
complicaciones con una tasa
de recurrencia mínima.
Neuropatía óptica isquémica
anterior no arterítica: manifestación inicial de síndrome
antifosfolipídico en una mujer
de 35 años
L Ramírez Gómez, 1 G Pérez
Bustamante,1 F Vásquez Ma-
S63
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
nuel,1 S Galindo Feria,2 D De
Los Ríos Obregón,3 D Magos
Rodríguez, 4 R Williams De
Roux,4 F Vega Boada4
1
Departamento de Medicina
Interna, Hospital Regional de
Alta Especialidad de Oaxaca,
Oaxaca de Juárez, Oax.
2
Departamento de Reumatología
3
Departamento de Oftalmología
4
Departamento de Neurología
Instituto Nacional de Ciencias
Médicas y Nutrición Salvador
Zubirán, México, DF
Introducción: la neuropatía
óptica isquémica anterior no
arterítica (NOIANA) es un infarto parcial o total de la cabeza
del nervio óptico por deficiente
irrigación de las arterias ciliares
cortas posteriores. La prevalencia de enfermedad ocular
en pacientes con síndrome
antifosfolípidos primario ha
sido reportada en un 29% pero
la NOIANA como primera
manifestación es rara con solo
algunos reportes aislados en la
literatura. Descripción del caso:
mujer de 35 años de edad sin
antecedentes personales, hematológicos ni obstétricos de
interés. En el año 2007 debutó
con disminución de la agudeza visual, dolor periorbitario
izquierdo y cefalea. Recibió
tratamiento con prednisona
10 mg c/24 h durante un año.
Evolucionó con repercusión
importante en la campimetría.
Dos nuevos episodios de afección visual ocurrieron en el año
S64
2011 y 2013 respectivamente.
Se inició tratamiento hospitalario con metilprednisolona 1
gr IV c/24 hrs por 3 dosis con
mejoría de la agudeza visual,
no así de la campimetría. Oftalmología determinó neuritis
óptica retrobulbar izquierda
con excavación bilateral del
nervio por fundoscopía. Resonancia magnética de órbitas
con marcada disminución del
grosor del nervio óptico izquierdo y perineuritis periorbitaria,
sin lesiones desmielinizantes,
neuroeje normal. Campos visuales con escotoma central y
nasal izquierdo. Campimetría
con defecto arcuato denso
izquierdo, agudeza visual ojo
izquierdo 20/200 sin corrección
con estenopeico. Ojo derecho,
discreto escotoma inferior sin
repercusión con agudeza visual
normal. Fondo de Ojo izquierdo
con papila pálida y excavación
amplia, disminución del brillo
foveolar y pérdida de células
ganglionares. Analítica básica
de estudios de laboratorio y
para causas infecciosas normales. Anti NMO-IgG AQP4
negativos, bandas oligoclonales
en LCR ausentes. Anticoagulante lúpico negativo, DNAdc, Anti
Ro, ANCAc Negativos. Anticardiolipinas positivos con IgG
10.4 (normal <8.4), IgM: 29.7
(normal <13.1), Anti-B2GP1
IgG: 4.6 (normal <8.4), IgM:
21.3 (normal <14.3), siendo
confirmados a las 12 semanas.
Conclusiones: el debut clínico
con neuropatía óptica isquémica anterior no arterítica en
el síndrome antifosfolípidos
es un hallazgo infrecuente, sin
embargo en todos los pacientes
con neuropatía óptica de etiología incierta se recomienda
un abordaje en búsqueda de
síndrome de anticuerpos antifosfolípidos primario ya que
la detección temprana y tratamiento son la mejor forma de
prevenir la mayor morbilidad y
mortalidad.
Síndrome de Bruns. Reporte
de un caso
Carolina C Ramírez Gómez,
J Orozco Paredes
Unidad de Neurología, Hospital
General de México, México, DF
Introducción: en 1906, Ludwig
Bruns describió un fenómeno
caracterizado por cefalea muy
intensa, asociado a síndrome
vestibular agudo, desencadenado por movimientos bruscos
de la cabeza y que, en ocasiones, podía tener un desenlace
infausto, llevando al coma, e
incluso la muerte. Las principales causas de este síndrome
son lesiones intraventriculares
móviles y deformables, que dan
lugar a obstrucciones episódicas
e intermitentes en la circulación
del líquido cefalorraquídeo,
produciendo elevación de la
presión intracraneal por un
mecanismo valvular. Las causas
de este fenómeno son tumores
de la línea media del cerebelo
y tercer ventrículo, pero sin
duda la causa más común es la
cisticercosis. La neurocisticercosis es una de las patologías
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
más frecuentes en los servicios
neuroquirúrgicos de los países latinoamericanos, la OMS
reporta más de 50mil muertes
cada año y la incidencia en
países endémicos se reporta
hasta de 3.6 por ciento. Caso
clínico: masculino de 29 años,
comerciante, sin antecedentes
de importancia, cuadro de un
mes con cefalea frontal punzante, 8/10 en EVA, intermitente,
exacerbada con movimiento
cefálico. Un día previo a su ingreso aumento en la intensidad
de la cefalea, acompañada de
náuseas y vómito, bradilalia
y de forma súbita pérdida del
estado de despierto durante
aproximadamente 30 minutos.
A la exploración se evidencia
somnolencia y síndrome de
Parinaud por limitación a la
supraversión de la mirada, signo
de Collier e hiporreflexia pupilar. Se realiza TC de cráneo en
la que se observa NCC múltiple,
con lesión en cuarto ventrículo.
El paciente fue sometido para
extracción de cisticerco intraventricular, con mejoría del
cuadro. Discusión: la neurocisticercosis ventricular es una
forma rara de presentación en
comparación a otras formas, los
quistes suelen ser únicos, y el
lugar habitual de localización
es el cuarto ventrículo, la complicación más común en estos
casos es la hidrocefalia obstructiva intermitente posicional
que produce aumento episódico de la presión intracraneal
por efecto de válvula, lo cual
llega a ser mortal. Aunque ha-
bitualmente consideramos a la
neurocisticercosis una enfermedad “benigna”, contemplando
como la manifestación más
común de la misma a la epilepsia, debemos tener en cuenta
otros cuadros de presentación
menos común, pero con mucho
impacto en la mortalidad del
paciente.
Ataque isquémico transitorio
como manifestación inicial de
metástasis cerebral por mixoma auricular
Nubia Delil Osorio Jáuregui,
Leonardo René Hernández Matamoros, Roberto Flores Trejo
Servicio de Medicina Interna,
Hospital General Dr. Fernando
Quiroz Gutiérrez, ISSSTE, México, DF
Introducción: los tumores cardiacos primarios representan
< 0.5% de todos los tumores, de su estirpe benigna, el
mixoma es el más frecuente.
Este se manifiesta con al menos un elemento de la triada
clásica: obstrucción cardiaca,
embolismo o síntomas constitucionales, lo cual condiciona
que mimetice una diversidad
de enfermedades. Descripción
del caso: femenina de 45 años.
Acude por cuadro de focalización neurológica de más de 24
horas. Antecedente de ataque
isquémico transitorio un mes
previo. Exploración física, con
galope ventricular constante, y
síndrome piramidal izquierdo.
TAC de cráneo: con metástasis
cerebral, edema perilesional
que oblitera el ventrículo lateral
ipsilateral, zona de isquemia
en hemisferio derecho. TAC
de tórax muestra lesión única
bilobulada ocupando el 30%
de aurícula izquierda y con
protrusión de la masa hacia
ventrículo izquierdo. El ecocardiograma transtorácico con
FEVI 63%, masa multilobulada
de bordes irregulares, no homogénea pediculada, dependiente
de septum interauricular de
69x9x31 mm, área de 16.7 cm2,
hipermóvil. Se realiza cirugía
de tórax con resección de masa
de aurícula izquierda. Reporte
de patología confirmatorio de
mixoma cardiaco. Comentarios: el mixoma cardiaco
representa un reto diagnóstico, tanto por la rareza de
incidencia de los tumores cardiacos primarios como por sus
múltiples cuadros clínicos, condicionantes de una morbilidad
y mortalidad significativa. La
diversidad de manifestaciones
es secundaria a: obstrucción
de la válvula mitral que puede
variar su manifestación desde
un síncope hasta una falla
cardiaca; mediante embolismo
pulmonar o sistémico, virtualmente puede enviar metástasis
a cualquier órgano; síntomas
sistémicos que mimetizan enfermedades autoinmunes. La
resección quirúrgica es el tratamiento definitivo, con una
mortalidad perioperatoria del 1
al 5%, sobrevida postquirúrgica
no difiere significativamente de
la población general. Conclusión: es importante buscar la
S65
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
etiología de un EVC, ya que su
incidencia es alta y su etiología
muy diversa, desde problemas
vasculares secundarios a enfermedades endémicas como la
diabetes e hipertensión, hasta
causas infrecuentes como un
tumor intracardiaco. El no tener
en consideración diagnósticos
diferenciales, como el mixoma,
es una omisión que aumenta
la morbilidad y mortalidad de
una patología curable mediante
procedimiento quirúrgico.
Síndrome de Rendu-OslerWeber
Guadalupe Gómez Ochoa, M
López Cruz, G Ordoñez Vázquez, G Pérez Bustamante
Medicina Interna, Hospital
Regional de Alta Especialidad
de Oaxaca, Oaxaca de Juárez,
Oaxaca
Mujer de 34 años, residente
de Oaxaca, casada, enfermera,
previamente sana; recibió atención en el HRAEO por absceso
de glúteo y muslo izquierdo,
complicado con fascitis necrotizante y mionecrosis por
Escherichia coli blee y Enterococo faecalis, tuvo choque
séptico y ameritó fasciotomia
e ileostomía. Cuatro meses
después reingreso por síndrome febril, cefalea intermitente,
desorientación, falta de coordinación en hemicuerpo derecho.
La tomografía evidenció absceso en región parietoccipital
izquierda por lo que fue sometida a craniectomía, drenaje de
absceso y capsulectomía. Con
S66
reporte de Citrobacter freundii,
Clostridium bifermentans, Enterococcus faecium en cultivo de
absceso, concluyó tratamiento
sin secuelas neurológicas; la
tomografía de abdomen, endoscopia y ecocardiograma
sin alteraciones. Año y medio
después acudió al servicio de
urgencias por cefalea intensa
sin focalización ni irritación
meníngea, la tomografía de
cráneo simple mostró lesión
sugestiva de abscesos a nivel
frontal de aproximadamente
15 mm, edema perilesional y
encefalomalacia parietooccipital izquierda que no respondió
a terapia antimicrobiana por
lo que se realizó craniectomía
frontal izquierda y drenaje de
absceso con capsulectomía
documentando nuevamente en
cultivos de absceso enterobacterias. Ante la recurrencia de
abscesos cerebrales solicitamos
angiotomografía de tórax que
evidenció lesiones vasculares
en lóbulos inferiores las de
mayor tamaño en el izquierdo.
Al reinterrogatorio dirigido; la
paciente refirió que su padre e
hijo tienen episodios recurrentes de epistaxis, telangiectasias
en labios y lengua, además la
paciente desde la infancia tuvo
epistaxis recurrente. En la exploración encontramos lesiones
puntiformes telangiectásicas
en dorso de la lengua, cara
interna de labio inferior, tronco
y extremidades, se auscultó
también soplo subescapular
izquierdo. El ultrasonido de
hígado, ecocardiograma y
panendoscopia fueron normales. Concluimos síndrome
de Rendu-Osler-Weber. Se ha
realizado embolización de
MAVs pulmonares sin complicaciones. La telangiectasia
hemorrágica hereditaria o síndrome de Rendu-Osler-Weber
enfermedad autosómica dominante caracterizada por
múltiples telangiectasias en piel
y mucosas, asociadas a MAVs
en distintos órganos como pulmón, tubo digestivo y cerebro,
las complicaciones como el
caso de la paciente con MAVs
pulmonares fueron abscesos
que son menos comunes.
Síndrome de Charcot-Marie
Tooth: reporte de un caso
Juan Ramón García Díaz, A
Aguiñiga Rodríguez, T Velázquez Gaspar, JO Duarte Flores,
DM Dueñas Tamayo, C Del Moral Stevenel, JA Cortés Sarabia
Medicina Interna, Hospital General de Zona núm. 48, IMSS,
México, DF
Introducción: el síndrome de
Charcot-Marie Tooth es una
neuropatía sensitivo motora hereditaria, generalmente
autosómica dominante, cuya
incidencia es de 17 casos
por cada 100,000 habitantes.
Existen más de 30 genes implicados, además de varios
subtipos que caracterizan la enfermedad. Presentamos el caso
de un paciente con afectación
motora, el cual se protocolizó
y se llegó a este diagnóstico.
Masculino de 35 años de edad,
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
con antecedentes familiares por
rama paterna con neuropatía
sensitivo motora no especificada. Inicia su padecimiento a
los 18 años con pérdida de la
fuerza en musculatura distal de
miembros pélvicos, progresiva,
que limitaba las actividades
cotidianas. Decide acudir a rehabilitación física, sin mejoría.
Un año después, continua con
pérdida de la fuerza muscular,
agregándose al cuadro hipoestesia plantar bilateral, que
dificultaba completamente la
deambulación. A la exploración
física presenta tono muscular
disminuido, con hipotrofia en
musculatura de extremidades
superiores, de predominio en
interóseos de ambas manos y
región distal de miembros pélvicos, con hipoestesia en guante
en las 4 extremidades, arreflexia
generalizada, pie cavo y marcha
en stepage. EMG: polineuropatía sensorial y motora severa
tipo degeneración axonal y desmielinización segmentaria de
predominio en manos. Es valorado por servicio de genética,
quien realiza estudio molecular,
el cual reporta duplicación
del Gen PMP22, confirmando CMT1A. Conclusión: el
síndrome de Charcot-Marie
Tooth es una neuropatía hereditaria, cuya variedad más
común es la CMT1A, en la
cual los pacientes presentan,
principalmente, debilidad de
predominio distal, así como
pie cavo con marcha equina.
Nuestro paciente presenta estas
y otras características típicas
de la enfermedad, confirmando el diagnóstico por estudio
genético. Esta enfermedad no
tiene tratamiento definitivo,
únicamente sintomático y rehabilitación, con un pronóstico
malo para la función.
Síndrome de Klippel-Trenaunay-Weber y trombosis venosa
cerebral. Reporte de caso
Rodolfo Ramírez del Pilar, María
Berenice Rodríguez y Rodríguez, Araceli Cruz Rodríguez,
Teresa Ivonne Gonzaga López,
Mónica Gonzaga López, Manuel Martínez Ramos Méndez,
Luis Javier Castro D´Franchis,
Abraham Emilio Reyes Jiménez,
M Labastida Bautista
Servicio de Medicina Interna,
Hospital Central Norte, Petróleos Mexicanos, México, DF
Introducción: el síndrome
de Klippel-Trenaunay-Weber
(KTW) es una malformación
congénita de etiología asociada
a un defecto en la mutación
del gen VG5Q, translocación
cromosomal t(5;11). Se caracteriza por la tríada de: angiomas
cutáneos en color vino de
oporto, inicio temprano de
varicocidades, hipertrofia de
tejidos blandos y/u óseos de
un miembro (por lo general
miembro pélvico derecho),
otras anomalías asociadas: asimetría facial, pie equino-varo,
hemangiomas cutáneos, linfangiomas, angiomatosis de colon
y/o vejiga, tumor de Wilms
bilateral, astrocitoma, malformaciones genitourinarias,
linfáticas, embolia pulmonar,
varices retinianas, esplenomegalia, etc. Descripción del
caso: femenino de 47 años,
tabaquismo positivo (IT 0.5).
Portadora de KTW. Safenectomía a los 45 años. Niega uso de
anticonceptivos orales. Inicia
en febrero 2014 por cefalea
occipital 8/10 opresivo, sin
irradiaciones, acompañada de
dolor de miembros pélvicos de
intensidad 8/10, se diagnosticó infección urinaria siendo
tratada, incrementándose la
intensidad de la cefalea a 9/10
se agrega asimetría facial por
edema de tejidos blandos en
hemicara derecha, piernas con
fuerza muscular 5/5, REM ++,
con múltiples telangiectasias
bilaterales y manchas rojo
vinosas, la pierna derecha
con aumento de volumen,
limitación y dolor de los arcos
de movimiento. Paraclínicos:
leucocitos 4.700, 87% neutrófilos, 5% linfocitos, hemoglobina
10.9 g/dL, hematocrito 32%,
327,000 plaquetas, glucosa 71
mg/dL, urea 21 mg/dL, creatinina 0.36 mg/dL, EGO: leucocitos
100, proteínas y nitritos negativos. IRM de encéfalo, con
gadolinio, reporta trombosis del surco del seno sagital
superior, con malformación
vascular. Comentarios: a través
de una búsqueda de Medline
se comentan implicaciones
neurológicas como neuropatía periférica, anastomosis
arteriovenosas microscópicas
epineuriales, ampliación del
nervio ciático, fístula arterio-
S67
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
venosa cerebral, aneurismas
intracraneales. Conclusiones:
aunque se han informado varias
manifestaciones neurológicas
asociadas al KTW no se ha
divulgado previamente la asociación con trombosis venosa
cerebral en pacientes con este
síndrome.
Mielitis transversa por virus
herpes simple en paciente inmunocompetente
Tannya Velázquez Gaspar, José
Nazario López Taboada, Juan
Ramón García Díaz, José Octavio Duarte Flores, Dalia María
Dueñas Tamayo, Joel Alonso
Cortés Sarabia, Czestochowa
Del Moral Stevenel
Servicio de Medicina Interna,
Hospital General de Zona núm.
48, IMSS, México, DF
Introducción: el síndrome
medular completo es una de
las afecciones más graves y discapacitantes a nivel mundial,
una de las etiologías engloba
los procesos inflamatorios
como la mielitis transversa. El
virus herpes simple raramente
se ha reportado como causa
infecciosa en pacientes sin
compromiso inmunológico.
Objetivo: presentar un caso
de mielitis transversa postinfecciosa en paciente joven sin
factores de riesgo para inmunodeficiencia, con recuperación
satisfactoria por diagnóstico
y tratamiento oportuno. Caso
clínico: masculino 16 años de
edad, sin antecedentes patológicos, sin antecedentes tóxicos.
S68
Inicia 5 días previos con debilidad de miembros inferiores,
torpeza para la deambulación
y posterior con imposibilidad
para mantener la bipedestación, incontinencia urinaria y
con hipoestesias a partir de región umbilical. Días previos a
su ingreso se refiere con IVRA.
A su ingreso se encuentra
hemodinámicamente estable,
sin datos de dificultad respiratoria, cardiopulmonar sin
compromiso aparente, EFNL;
funciones mentales conservadas, NCs normales. Sistema
motor; eutonismo y eutrofismo,
fuerza en MTs 5/5 fuerza en
MPs 0/5, REM MTs++/++++
MPs 0/++++, respuesta plantar
indiferente, nivel sensitivo en
L1 en la modalidad superficial,
palestesias y posición articular
abolida de manera bilateral,
signos meníngeos ausentes.
Gabinete: CR 0.8, K 4.9, HGB
16.4, HTC 48.5, leuc 7,2, neut
69%, linf 20%, herpes IgM
1.25, CMG 0.3. Anti VHC 0.1,
HIV 0.06, ANAS-, ANTI DNA
34, C3 130, C422, PCR 4.0,
LCR: pleocitosis linfocítica.
PCR en LCR para herpes tipo
1 positivo. Resonancia magnética: imagen hiperintensa
de C7-T2 con ensanchamiento medular. Comentario: la
mielitis transversa representa
una de las complicaciones en
infecciones virales con poca
incidencia; 1-5 por cada millón
de habitantes, el virus herpes
simple se ha reportado raramente como causa de mielitis.
Una prueba PCR positiva en
LCR siguiere hasta en un 98%
que la mielitis esta relacionada
con la infección viral. Se ha
observado que el diagnóstico
temprano y el tratamiento
oportuno disminuyen el daño
a sistema nervioso central,
mejorando la supervivencia y
reduciendo las secuelas.
Intoxicacion subaguda por
arsénico. Reporte de caso y
revisión de la literatura
Eduardo Fernández Campuzano,1 Valentín Trujillo,2 Aili García
Tuomola2
1
Médico Internista
2
Residente de Medicina Interna
Servicio Medicina Interna, Hospital ABC Santa Fe, México, DF
Introducción: el arsénico es
un elemento metaloide que
se encuentra en la tierra y
cuya exposición en humanos
es secundario a exposición
a fuentes como pesticidas,
agua contaminada, alimentos
contaminados y cristales y
metales. Es incoloro e inodoro
y su exposición crónica provoca una toxicidad subaguda
caracterizada por afección
dermatológica, neuropatía y/o
hepatotoxicidad. Descripción
del caso: masculino de 54 años
de edad sin antecedentes médicos de importancia, el cual
acude a consulta por presentar
cuadro caracterizado por astenia, parestesias en manos y
plantas y pérdida de pelo en
piel cabelluda y cuerpo. A la
exploración física, signos vitales normales, extremidades
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
con presencia de parches sin
vello corporal y alopecia difusa, sin patrón androgénico
o placa, cuero cabelludo sin
afección o presencia de placas,
disminución de sensibilidad en
región distal de extremidades
con fuerza conservada. En el
abordaje de alopecia y dermatosis se descartaron afecciones
tiroideas, déficits hormonales,
diabetes, infecciones. Se realiza nuevamente interrogatorio
acerca de exposiciones ambientales donde se encuentra
que el paciente realiza nado
diario en alberca personal que
se mantiene con agua tratada
en pipas de poblaciones del
Estado de México, por lo que
se solicitan niveles de metales
pesados, encontrandose positivo en suero niveles de arsénico.
Comentarios y Conclusiones:
la intoxicación por arsénico
es una causa poco frecuente
de alopecia y neuropatía, al
descartar las etiologías más
comunes se resalta la importancia del interrogatorio y
la necesidad de continuar la
búsqueda del diagnóstico con
etiologías menos comunes. En
nuestra revisión discutimos
generalidades clínicas de la
patología, así como su abordaje
y tratamiento.
Presentación atípica de trombosis venosa cerebral: reporte
de caso
We n dy Jo s e f i n a S a n t i l l a n
Fragoso, Dinorah Alemán Domínguez, Albino Bautista Cano,
Dulce Valeria Copca Nieto,
Maricarmen Lagunas Alvarado,
Diana Sarai López González,
Luis Raul López y López, Rodolfo Ramírez Del Pilar, María
Laura Rodríguez Rosales
Servicio de Medicina Interna,
Hospital Central Norte Petróleos Mexicanos, México, DF
Introducción: la trombosis
venosa cerebral es una causa
rara, que representa el 3% de
eventos vasculares cerebrales,
potencialmente fatal sobretodo
en mujeres jóvenes, que requiere un abordaje amplio por
las posibilidades etiológicas, el
amplio espectro y curso clínico
inespecífico que puede mimetizar diferentes condiciones
clínicas. El uso de anticonceptivos orales aumenta el riesgo
de eventos vasculares, aun en
personas sin historia personal
o familiar de trombosis venosa,
siendo un factor de riesgo reportado en 15.3% de los casos.
Descripción del caso: femenino de 19 años. Tabaquismo
durante los últimos dos años a
razón de 20 cigarros por semana, sin antecedentes médicos
de importancia excepto fecha
de última menstruación hace 4
meses por ingesta de anticonceptivos orales en los últimos
6 meses. Inicia padecimiento
28 días previos a su valoración
con cefalea hemicraneana
intermitente y nausea con mejoría parcial con analgésicos
y en los últimos 5 días visión
borrosa. A su ingreso con agudeza visual en ojo derecho
20/400, ojo izquierdo 20/50,
papiledema bilateral grado IV,
hemorragias peripapilares y
parálisis de VI nervio craneal.
Punción lumbar con tensión
de apertura >400 mmH 2 O,
líquido fluido, transparente,
incoloro, glucosa 49 mg/dL,
proteínas 13 g/dL, células 3/
mm 3. Tomografía de cráneo
normal. Venorresonancia con
disminución y defecto de llenado de seno longitudinal inferior
y seno transverso izquierdo. Se
descartaron otras patologías
protrombóticas, obstrucción
mecánica e infecciones. Comentarios: la trombosis venosa
cerebral debe ser parte de los
diagnósticos diferenciales en
presencia de cefalea, visión
borrosa intermitente con papiledema bilateral y parálisis
de VI nervio craneal. La enfermedad venooclusiva cerebral
afecta de mayor a menor frecuencia los senos longitudinal
superior, transverso, sigmoideo y recto. Conclusiones: la
ausencia de flujo en el seno
longitudinal inferior y seno
transverso izquierdo confirmó
el diagnóstico de trombosis
venosa cerebral subaguda por
tiempo de evolución. Tras descartarse otros factores de riesgo
protrombóticos se atribuyó al
uso de Anticonceptivos orales.
Se eliminó la causa e instauró
tratamiento con Heparina seguido de anticoagulante oral
durante 6 meses, sin embargo
como secuela presentó amaurosis, lo cual ocurre en 2 al 4%
de los casos por retraso en el
diagnóstico.
S69
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Neuromielitis óptica (síndrome
de Devic). Reporte de un caso
Dante Rivera Zetina, Alejandro
Rivera Mora, Emmanuel Flores
Martínez, Anely Rodríguez
Fabian
Departamento de Medicina Interna, Centro Médico ISSEMyM
Ecatepec, Ecatepec, Estado de
México
Introducción: el término neuromielitis óptica (síndrome
de Devic) refiere al síndrome
caracterizado por neuritis y
mielitis. En años recientes la
condición ha aumentado el
interés entre clínicos debido a
la posibilidad de detectar inmunoglobulina sérica específica
reactiva (IgG) (NMO-IgG) en
mas del 80% de los pacientes
con NMO. Estos anticuerpos
fueron demostrados contra
AQP4 el canal de agua mas
abundante en el SNC. En el
presente trabajo se hace una
revisión de caso, así como
una revisión bibliográfica de
la enfermedad. Presentación:
paciente femenina de 26 años
de edad, sin AHF de importancia, APP neuritis óptica en
2011 y 2012 de ojos derecho
e izquierdo respectivamente
vista por los servicios de Oftalmología y Neurología en
HGM y CMIE diagnosticándose
neuritis óptica recibió 3 pulsos
de metilprednisolona 1 g/día
en ambas ocasiones presentando remisión completa de
síntomas, continuando con
prednisona 5 mg/día, carbamazepina 200 mg/día. Ingresa
S70
procedente del servicio de admisión continua en diciembre
de 2013 por síntomas 1 mes
de evolución caracterizado
por parestesias en manos y
pie, acompañado de dolor
cervical de tipo punzante de
intensidad 4/10 el cual se presentaba de manera espontanea
sin precipitantes,exacerbantes
o atenuantes y remitía con la
administración de AINEs, 1
semana previa a su ingreso
hay disminución progresiva de
fuerza de las 4 extremidades
de manera simultánea hasta ser
incapacitante motivo por el cual
acude referida de Hospital Regional. A la exploración sistema
motor con cuadriparesia con
fuerza muscular 4/5 proximal,
4/5 distal de miembros torácicos, 2/5 de miembros pélvicos
con reflejo de Babinsky bilateral, hipoestesia con nivel de
T2-T3. RMN contrastada con
gadolineo de columna con
lesiones hiperintensas en T2 en
medula reforzando a la aplicación de medio de contraste
desde la raíz del bulbo hasta
nivel de C3, lesiones hiperintensas aisladas desde C 4 hasta
C 6. Anti NMO IgG positivos
con un resultado de 79 U/
mL. Se da terapia con (metilprednisolona 1 g/día/5 días),
mejorando sensibilidad y motricidad. Se egresa con reducción
de prednisona 100 mg/día y
azatioprina 50 mg/día. Comentario: nos encontramos ante un
caso clásico de NMO el cual
fue manejado apropiadamente
y deberá llevar un seguimiento
estrecho. Conclusiones: es importante la busqueda NMO en
enfermedades desmielinizantes
pues el pronóstico de la NMO
es pobre comparado con EM y
el tratamiento enfocado podra
modificar el curso de la enfermedad.
Síndrome de Cogan: Reporte
de caso
Diego Ontañón Zurita, José Salvador López Gil, Mariam Paola
Smith Pliego, Arnoldo Kraus
Weisman
Centro Médico ABC, Servicio
de Medicina interna, México,
DF
Paciente masculino de 50 años
que inicia padecimiento en abril
del 2014 al presentar dermatosis en palmas y tórax anterior
caracterizado por maculas eritematosas. Se realiza biopsia
de piel para identificar estas
lesiones que muestran patrón
de vasculitis de pequeño vaso.
Posteriormente se agrega al cuadro hipoacusia de predominio
izquierdo con presencia de escotoma izquierdo , por lo cual se
realiza resonancia magnética de
encéfalo que muestra lesiones
desmielinizantes puntiformes.
Se sospecha el diagnostico de
síndrome de Cogan y se administra Ciclofosfamida con la
cual el paciente responde satisfactoriamente. Las lesiones que
presenta el paciente conjuntada
con la clínica nos muestra un
caso atípico de síndrome de
Cogan. Al mostrarse vasculitis de
pequeño vaso , afección ocular
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
y auditiva se tiene que descartar
síndrome de Cogan. La definición original establecía que la
enfermedad de Cogan era una
queratitis intersticial, sin antecedentes sifilíticos, acompañada
de alteración cocleovestibular
que provocaba vértigo periférico
e hipoacusia neurosensorial. Es
una enfermedad de baja incidencia que suele aparecer en
pacientes varones entre los 20 y
30 años de edad. El cuadro clínico más frecuente es el vértigo de
origen periférico que en ocasiones se acompaña de hipoacusia
neurosensorial. La evolución es
fluctuante con periodos asintomáticos. La progresión de
la hipoacusia puede provocar
sordera grave. El pronóstico está
relacionado con la instauración
del diagnóstico precoz. Sin
tratamiento casi un 75% de los
pacientes pueden presentar una
hipoacusia grave. De la misma
manera la queratitis puede provocar leucomas corneales que
precisen de transplante corneal.
Encefalomielitis diseminada
aguda relacionada a inmunización contra AH1N1: revisión
de caso
Ariadna Aguiñiga Rodríguez,
Dalia María Dueñas Tamayo,
José Octavio Duarte Flores,
Tannya Velázquez Gaspar, Juan
Ramón García Díaz, Joel Alonso
Cortés Sarabia, Czestochowa
Del Moral Stevenel
Medicina Interna, Hospital
General de Zona 48, Instituto
Mexicano del Seguro Social,
México, DF
Introducción: la encefalomielitis diseminada aguda es una
enfermedad desmielinizante
del sistema nervioso central
mediada inmunológicamente.
Aproximadamente el 5% de
los casos de encefalomielitis
diseminada aguda son precedidas de una inmunización,
realizada un mes antes del
inicio de síntomas. Esto ocurre
raramente posterior a una inmunización contra influenza.
Descripción del caso clínico:
masculino de 35 años, empleado administrativo. Tabaquismo
y alcoholismo social. Sin enfermedades crónico degenerativas.
Vacunación en septiembre del
2013 de Hepatitis e influenza
AH1N1. Inicia el 11/10/2013
con dolor abdominal en
hipocondrio derecho, a la semana debilidad y disestesias en
miembros pélvicos, predominio
izquierdo, afectando la deambulación, hasta imposibilitarla,
incontinencia urinaria y rectal.
Acalculia. Fuerza muscular en
miembros inferiores izquierdos
distal 1/5, proximal 3/5, derecho 4/5, clonus, reflejo extensor
bilateral, Trommer y Hoffman
bilaterales. Sensibilidad: nivel
sensitivo en T4. Agrafestesia y
astereognosia. Afectación de
esfínteres urinario y anal, resto
normal. Líquido cefalorraquídeo: glucosa 48 mg/dL, DHL 47
U/L, sin leucocitos. Resonancia
magnética: cráneo con lesiones
intraparenquimatosas desmielinizantes; columna con mielitis
desde C6 hasta C7. Mejoría
clínica con esteroide, estudios
de control con disminución del
tamaño de las lesiones. Comentarios: el factor precipitante
para la EMDA en el paciente
es el antecedente de inmunización, un mes previo al inicio
de síntomas, con adecuada
respuesta a esteroides y pronóstico favorable. Conclusión:
la encefalomielitis diseminada
aguda es una enfermedad típicamente monofásica que afecta
la sustancia blanca subcortical.
Suelen presentarse desde 7-14
días de una infección viral o
hasta un mes posterior a inmunización pasiva. Sin embargo,
por el número limitado de casos
relacionado a inmunizaciones,
no se ha publicado la incidencia estimada.
Síndrome de encefalopatía
posterior reversible asociado
a enfermedad renal crónica:
presentación de un caso
Rosa Elia Ramírez García, Antonio Cruz Estrada, Judith Eulogia
Delgado Yépez, Antonio González Chávez, Ariana Heredia
Arroyo, Alejandro Maya Gutiérrez
Medicina Interna, Hospital
General de México Dr. Eduardo
Liceaga, México, DF
Introducción: el síndrome de
encefalopatía posterior reversible (PRES) es un síndrome
clínico-radiológico, agudo o
subagudo, de incidencia desconocida, caracterizado por
manifestaciones neurológicas
(alteraciones visuales y del
estado mental, así como convul-
S71
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
siones), en relación a lesiones
cerebrales reversibles (edema
vasogénico) de predominio
parieto-occipital bilateral. Se
han descrito casos asociados
a encefalopatía hipertensiva,
insuficiencia renal crónica y
enfermedades autoinmunes. El
diagnóstico se realiza en base a
estos datos clínico-radiológicos
característicos. La tomografía
y la resonancia magnética
son los estudios de elección.
En la tomografía se observan
lesiones hipodensas simétricas
bilaterales, principalmente
parieto-occipitales; la resonancia magnética muestra lesiones
hipointensas en T1 e hiperintensas en T2, que corresponden al
edema vasogénico. Se presenta
un caso clínico del síndrome,
asociado a una enfermedad de
alta prevalencia en nuestro medio. Caso clínico: mujer de 22
años, con diagnóstico reciente
de enfermedad renal crónica
en tratamiento sustitutivo con
hemodiálisis. Inició 15 días
previos con diplopía, agitación
psicomotriz, desorientación,
lenguaje incoherente e incongruente y alucinaciones
visuales; posteriormente con
disminución de agudeza visual,
somnolencia y crisis convulsiva. Ingresó con descontrol
hipertensivo, con síndrome epiléptico de inicio temprano con
modelo de crisis tónico-clónico
generalizado, ceguera cortical, oftalmoplejía internuclear
bilateral, encefalopatía metabólica y síndrome discinético
no epiléptico caracterizado por
S72
mioclonías. En la tomografía
se observaron hipodensidades
en lóbulo occipital y parietal
bilateral, correspondientes a
edema vasogénico. Presentó
remisión del cuadro con el
tratamiento antihipertensivo y
hemodialítico. La resonancia
magnética de control efectuada
al mes, mostró resolución de las
lesiones. Se descartó la posibilidad de enfermedad vascular
cerebral y neuroinfección. Conclusión: PRES es una entidad
usualmente benigna, pero poco
conocida. En nuestro medio
existen múltiples enfermedades de alta prevalencia con las
que puede asociarse, como la
enfermedad renal crónica o la
hipertensión arterial sistémica.
Se considera entonces fundamental su conocimiento, para
así incrementar el índice de sospecha, ya que la mayoría de los
casos es reversible si se realiza
un diagnóstico y un tratamiento
oportunos.
Evento vascular cerebral maligno secundario a neurocisticercosis masiva subaracnoidea e
intraventricular
Nadia Monserrat Muñoz Campos, Adriana González Andujo,
Ariana Román Flores, Alberto
González Aguilar, José Juan
Lozano Nuevo
Neurología Hospitalización,
Instituto Nacional de Neurología y Neurocirugía, Secretaría
de Salud, México, DF
La neurocisticercosis puede
complicarse con vasculitis
afectando arterias de todos los
calibres. La forma más grave
ocurre cuando los quistes se
encuentran diseminados en el
espacio subaracnoideo induciendo exudados que atrapan
a múltiples arterias de la base.
La frecuencia de infarto fluctúa
entre 2 y 12% de los casos.
Masculino de 45 años diagnosticado en Julio del 2013
con neurocisticercosis subaracnoidea e intraventricular con
colocación de Sistema de derivación ventrículo-peritoneal.
Hospitalizado en noviembre
del 2013 para tratamiento con
albendazol, se realiza Doppler
transcraneal encontrándose
vasculitis en arteria cerebral anterior, se inicia tratamiento con
esteroide. Acude a cita de control donde se realiza punción
lumbar que reporta: líquido
xantocromico, células 61, proteínas 740, glucosa 5, además
de IRM con persistencia de lesiones quísticas parasitarias, por
lo que se administra nuevamente tratamiento con albendazol
durante 10 días y esteroide
15 días, siendo egresado por
mejoría. El 08.07.2014 con
vómito de contenido gástrico,
fiebre de 39 grados, agregándose somnolencia, alternada
con periodos de agitación. A su
llegada somnoliento, inatento,
desorientado, con fuerza en
hemicuerpo izquierdo (3/5),
Babinski izquierdo. Se ingresa
por probable vasculitis. Se
iniciaron bolos de metilprednisolona 1 gramo por 3 días, sin
embargo presentó crisis convul-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
sivas motoras parciales que se
generalizaron, administrando
tratamiento anticonvulsivo y
remisión de las mismas. Posteriormente comienza con
periodos de apnea y desaturación por lo que se decide
manejo avanzado de la vía
aérea para protección avanzada
de la vía aérea. El 16.07.2014
se realizó IRM con infarto
hemisférico derecho y engrosamiento cortical. Durante su
estancia hospitalaria el paciente
cursa con evolución estacionaria, dependiente de ventilador y
necesidad de procedimientos
invasivos como traqueostomía
y gastrostomía. El tipo más severo de angeítis, ocurre cuando
el cisticerco tiene una amplia
distribución en el espacio subaracnoideo, lo cual se acompaña
de cambios importantes en el
LCR y se aprecia en estadios
crónicos de la enfermedad.
Este caso muestra una de las
complicaciones más graves de
la cisticercosis, que es la angeítis cisticercosa cerebral, que
llevó al paciente a un deterioro
neurológico severo por la gran
extensión y compromiso de
las diferentes áreas vasculares
comprometidas, catalogándose
como infarto cerebral maligno.
Encefalitis paraneoplásica como
primera manifestación de carcinoma endobronquial
Jorge Ely Ortiz Balderas, Enrique
Molina Carrion, Elena Deyanira
Delgadillo Vega, Luis Francisco
Pineda Galindo, Diana Betzabe
Villalobos Ramos
Servicio de Neurología y Medicina Interna del Centro Médico
Nacional La Raza, IMSS, México, DF
Introducción: los trastornos neurológicos para neoplásicos son
síndromes vinculados con canceres que pueden afectar cualquier
parte del sistema nervioso central.
En 60% de los afectados, los síntomas neurológicos surgen antes
de que se diagnostique el cáncer.
Observándose solo en 0.5 a 1%
de todos los pacientes con cáncer.
Descripción del caso: presentamos el caso de una paciente
de 51 años de edad, quien tiene
como antecedente diabetes tipo 2
de 7 años de diagnóstico y depresión de 17 años de diagnóstico.
Quien inicia su padecimiento
con la presencia de alucinaciones visuales y auditivas, habla
incoherente evolucionando a
afasia y somnolencia que evoluciona a estupor. Valorada en
hospital psiquiátrico donde se
reducen dosis de medicación
antidepresiva. Se envía a hospital
de infectológica por sospecha
de absceso cerebral y se realiza
punción lumbar y tomografía de
cráneo que resulta normal, por lo
cual se envía a nuestra unidad,
ingresando con diagnóstico de
encefalitis para neoplásica, la
cual se confirma con la presencia
de anticuerpos anti neuronales.
La resonancia magnética de
cráneo muestra quiste temporal
aracnoideo con discreto edema a nivel de hipocampo de
forma bilateral, observándose
hiperintentos en T2 y FLAIR.
Se corrobora la presencia de
tumoración en pulmón derecho
por tomografía, realizamos broncoscopia con reporte de lesiones
infiltrativas a nivel de bronquio
de lóbulo superior derecho y
bronquio inferior izquierdo con
reporte histopatológico de carcinoma de pulmón. Comentarios:
la encefalitis límbica, se caracteriza por su variada forma de
presentación, siendo el deterioro
de la memoria reciente uno de
los síntomas predominantes, aunque también pueden observarse
síntomas neuropsiquiatricos y
crisis comiciales. En un 70% se
asocia a carcinoma de células
pequeñas. En el caso reportado
se encuentran presentes los datos
clínicos y complementarios como
son: la forma de presentación
y la presencia de anticuerpos
anti neuronales positivos lo que
nos orientó hacia el diagnostico
de encefalitis para neoplásica y
finalmente la búsqueda de tumor primario. Conclusiones: la
encefalitis límbica es por tanto,
una entidad a tener en cuenta
ante del estudio de un paciente
con síntomas neurológicos de
causa incierta, y puede ser, como
en este caso una de las primeras
manifestaciones de un carcinoma
de pulmón.
Síndrome opsoclonus-mioclonus desarrollado durante el
embarazo: reporte de caso
Aldo Gabriel Olmedo Gaytán,
Héctor Alvarado Verduzco,
Lucila Esmeralda Ruiz Jáuregui,
Israel Anaya Silva, Miguel Ángel
Buenrostro Ahued
S73
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Servicio de Medicina Interna,
Hospital Civil de Guadalajara
Fray Antonio Alcalde, Guadalajara, Jalisco
Introducción: el síndrome opsoclonus-mioclonus (SOM) es
una rara enfermedad, de etiopatogenia desconocida, asociada
a una desregulación del sistema
inmune, caracterizada por la
presencia de opsoclonos, mioclonías y ataxia troncal. En el
adulto se ha relacionado con
infecciones, tóxicos y como una
manifestación paraneoplásica.
Reportamos el caso de una
mujer joven que desarrolla este
síndrome, durante el embarazo
como único factor asociado.
Descripción del caso: femenina
de 30 años, sin conocerse con
patologías previas, cursando
su séptimo embarazo de 23.5
semanas, ingresa a nuestro servicio por presentarse siete días
previos con temblor de extremidades, incoordinación para la
marcha, y posteriormente movimientos oculares involuntarios.
La exploración neurológica
con presencia de movimientos
oculares bilaterales sacádicos,
arrítmicos y multidireccionales; movimientos mioclónicos
de todas las extremidades que
se exacerbaban a la intensión, además de dismetría,
disdiadococinesia izquierdas
y marcha atáxica. Exámenes
de laboratorio, punción lumbar, tomografía y resonancia
magnética de cráneo se reportan sin alteraciones. Se inicia
tratamiento con prednisona a
S74
1 mg por kg de peso día, con
descenso progresivo de la dosis
hasta el término del embarazo.
Posterior al inicio del esteroide
la paciente presenta mejoría
parcial del cuadro. Al término
del embarazo se encuentra
con remisión de los movimientos oculares y las mioclonías.
Comentarios: siendo una enfermedad poco común, es aún
más rara su asociación con
el embarazo, reportándose
en la literatura mundial solo
dos series de casos con tres
pacientes en las que como en
el nuestro el embarazo era el
único factor involucrado en el
desarrollo de esta patología. El
diagnóstico de esta enfermedad
es clínico, debiendo realizar
un abordaje diagnóstico de las
diferentes causas con las que
se ha asociado a este síndrome.
Respecto al tratamiento, los más
utilizados son los esteroides,
asociados o no a otras terapias
inmunosupresoras e inmunomoduladoras. Conclusiones:
en el SOM, el principal reto
diagnóstico es la búsqueda de
los factores desencadenantes,
siendo el embarazo en muy
pocos casos el asociado a la
aparición de esta enfermedad,
desconociéndose actualmente
el porqué de su desarrollo,
pero observándose que en los
casos reportados en la literatura
el cese del embarazo puede
representar la resolución de la
sintomatología.
Evento cerebrovascular isquémico secundario a neurosífilis
Eugenia Saldarriaga,1 Lina Fajardo, 1 Diana Casas, 1 Gloria
Martínez, 1 Carlos Escalante
Penagos2
1 Medicina Interna, Hospital
de La Samaritana, Bogotá,
Colombia
2
Servicio de Reumatología,
Hospital General de México
Introducción: la sífilis meningovascular representa el 10%
de los casos de neurosífilis y
menos del 1% de los casos
se comporta como un evento
cerebro vascular isquémico
(ECV), el cual puede afectar
cualquier vaso en el sistema
nervioso central. Descripción
del caso: paciente masculino
65 años, quien consulta por
cuadro clínico de 4 meses
de evolución consistente en
parestesias en hemicuerpo
izquierdo, asociado a cefalea
global, tipo punzante, en escala análoga del dolor 7/10.
Tiene antecedente de sífilis
secundaria hace 15 años sin
tratamiento. Al examen físico
presenta hemiparesia e hipoestesia en hemicuerpo izquierdo,
reflejos musculotendinosos
++/++++. TAC de cráneo zona
de isquemia en región parietal
izquierda correspondiente a
territorio de arteria cerebral
posterior izquierda, asociado a
examen de liquido cefalorraquídeo con pleocitosis linfocítica,
hiperproteinorraquia y VDRL
reactivo, por lo anterior se hace
diagnóstico de ECV isquémico
secundario a neurosífilis, y se
administra tratamiento com-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
pleto. Conclusión: la sífilis
meningovascular se evidencia
en <1% de los casos de ECV
isquémico, puede desarrollarse
en cualquier momento del curso de la enfermedad, desde los
primeros meses de la infección
hasta años después del inicio
de ésta, con un intervalo promedio de 7 a 10 años. La arteria
cerebral media y sus ramas se
comprometen el 85% de los
casos, la arteria vertebrobasilar se compromete en el 10 a
15% de los casos y con menor
frecuencia, se ve afectada la
arteria espinal anterior, lo que
provoca infartos de la médula
espinal. Por lo anterior en todos
los casos de ECV isquémico y
antecedente de sífilis, infecciones de transmisión sexual y/o
conductas sexuales de riesgo
se recomienda solicitar VDRL
ya que permite aclarar posibles
causas del evento como lo es la
neurosífilis.
Encefalitis límbica asociada a
colitis ulcerativa con hallazgos
tardíos en neuroimagen
Eduardo Martín Nares, Heriberto Ontiveros Mercado, Álvaro
López Iñiquez, Ricardo Rubio
Reynoso, Luis Arnoldo Muñoz
Nevárez, Lorena Valerdi Contreras, Miguel Ángel Pérez Aranda
Servicio de Medicina Interna,
Hospital Civil de Guadalajara
Fray Antonio Alcalde, Guadalajara, Jalisco
Introducción: la encefalitis
límbica autoinmune se caracteriza por el inicio agudo
o subagudo de convulsiones,
alteración del estado de alerta,
síntomas neuropsiquiátricos
y afectación del lóbulo temporal medial. Presentamos
el primer caso descrito de
encefalitis límbica asociada a
colitis ulcerativa con hallazgos
tardíos en neuroimagen. Descripción del caso: masculino
de 49 años con historia de
10 días con crisis convulsivas
tónicoclónicas generalizadas,
alucinaciones visuales, discinesias orofaciales y braquiales
y alteración del ciclo sueño-vigilia; el electroencefalograma
reportó actividad paroxística
desorganizada y generalizada;
el líquido cefalorraquídeo sin
alteraciones, tinciones y cultivos negativos, PCR para herpes
negativo. Los estudios de neuroimagen sin anormalidades.
Se descartó etiología metabólica e infecciosa. Posteriormente
presentó estatus epiléptico
por lo que se realizó intubación orotraqueal. Se trató con
corticoides ante la sospecha
de encefalitis límbica autoinmune. Se repitió la resonancia
magnética de cráneo en la cual
se evidenciaron hiperintensidades en ambos hipocampos
en secuencias T2 y FLAIR. Se
solicitaron anticuerpos antinucleares, antiperoxidasa,
antitiroglobulina, antigliadina,
antitransglutaminasa, anti-Hu,
anti-Yo, anti-Ri y anti-GAD
resultando negativos. No se
encontró evidencia de neoplasia. Posterior a la extubación
continúo con somnolencia y
amnesia además de presentar
bradicardia y hipoventilación
central, se sospechó en encefalitis por anticuerpos contra
el receptor de NMDA. Se trató
con plasmaféresis presentando
mejoría. El paciente presentó
diarrea y proctalgia, se realizó
colonoscopía y biopsia en la
cual se diagnosticó colitis ulcerativa. Los anticuerpos contra
receptor de NMDA resultaron negativos. Se diagnosticó
como una encefalitis límbica
asociada a colitis ulcerativa.
Comentarios y Conclusiones: la
encefalitis límbica autoinmune
se considera paraneoplásica
debido a su asociación con
diversos tipos de cáncer y autoinmune por la presencia de
anticuerpos o coexistencia con
otras enfermedades autoinmunes sistémicas. Los hallazgos
en neuroimagen pueden estar
ausentes o presentarse posterior al inicio del cuadro. El
3% de las colitis ulcerativas
presentan manifestaciones
neurológicas, sin embargo no
se encontraron casos en la literatura asociados con encefalitis
límbica.
Neuromielitis óptica (enfermedad de Devic): presentación de
un caso y revisión de la literatura
Rogelio Domínguez Moreno,
Juan Echeverría, Alonso Gutiérrez, Luis Guevara Arnal, Felipe
Vega Boada
1
Medicina Interna, Hospital
Médica Sur, México, DF
2
Neurología, Instituto Na-
S75
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
cional de Ciencias Médicas y
Nutrición Salvador Zubirán,
México, DF
Introducción: la neuromielitis
óptica (NMO) o enfermedad
de Devic es una enfermedad
desmielinizante poco frecuente que aunque tiene similitudes
con la esclerosis múltiple (EM)
difiere de forma importante
en varios aspectos que deben
considerarse para su abordaje diagnóstico y terapéutico.
Caso clínico: femenina de 25
años sin antecedentes patológicos, inicia su padecimiento
2 meses previos con parestesias en las 4 extremidades,
dos días después monoparesia de pierna derecha y
posteriormente disminución
de la agudeza visual, dolor a
los movimientos oculares así
como fotopsias en ojo derecho. A la exploración física
funciones mentales superiores
conservadas, nervios craneales normales con fundoscopia
sin alteraciones, fuerza, sensibilidad, cerebelo y marcha
normales, signos patológicos
ausentes, signo de Lhermitte
presente. Estudios de laboratorio que reportan hemoglobina
14.3 g/dL, plaquetas 177 mil/
mm3, leucocitos 8.5 mil/mm3,
proteína c reactiva 0.6 mg/
dL, examen general de orina
normal, anti ADN de doble
cadena, anti SM, anti RNP, anti
SS-A, anti SS-B, anti SCL-70,
ANCAs totales negativos, ANA
por inmunoflorescencia 1:80,
pruebas de funcionamiento
S76
renal, hepático, perfil lipídico
y electrolitos séricos normales.
Líquido cefalorraquídeo: citoquímico, citológico, tinción
gram, tinta china, bandas
oligoclonales, herpes zoster,
Epstein-Barr negativos. ELISA
IgG NMO positivo >160.
Resonancia magnética donde se observa neuritis óptica
derecha aguda así como mielitis longitudinal de más de 3
cuerpos vertebrales crónica.
Se trató a base de metilprednisolona 1 gramo intravenoso
diario por 5 días con mejoría
importante de la agudeza visual. Discusión: es importante
hacer el diagnóstico correcto
de esta entidad mediante el
uso de anti AQP4 para poder
hacer un manejo adecuado de
la enfermedad ya que como
se ha dicho el tratamiento
difiere y el uso de interferones
como en EM puede empeorar
las lesiones intracraneales y
significar un peor pronóstico.
Encefalitis límbica. Manifestación precedida a un tumor
de ovario
Al Carrillo González, D Adalid
Arellano, S Alvarado Romero
Admisión Continua-Medicina
Interna, Hospital de Especialidades, Centro Médico Nacional
La Raza, México, DF
Introducción: los síndromes
paraneoplásicos mediados por
anticuerpos ocurren cuando
ciertas neoplasias fuera del sistema nervioso central expresan
antígenos que son expresados
por las células neuronales en los
que la respuesta inmune resulta
en la producción de anticuerpos que tienen como objetos el
tumor y sitios específicos en el
cerebro. Descripción del caso:
mujer de 23 años de edad, que
inició tres meses previos a su
ingreso a hospitalización con
cuadro depresivo, disminución
de la ingesta de alimentos e
ideas de suicidio recibiendo
tratamiento con fluoxetina y
clonazepam. Ingresa al servicio
es por presentar habla incoherente, sin responder órdenes
verbales de inicio de forma
súbito, además de un temor irracional a ser portadora de artritis
reumatoide. A la exploración
física con lenguaje espontáneo,
con emisión de algunas palabras
comprensibles, con mirada en
continuo movimiento. Se realizó
panel viral con valor positivo
para memoria de rubeola y citomegalovirus. Marcador tumoral
Ca 125 mayor a 500 U/mL. En
líquido cefalorraquídeo con
reporte de 12% de linfocitos B
activados de manera anormal
y localización de células que
pueden ser compatibles con
células neoplásicas. La tomografía abdomino-pélvico con
lesión pélvica tumoral de anexo
derecho, con desplazamiento de
estructuras adyacentes. No hubo
respuesta favorable a pesar del
tratamiento a base de esteroides,
inmunoglobulina y dos sesiones
de plasmaféresis. Comentarios:
ante una encefalitis límbica se
debe buscar de forma exhaustiva
una neoplasia subyacente. En
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
algunos casos puede aparecer
posteriormente o estar presente
en una fase localizada, lo que
se ha que tener en cuenta y
realizar las exploraciones y cribado correspondiente. El mejor
tratamiento de la encefalitis
límbica paraneoplásica consiste
en el tratamiento dirigido a la
propia neoplasia subyacente;
sin embargo la respuesta es
variable, de acuerdo al tipo de
neoplasia y terapéutica empleada. Conclusiones: el presente
caso clínico pone de relieve
la importancia de una clínica
completa y la investigación
neurológica en los casos de
presentación neuropsiquiátrica
atípica. La neuroimagen es una
herramienta importante en estos
casos para demostrar estructura
funcional cerebral y la búsqueda
de anticuerpos antineuronales
en los que no se encuentre un tumor relacionado. El diagnóstico
tardío lleva a la rápida y tórpida
evolución de la patología de
base como lo ilustra en este
problema de baja frecuencia y
de difícil diagnóstico.
Síndrome de vena cava inferior
secundario a schwannoma retroperitoneal
JAJ Batún Garrido, E Hernández
Núñez, F Olán
Servicio de Medicina Interna,
Hospital Gustavo A Rovirosa
Pérez, Villahermosa, Tabasco
Introducción: el síndrome de la
vena cava inferior se caracteriza
por edema bilateral de extremidades inferiores, edema de
genitales externos y dilatación
de la red venosa en la pared
abdominal. Verocay describe
el primer tumor de nervios
periféricos, Masson introduce
el término schwannoma. Es
una neoformación originada
de las células de Schwann de
la vaina nerviosa, siendo su
localización retroperitoneal
infrecuente representa del 0.7
al 2.7%. El diagnóstico es histopatológico, el tratamiento es
la resección tumoral con márgenes libres. Descripción del
caso: femenina 42 años. Inicia
su padecimiento hace 24 meses
al presentar dolor punzante e
intermitente en hipocondrio
y flanco derecho y distención
abdominal, dos meses previos a
su ingreso se intensifica el dolor
y percepción de tumoración en
hipocondrio y flanco derecho,
aumento de volumen y dolor en extremidades pélvicas,
progresivo con dificultad para
la deambulación y edema en
genitales externos. Se realiza
USG de abdomen: tumoración
de 68x60x58 mm hipoecogénica con centro hiperecogénico
en región subhepática. TAC
abdominal: tumoración de
85x60 mm de predominio
del musculo psoas derecho a
nivel de su tercio proximal y
se expande hacia la cavidad
peritoneal, con áreas hipodensas centrales. Se realiza
LAPE encontrando tumoración
retroperitoneal de 6x8 cm, indurada, de bordes irregulares,
adosada a cara anterior de
vena cava inferior infrarrenal,
por lo que únicamente se toma
estudio histológico reportando
dos patrones de crecimiento
celular, caracterizado por células alargadas con extensión
citoplasmática dispuestas en
fascículos con escasa matriz de
estroma (Antoni A) y aéreas de
cuerpo de Veracoy, alternadas
con aéreas menos densas con
un entramado laxo (Antoni
B), sin datos de atipia o malignidad. Se realiza segunda
intervención quirúrgica con
extirpación completa de la tumoración, sin complicaciones
posoperatorias, se egresa con
seguimiento por la consulta
externa. Comentario y Conclusiones: se presenta el caso de
una paciente con el diagnóstico
de schwannoma retroperitoneal
benigno, el cual es un tumor
raro que debido a la laxitud y
flexibilidad del espacio retroperitoneal puede tener gran
tamaño, produciendo compresión de las estructuras vecinas
entre ellas la vena cava inferior.
Mesotelioma peritoneal maligno en paciente sin exposición a
asbesto: reporte de caso
C Alanis Fraga,1 MT Sánchez
Ávila,2 O Gaytan Torres3
1
Residente de segundo año de
Medicina Interna
2
Profesora de Medicina Interna
3
Servicio de Gastroenterología
Hospital San José, Tec Salud,
ISSSTE León, Monterrey, NL
Antecedentes: el mesotelioma
peritoneal es una enfermedad
rara cuya incidencia se encuen-
S77
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
tra en ascenso. Actualmente se
presenta cerca de 1 caso en 1,
000,000. Objetivos: reportar
un caso de mesotelioma sin
exposición referida al asbesto.
Reporte: masculino de 58 años
de edad. Jubilado de policía.
Diabetes mellitus 2 10 años
de evolución. HAS 5 meses de
evolución. Niega exposición a
humo de biomasa u ocupacional
a químicos. Acude tras 3 semanas de evolución con distención
abdominal y dolor tipo cólico
en todo el abdomen intensidad
2/10, el cual disminuye a la
posición de decúbito supino
acompañado de hiporexia con
disminución objetiva de 9 kg
en el mismo periodo de tiempo.
Niega alguna otra sintomatología. Acude a realizándosele US
abdominal reportando imágenes
nodulares en pared abdominal
y liquido libre. Se decide su estudio. Exploración física: signos
vitales normales. Consciente,
orientado, pupilas isocóricas
normorreflecticas, mucosas
sin alteración. Cabeza y cuello sin alteraciones. Campos
pulmonares y ruidos cardiacos
normales. Abdomen globoso,
peristalsis disminuida, renitente
a la palpación, mate a la percusión, doloroso a la palpación
en hipocondrio derecho, no se
palpan masas ni organomegalias. Extremidades con edema
leve. Laboratorios: Hg. 9.3 Hto.
29 Leu. 6.3 Plq.s 564 TP 13 TTP
29.2 INR 1.16 Glucosa 117
Creat. 0.9 BUN 16 Colesterol
167 BT 0.6 BD 0.39 FA 169
TGO 18 TGP 14 GGT 131 DHL
S78
262. Adenosin deaminasa, ACE,
Ca 19-9, Alfa feto proteínas: negativas. TC de tórax y abdomen
con contraste IV: líquido libre
abdominal. Engrosamiento de
epiplón y masas en epigastrio,
mesogastrio y flanco derecho.
Paracentesis: líquido de ascitis con exudado inflamatorio
mixto y cambios reactivos de
mesotelio. Glucosa 98 Proteínas
4840 DHL 172 glóbulos blancos
1780 células, 86% Linfos. Col
93 albúmina 1.74. Endoscopia
superior y colonoscopía: sin
alteraciones. Biopsias: inicial
negativa, segunda reportada con
células neoplásicas formando
estructuras tubulares y nidos
sólidos. Núcleos claros y pequeños nucléolos.CK7 (+) CK20 (-)
ACE (-) D-240 (+) calretinina (+)
RCC (-) Ca 19-9 (-). Diagnóstico:
mesotelioma maligno. Se inicia
cisplatino y pemetrexed, una
semana posterior desarrolla síndrome de lisis tumoral y fallece.
Conclusión: debido a la baja
incidencia de la enfermedad
y síntomas inespecíficos, su
diagnóstico no se determina en
forma temprana, lo que afecta su
tasa de supervivencia.
Enfermedad de Castleman: Reporte de un caso clínico
J E H e r n á n d e z U t r e ra , 1 C
Monreal Alcántara, 2 R Ovilla Martínez, 2 LA Reynolds
Ocampo,2 DI Calles Payan,2 A
Cabrera García A,2 RM Jiménez
Alvarado2
1
Residente de tercer año de Medicina Interna, UMAE Hospital
de Especialidades Dr Antonio
Fraga Mouret, Centro Médico
Nacional La Raza, IMSS, México, DF
2
Médico adscrito al Servicio de
Hematología, Hospital Ángeles
Lomas, México, DF
Introducción: la enfermedad
de Castleman (o hiperplasia
linfonodular angiofolicular) es
un desorden linfoproliferativo. Fue descrita en 1956 por
Benjamín Castleman quien
reportó una serie de casos de
pacientes con nódulos linfáticos
mediastinales hiperplásicos.
Descripción del caso: se trata
de paciente femenina de 21
años de edad sin antecedente
de importancia que inicia padecimiento en el mes de enero
del 2014 con presencia de dolor
torácico de tipo pleurítico de
intensidad 3/10 sin demás otra
sintomatología agregada, por lo
que recibe manejo sintomático
con mejoría parcial, acude a
esta unidad donde se realiza
estudio de imagen de tórax con
evidencia de masa pulmonar
en lóbulo medio derecho y es
ingresada para su protocolo de
estudio. A la exploración física
no se observan alteraciones a
comentar. Sus laboratorios de
ingreso con Hb de 14, Leu 5.4
Neut 2.7 Plaquetas 241, Na
143, K4, Cl 108, Glu 78 Cr 0.69
Alb 4.2. se realiza estudio de
PET Scan el cual no evidenció
Mets y no capto FDG, aspirado
de médula ósea sin alteraciones,
por lo que se decide realización
de toracotomía evidenciándose
tumoración muy vascularizada
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
que se irriga por vasos del hemitórax derecho comprime vena
cava inferior, tumoración no resecable por lo que toma biopsia.
Dicho reporte menciona masa
mediastinal derecha con hiperplasia angiofolicular linfoide.
Discusión y comentario: se trata
de un paciente con Enfermedad
de Castelman de tipo hialino
vascular (hiperplasia gigante
de ganglios linfáticos) siendo
la unicentrica la más frecuente
alrededor del 70% teniendo
como localización más frecuente el tórax, siendo esta de
curso benigno sin embargo por
la compresión vascular muestra
carácter maligno y también por
su incapacidad en este caso de
resecabilidad, por lo que se decide manejo con quimioterapia
a base anticuerpos monoclonales con ciclo de anti CD20
(rituximab) y posteriormente
con ciclos de tocilizumab que
es un anticuerpo anti IL6 que
ha demostrado resultados promisorios con disminución de
los síntomas, adenomegalias y
restablecimiento de alteraciones
de laboratorio, la paciente se
encuentra estable con mejoría
de los síntomas, dicha patología no es muy frecuente y es
necesario su estudio histológico
durante la evaluación así como
la sospecha clínica y patológica
de las diferentes variedades de
la enfermedad de castelman
para permitir un tratamiento
oportuno y evitar el deterioro de
los pacientes, por lo que es un
tema de interés para el internista
ante la sospecha.
Metástasis cutáneas, manifestación inicial de un cáncer de
mama
Josefina Álvaro Vásquez, Juan
Carlos Salas Ruiz, Misael Gómez Franco
Hospital Regional ISSSTE
Veracruz, Departamento de
Medicina Interna, Veracruz,
Veracruz
Introducción: se presenta el
caso de una mujer de 44 años
de edad con cáncer de mama,
cuya manifestación inicial
fueron lesiones cutáneas en
piel cabelluda. Caso clínico:
mujer de 44 años de edad.
Mastopatía fibroquística hace
18 años y trombosis venosa
profunda de miembro pélvico
izquierdo hace 4 años. Inicia
en diciembre de 2012 con tos
seca intermitente. En agosto
de 2013 detecta nódulos en
cuero cabelludo y axilas. EF:
7 Nódulos subcutáneos en
cabeza, el mayor de 2x2 cm,
y en axilas de 1.5x0.5 cm,
mama izquierda con tumoración que abarca CSE, de
4x4 cm móvil, pezón normal.
Biopsia de nódulo de cuero
cabelludo: metástasis de primario desconocido. Se inicia
protocolo de estudio. TAC de
tórax: derrame pleural derecho
del 40%, nódulo espiculado
en ambos lóbulos inferiores.
Mastografía de mama izquierda con microcalcificaciones,
lesión sospechosa en CI. Reporte histopatológico de biopsia
(trucut), carcinoma ductal infiltrante sin patrón especifico;
receptores de estrógenos ++
90% y de progesterona ++
85%, HER2 (-). Ecocardiograma, derrame pericárdico de
300 ml. CA 125 518.9, CA
15.3 46.77. Centelleografía
ósea negativa. Se diagnostica
cáncer de mama izquierda
ductal infiltrante EC IV. Se inicia
quimioterapia sistémica por 6
ciclos a base de antracíclicos.
Mastectomía radical modificada izquierda en abril de
2014, reporte histopatológico
de carcinoma ductal in situ.
CA 15.3 16.64. Nuevamente
se inicia tratamiento sistémico
a base de taxanos por 4 ciclos.
Conclusiones: las metástasis
cutáneas son una manifestación
inusual de neoplasias internas,
aparecen en un 0,7-9% de
los tumores y como primera
manifestación en el 0.8%. Son
frecuentes en la mujer (70%)
ya que el principal origen es el
carcinoma de mama, afectando
sobre todo la región torácica.
En las mujeres, 69% proviene
de cáncer de mama, 9% de
colon, 5% de melanoma. En
un estudio retrospectivo de
40 pacientes con metástasis
cutáneas realizado por López
y col., los tumores primarios
más frecuentes fueron: adenocarcinoma de mama (17.5%),
de origen gastrointestinal (20%)
y hematológico (17.5%). Pueden adoptar distintas formas
clínicas, la nodular es la más
frecuente y consiste en nódulos
de 1 a 4 cm, indoloros; se observa en carcinomas de mama,
pulmón, riñón, vías digestivas
S79
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
y próstata. Otra forma es la cicatrizal o alopecia neoplásica,
se caracteriza por la presencia
de una placa alopécica en piel
cabelluda, siendo común en
el cáncer de mama, como en
nuestro caso.
Polineuropatía desmielinizante
crónica como manifestación
inicial de un síndrome POEMS
Josué Román Cab Paat, Faustino
Morales Gómez, Jorge Uriarte
Archundia
Servicio de Neurología, Departamento de Medicina Interna,
Hospital de Especialidades de
Puebla, Puebla, México
Introducción: el síndrome
POEMS, descrito por primera
vez por Shimpo en 1968,enfermedad rara de baja incidencia,
con predominio en países
occidentales. El acrónimo
POEMS, descrito por Bardwick
en 1980 hace referencia a P
(polineuropatia), O (organomegalia), E(endocrinopatía),
M (desorden monoclonal de
células plasmáticas), S (lesiones cutáneas). El diagnóstico
se realiza a través de los criterios propuesto por Dienzeri
al cumplir 2 criterios mayores
(polineuropatía y desorden
monoclonal de células plasmáticas) y un criterio menor
(lesiones óseas escleróticas,
enfermedad de Castleman,
organomegalia, endocrinopatía, lesiones en piel).Dada la
complejidad de sus manifestaciones clínicas lo cual hacen a
esta entidad, poco común, un
S80
reto diagnóstico, se presenta
el siguiente caso. Descripción
del caso: mujer de 49a, con
antecedentes de DM2 (6ª de
dx) e hipertensión, cuadro
clínico de 2a de evolución
caracterizado por cuadriparesia y parestesias en miembros
torácicos y pélvicos, con distribución inicial en “guante y
calcetín”, diagnóstico inicial
de Neuropatía Diabética.
Progresión del cuadro clínico
con incremento de la debilidad muscular, lesiones del
tipo urticaria en piel, dolor
abdominal y dolor acromioclavicular izquierdo. EF. Fondo
de ojo: sin RTNPD, neurológicamente: pares craneales sin
alteraciones, con disminución
de la fuerza distal de extremidades superiores (manos)
3/5, extremidades pélvicas
con disminución bilateral
de la FM 3/5 y sensibilidad,
acompañado de hiperestesia
plantar con respuesta flexora.
Abdomen con esplenomegalia
4cm DRBC. BH: trombocitosis
(489 000), Ac-antinucleares:
4.42 UI/mL, anti-DNA, anti
SM y anticardiolipinas: (negativos), inmunoglobulinas:
IGG 17.4 g/L. Electroforesis de
proteínas: en rangos normales.
B-2 MCGB:4.6 mg/L. RX de
región acromio clavicular:
con lesión lítica en 1/3 sup
de humero izq e imagen de
aspecto tumoral. Biopsia de
hueso humero izq: plasmocitoma, AMO: plasmocitoma
11%, EMG: PNP sensoriomotora del tipo degeneración
axonal y desmielinizaciún
sec. IRM cráneo: normal.
Comentarios y Conclusiones:
por polineuropatía sensoriomotora , reporte en biopsia
ósea y aspirado medular de
plasmocitoma , perfil tiroideo
compatible con hipotiroidismo primario, hallazgo clínico
de esplenomegalia y lesiones
dérmicas en piel se concluye
síndrome POEMS. Cumple 2
criterios mayores y 3 criterios
menores de los propuestos por
Dienzeri. Se incia QT con CFA
+ talidomida y esteroide.
Hallazgo radiológico de plasmocitoma como manifestación
inicial de mieloma múltiple
asociado con insuficiencia
renal
LF Valdés Corona, 1 E Erazo
Tapia, 1 AS Cepeda Pérez, 1 L
Jorge Diego,2 Antonio Enrique
Cataneo Dávila3
1
Servicio de Medicina Interna
2
Servicio de Anatomía Patológica
3
Servicio de Nefrología
Hospital Ángeles Lomas, Huixquilucan, Estado de México
Introducción: aunque las
lesiones extra óseas del mieloma múltiple son comunes,
el involucro pulmonar es extremadamente raro con una
incidencia reportada de tan
sólo 0.8% de los pacientes y
se relaciona con enfermedad
avanzada ó diseminada. En
este trabajo presentamos un
paciente con hallazgo de plasmocitoma en pared torácica
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
como primera manifestación
de mieloma múltiple. Caso
clínico: masculino de 78 años
de edad, historia de tabaquismo importante, antecedentes
de DM tipo 2 e HAS en tratamiento; historia de cáncer de
vejiga en 1970 actualmente
en remisión. Fue trasladado
a urgencias por focalización
(hemiparesia derecha y disartria) de 2 horas de evolución.
Se encontró neurológicamente
íntegro, con TA 140/70, FC
entre 70 y 90 lpm, afebril, IMC
28.9. La resonancia magnética de cráneo sin evidencia
de isquemia o hemorragia. El
electrocardiograma mostró
ritmo de fibrilación auricular.
El ECOTE con buena movilidad global, FeVI 42%, P.S.A.P.
41mmHg sin evidencia de
trombos ni vegetaciones. La
tele de tórax mostró radiopacidad definida, ovoide, en lóbulo
superior de pulmón derecho
con extensión desde la periferia hacia la región del hilio.
Por tomografía se definió como
masa sólida, en contacto con
la musculatura intercostal y arcos costales sin erosión de los
mismos ni datos de extensión
locorregional, sin adenopatías
axilares ni derrame pleural.
En sus laboratorios destacó
Hb 10.1 mg/dL, Leu 5.9, plaquetas 168,000, BUN 42.4
mg/dL, creatinina sérica 3.7
mg/dL, glucosa de 58 mg/dL,
calcio corregido en 9, HbA1c
5.5%, beta 2 microglobulina
en 9650. El EGO: eritrocitos 12
a 14 por campo, leucocitos 6
a 8 por campo y proteínas++.
El ultrasonido renal mostró
riñones en situación habitual,
sin evidencia de ectasias, con
quistes renales simples bilaterales. Se realizó biopsia pleural
mediante trucut con resultado
sugerente de plasmocitoma. Se
realizó biopsia de hueso y aspirado de médula ósea donde se
observaron células plasmáticas
positivas a CD138 y MUM-1,
además de monoclonalidad
con restricción de cadenas
ligeras Lamda, compatible con
mieloma múltiple. Discusión:
Este trabajo muestra un paciente con múltiples patologías de
interés desde el punto de vista
de un internista. Durante sus
estudios iniciales se detectó
una lesión poco habitual en
tórax, lo que obliga al ejercicio
de realizar varios diagnósticos
diferenciales. El diagnóstico
final es interesante y su tratamiento ha traído un beneficio
evidente a este paciente.
Alteraciones citogenéticas en
un paciente con mieloma múltiple como factor pronóstico y
terapéutico
Diego Armando Victoria Ríos,
Jesús Gutiérrez Bajata, Gerardo
Callejas Hernández
Servicio de medicina interna
Hospital Fernando Quiroz Gutiérrez ISSSTE, México, DF
Introducción: el mieloma múltiple forma parte de
los trastornos de las células
plasmáticas conocidos como
gamapatías monoclonales.
Existen factores pronósticos
para definir el curso clínico de
la enfermedad. Estos pacientes
cursan con gran inestabilidad
cromosómica, el estudio de
las alteraciones citogenéticas
ha demostrado gran relevancia
clínica a la hora de las decisiones terapéuticas y pronosticas,
es por eso que se desarrolló
un abordaje basado en grupos
de riesgo definidos por sus características citogenéticas por
lo que la introducción nuevos
fármacos, han cambiado el
panorama pronostico. Descripción del caso: presentamos el
caso clínico de un varón de 75
años que inicia su padecimiento 2 meses previos a su ingreso
con dolor en región lumbar
intenso, que le condicionaban
imposibilidad para deambular
por lo que se realizó tomografía
computada simple de columna
dorsolumbar encontrando lesiones osteolíticas. Presentó falla
renal aguda asociada a hipercalcemia e hiperglobulinemia
considerando la posibilidad
de mieloma múltiple, se realizó inmunoelectroforesis de
proteínas e inmunofijación
evidenciando paraproteinemia
monoclonal de cadenas Kappa;
el aspirado de médula ósea dio
evidencio >10% de células
plasmocitoides corroborando el diagnóstico se clasifico
como Durie Salmon II. Como
parte de la complementación
diagnóstica se realizó análisis
de citogenética que demostró
deleción del cromosoma 1 y
10 y trisomía del cromosoma
S81
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
13. Se inició tratamiento con
dexametasona, bortezomib y
melfalan con adecuada respuesta clínica. Comentarios: en
nuestro paciente se pudo identificar deleciones del cromosoma
1 y 10 así como trisomía del
3. La delación del cromosoma
1 es una de las alteraciones
cromosómicas más comunes
en el diagnóstico de mieloma
múltiple y es un factor de mal
pronóstico bien establecido.
Por lo que se decidió usar como
primera línea de tratamiento
bortezomib que a demostrado
adecuada respuesta. Conclusiones: actualmente el análisis
citogenético ha cobrado gran
importancia ya que hasta una
tercera parte de los pacientes
tienen alteraciones cromosómicas Nuestro conocimiento
sobre la genética del mieloma
múltiple está evolucionando de
manera acelerada. Los estudios
utilizando datos genómicos están mejorando la comprensión
del mieloma múltiple así como
la identificación de pacientes
de alto riesgo de falla terapéutica por lo que en un futuro será
posible la personalización del
tratamiento con el objetivo de
mejorar el pronóstico de estos
pacientes.
Linfoma primario de sistema
nervioso central. Reporte de
un caso
Berenice Vicente Hernández,
María José Pardinas Llergo, José
Mauricio Cedillo Fernández,
Alberto Alfonso Palacios Boix,
Arturo Violante Villanueva, Enri-
S82
que Juan Díaz Greene, Federico
Rodríguez Weber
Hospital Ángeles Pedregal,
Unidad de Terapia Intermedia,
México, DF
Femenino de 81 años con
tabaquismo positivo (IT 26)
suspendido hace 5 años, hepatitis B hace 50 años, diabetes
mellitus 2 e hiperuricemia.
Inicia 6 meses previos astenia,
adinamia y pérdida ponderal
no cuantificada, disminución
de la fuerza de extremidades
inferiores de manera intermitente sin imposibilitar la
marcha, vértigo y parestesias en
miembros torácicos. 3 días previos con caída de forma súbita
recibiendo trauma craneoencefálico sin pérdida del estado de
alerta. Posteriormente presenta
alteraciones de la memoria
por lo que acude a urgencias,
ingresando con Glasgow 5,
desorientación en tiempo y
espacio y bradilálica. Se realizan exámenes de laboratorio
sin alteraciones, se toma una
RMN de cráneo encontrando
una lesión periventricular izquierda de 5 cm con efecto de
masa, refuerza en T1, no desplaza la línea media y no tiene
edema perilesional, 3 lesiones
periventriculares en hemisferio
derecho frontoparietales y núcleo caudado. Espectrometría
con pico de colina y lípidos.
Se solicita perfil TORCH con
IgG para CMV y rubéola positivos, el resto negativo. Perfil
de hepatitis compatible para
infección previa, antígeno de
Neisseria meningitis negativo
y anti-VIH negativo. Se realiza
biopsia en la que se reporta
linfoma difuso de células B
grandes CD 20+ positivo con
coexpresión de Bcl-6, CD 10 y
MUM-1. El linfoma primario de
sistema nervioso central es un
linfoma no Hodgkin extranodal
que puede afectar parénquima
cerebral, ojos, leptomeninges,
pares craneales y médula espinal, en ausencia de linfoma
sistémico al momento del
diagnóstico. Su incidencia es
de 5 casos/1 millón de personas
en Estados Unidos, representa
el 1% de los LNH y del 3-5%
de los tumores primarios del
sistema nervioso central. Se
presenta entre la sexta y séptima década, con una relación
H:M 1.2:1.7. Estamos frente a
un caso de linfoma primario de
sistema nervioso central en un
paciente inmunocompetente,
en el cual, la importancia de la
clínica y la presentación de los
síntomas tienen suma importancia para la sospecha clínica.
Síndrome de Sweet asociado
con síndrome mielodisplásico
O Paredes Ceballos, L Moranchel García, M Quintal
Ramírez, O Vera Lastra
Servicio de Medicina Interna
y Anatomía Patológica, UMAE
Hospital de Especialidades Dr.
Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: el síndrome de
Sweet o dermatosis neutrofílica (DN) febril aguda es
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
una enfermedad infrecuente
caracterizada por la aparición
brusca de placas y nódulos eritematosos cutáneos, dolorosos,
en cara, extremidades o tronco,
asociados a fiebre, malestar
general y neutrofilia, con patrón
histopatológico de dermatitis
neutrofílica. Descripción del
caso: mujer de 21 años, tabaquismo e ingesta de cocaína
positivo. Anemia aplásica severa desde 2010 con varios
tratamientos (timoglobulina,
ciclosporina, micofenolato y
danazol, terapia transfusional,
aproximadamente 40 concentrados eritrocitarios). Inició
padecimiento hace 6 meses
con dolor faríngeo, fiebre y
leucocitosis sin respuesta a
antibióticos; asimismo dermatosis localizada en mama
derecha de 3cm con base
eritematosa, de crecimiento radial, eritematoviolácea,
bien delimitada, bordes sobreelevados purpúricos muy
dolorosa tipo nodular, aumento
progresivo de tamaño que
evolucionó a ampollas confluentes, ulceración y necrosis
con secreción no purulento.
Ingresó a Ginecología por
sospecha de cáncer de mama
para tratamiento quirúrgico radical; sin embargo, durante su
estancia se observó progresión
a miembro pélvico izquierdo,
de las mismas características. A
su ingreso a Medicina Interna
con derrame pleura derecho
e infiltrado pulmonar. Biopsia
de piel de miembro pélvico
con intenso infiltrado neutro-
fílico sin vasculitis. Biometría
hemática con pancitopenia.
Proteína C reactiva elevada,
AMO con diagnóstico de SM.
Tratamiento: esteroide 60 mg/
día más micofenolato de mofetilo con adecuada respuesta y
remisión de las lesiones en 15
días. Comentario: el SS es una
DN caracterizada por desregulación autoinmune y activación
de neutrófilos e infiltrado de
dermis papilar. En un 15% se
asociado a neoplasia y de éstas
el 85% son de origen hematológicas. Conclusiones: mujer con
fiebre y aparición abrupta de
dermatosis eritematoviolácea
en mama caracterizada por
vesículas y úlcera muy dolorosa que en la biopsia de piel
mostró infiltrado neutrofílico
sin vasculitis y buena respuesta
e esteroides cumpliendo así
criterios para SS y se asoció
a neoplasia hematológica inicialmente anemia aplásica y
posteriormente un síndrome
mielodisplásico.
Incompatibilidad RH y síndrome de hiperviscosidad en
paciente con mieloma múltiple
LI Corona Sevilla, Y Moctezuma
Montaño, HB Castellanos Sinco, R Álvarez Cruz
Hospital General de Zona núm.
48, IMSS, México, DF
Introducción: el mieloma
múltiple es una proliferación
incontrolada de las células
plasmáticas que en la mayoría
de los casos producen una
gammaglobulina monoclonal
responsable de muchas de sus
manifestaciones, tal como el
síndrome de hiperviscosidad;
caracterizado por alteraciones
oftalmológicas, neurológicas
y diátesis hemorrágicas. Descripción de caso: masculino
de 57 años de edad. Médico. Antecedentes de diabetes
mellitus tipo 2, hipertensión
arterial sistémica, cardiopatía
isquémica, hiperplasia prostática tratada con resección
trasuretral, alérgico a la penicilina y sulfas, artrodesis con
disminución de espacio en
L5-S1. Presenta cuadro clínico de 3 semanas con astenia,
adinamia, evacuaciones melénicas, lumbalgia y lipotimia.
En paraclínicos con elevación
de azoados, acidosis metabólica, anemia; catalogado como
encefalopatía urémica ingresa
a sesión de hemodiálisis; sin
presentar mejoría a la tercera
sesión. Persisten evacuaciones
melénicas, epistaxis profusa,
deterioro neurológico con estupor. En las pruebas cruzadas se
reporta incompatibilidad y frotis
de sangre periférica con esquistocitos y dacriocitos, Coombs
directo negativo, bilirrubinas
normales. Se realiza aspirado
de médula ósea observando
infiltración de 35 % de células plasmáticas trinucleadas y
plasmoblastos. Electroforesis de
proteínas con inmunofijación,
B2 microglobulina, cadenas ligeras en suero, obteniendo pico
monoclonal en región beta, con
aumento de IgA y depleción
de IgG e IgM, inmunofijación
S83
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
en suero con paraproteinemia
monoclonal IgA Kappa en zona
beta, y relación de cadenas
Kappa/Lambda 28.08, aumentada a expensas de las cadenas
Kappa; concluyendo el diagnóstico de mieloma múltiple.
Se dio manejo con bolos de 1 g
de metilprednisolona por 3 días
y posterior con dexametasona
40 mg. Continúo con sesión
de hemodiálisis, tratamiento
antibiótico y control glucémico con mejoría considerable.
Comentario: en los pacientes
con factores de riesgo para
daño renal crónico, es común
que no se indague sobre otras
causas. Consideramos que las
manifestaciones expresadas
por el paciente corresponden a
la hiperviscosidad secundaria a
mieloma múltiple que se manifiesta en el 2 a 8% de los casos.
La incompatibilidad Rh en el
mieloma es debida a la hiperglobulinemia. Conclusión: el
modelo de presentación con
incompatibilidad RH en el
mieloma es poco común como
una de sus manifestaciones
iniciales, sin embargo siendo
clave en el diagnóstico del
paciente.
Falla renal como manifestación
única de mieloma múltiple:
reporte de un caso
Juan Ramón García Díaz, JN
López Taboada, JO Duarte Flores, T Velázquez Gaspar, DM
Dueñas Tamayo, C Del Moral
Stevenel, JA Cortés Sarabia
Hospital General de Zona núm.
48, IMSS, México, DF
S84
Introducción: el mieloma múltiple es la neoplasia de células
plasmáticas más frecuente. El
desarrollo de insuficiencia renal
se presenta por la precipitación
de células plasmáticas en los
túbulos renales. Presentamos el
caso de un paciente que ingresa
para protocolo de estudio por
presentar falla renal sin causa
aparente. Paciente masculino de
46 años de edad, tabaquismo y
alcoholismo positivos, enfermedad renal crónica de 3 meses
de diagnóstico sin etiología
aparente, Hipertensión Arterial
Sistémica de 3 años de diagnóstico. Inicia hace 4 meses con
presencia de astenia, adinamia
y malestar general, posteriormente presenta disminución de
volúmenes urinarios, así como
elevación de Creatinina, sin
referir alguna otra sintomatología, por lo que se interna para
protocolo de estudio. Presenta
los siguientes resultados de
laboratorio: Cr 16.8, DHL 667,
albúmina 2.3, Prots. totales
6.8, globulinas 4.5, Hgb 8.3,
VGM 90.6, CHCM 29.8, leuc
4, neutrófilos 27.32 %, linfocitos
67.2 %, plaquetas 122, TP 17.4
INR 1.42. EGO con albuminuria de 30 mg/dL. Cuenta con
USG Renal, reportando daño
renal parenquimatoso difuso
subagudo de predominio derecho. Se solicitan estudios
inmunológicos por sospecha
de glomerulopatía primaria,
en donde llama la atención
aumento de IgA de 2,840, se
realiza frotis de sangre periférica, donde presenta fenómeno
de Rouleaux, posteriormente se
realiza aspirado de médula ósea,
en donde se observa infiltración
de células plasmáticas de 92%,
cumpliendo criterio para mieloma múltiple. Conclusión: el
mieloma múltiple puede manifestarse como insuficiencia renal
en un 25 % de los pacientes
como hallazgo único. En los pacientes que presenten falla renal
sin una causa aparente, se debe
pensar, de primera instancia, en
una glomerulopatía primaria o,
de acuerdo a los hallazgos clínicos (como se presentó en este
caso), a un proceso infiltrativo,
tal es el caso del mieloma múltiple. El diagnóstico oportuno
permite establecer un tratamiento dirigido temprano y mejorar la
calidad de vida de los pacientes.
Cánceres sincrónicos con
actividad metastásica: adenocarcinoma de colón y cáncer
de próstata.
ID Peña Chávez, O Morales
Gutiérrez, AA Holling Martínez,
C Mitrani Boyle, F Pérez Zincer,
I López Caballero
Medicina Interna, Hospital
Ángeles Lomas, Huixquilucan,
Estado de México
Introducción: el cáncer de
colon ocupa el tercer lugar en
frecuencia en México. Se ha
reportado una incidencia en
hombres de 1.02% al año. Debido a mejores herramientas
diagnosticas así como mejores
tratamientos, se han reportado mas casos de cánceres
primarios múltiples. Estudios
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
sobre la epidemiología de
cáncer de colon mencionan
que un 2-5% presentan múltiples tumores primarios y un
15.1% se atribuye a cáncer
de próstata. Descripción del
caso: hombre, de 73 años que
inició su al presentar hematuria macroscópica de manera
intermitente por un mes, sin
datos relevantes a la exploración física. Citología de orina
reportó células epiteliales
atípicas. Se solicitó tomografía
computarizada donde se observó tumoración vesical con
probable infiltración contigua
a sigmoides y parénquima
heterogéneo por imágenes
hipodensas en los segmentos
VI y VII con densidad heterogénea y reforzamiento
heterogéneo con el medio de
contraste endovenoso. Colonoscopía mostró tumoración
en colon sigmoides aproximadamente a 37 cm del margen
anal. Se realizó resección transuretral de neoplasia vesical,
se tomaron biopsias de vejiga
y próstata. Biopsias de tumor
en colon sigmoides: adenocarcinoma moderadamente
diferenciado, ulcerado e infiltrante con extensa necrosis
y calcificación distrofia focal.
La histopatología de la lesión
vesical reportó tejido prostático con adenocarcinoma acinar
prostático con fragmentos de
adenocarcinoma moderadamente diferenciado con patrón
morfológico de tipo intestinal
colónico. Biopsias de próstata
con adenocarcinoma acinar
prostático suma de Gleason
4 + 4 = 8. La actividad metastásica hepática podría ser
de tumor primario de colon
o de cáncer de próstata. Comentarios: el caso clínico es
inusual por su presentación
atípica con sintomatología
urinaria. Cumple criterios de
acuerdo a la clasificación de
Warren y Gates para tumores
sincrónicos, cada tumor es
histopatológicamente malignos y son histológicamente
distintos. Conclusión: este
caso representa una presentación poco frecuente de
neoplasias sincrónicas en el
adulto. La alta incidencia de
cáncer de colon y de próstata en sujetos de esta edad,
hace que este caso sea una
presentación atípica de dos
neoplasias comunes.
Neuritis óptica retrobulbar
como primera manifestación
de síndrome paraneoplásico
asociado con adenocarcinoma
renal de células claras, reporte
de caso
Sara Olivia Ramos Romero,1
Héctor Enrique Ortiz Mendoza,1 Alejandro Ortiz Piña,2 Julio
César Castañón Pastén,3 Arturo
Mena Benítez,4 José Antonio
Marín Muñoz, 5 Juan Andrés
Méndez García2
1
Médico residente de primer
año de Medicina Interna
2
Médico de base de Medicina
Interna
3
Médico de base de Neumología
4
Jefe de Medicina Interna
Médico de base de Patología
Hospital General Zona núm.
32, Dr. Mario Madrazo Navarro, México, DF
5
Introducción: la neuritis óptica paraneoplásica es una
manifestación ocular de una
neoplasia sistémica caracterizada por disminución en la visión,
inflamación del disco óptico
y síntomas neurológicos, en
la literatura solo existen pocos
reportes de casos. Descripción
del caso: masculino de 49 años
de edad con los antecedentes de
etilismo social, diabetes mellitus
tipo 2 e hipertensión arterial sistémica de larga evolución. Inicia
padecimiento con disminución
súbita (24 h de evolución) de la
agudeza visual en ojo derecho y
disnea de pequeños esfuerzos, su
exploración física se integra derrame pleural derecho del 70%,
neurológicamente se documentó
por campimetría por confrontación limitación de campo visual
ojo derecho superior, inferior y
temporal, sin alteraciones de la
respuesta pupilar, fondo de ojo
con papila hiperémica borde
nasal borrado y elevado con
líquido subretiniano peripapilar
nasal, sin otro déficit neurológico, se sospechó neuritis
óptica retrobulbar, corroborada
por el servicio de neurología y
oftalmología, iniciando pulsos
de metilprednisolona, la Tomografía de cráneo reportó lesión
hemorrágica intraparenquimatosa encapsulada, bien definida,
edema perilesional en lóbulo
parietooccipital izquierdo, sin
S85
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
descartar lesión metastásica,
se inició protocolo de neoplasia primaria. La radiografía de
tórax mostró derrame pleural
derecho del 70%, citoquímico
compatible con un trasudado,
los marcadores tumorales negativos, examen general de orina
con hematuria y proteinuria, se
solicitó tomografía contrastada
que corroboró derrame pleural
derecho, atelectasia pasiva,
tumor renal derecho solido de
arquitectura heterogénea, que
reforzaba con el medio de contraste, valorado por urología
quien realizó nefrectomía derecha radical por T1B N0 M0, con
reporte histopatológico de adenocarcinoma renal de células
claras. Comentario: los síndromes paraneoplásicos pueden ser
el primer signo de malignidad, y
su identificación es crucial para
lograr una detección precoz del
tumor. Conclusión: el adenocarcinoma renal de células claras es
una neoplasia poco frecuente en
población adulta y en la literatura no se cuentan con referencias
en la cual describan casos de
neuritis óptica como manifestación inicial de un síndrome
paraneoplásico desencadenado
por cáncer renal.
Fracturas patológicas como
presentación inicial de carcinoma insular de tiroides
metastásico. Reporte de un
caso
Mario Joatam Pozas Rivas, Marisol Hernández López, Yolanda
Galvez Molina
Servicio de Medicina Interna,
S86
Hospital General de Cuernavaca Dr. José G Parres,
Cuernavaca, Morelos
Introducción: el carcinoma
insular de tiroides es una neoplasia del epitelio folicular
escasamente diferenciada,
descrito por primera vez por
Carcangiu en 1984. Descripción del caso: femenino de
69 años, antecedentes de exposición a biomasa y fractura
de cadera derecha 14 meses
previos a su ingreso que requirió prótesis y desde entonces
postrada en cama. Disfonía y
parálisis de cuerdas vocales
de 10 años en seguimiento
por ORL. Pérdida ponderal de
20 kg en medio año asociado
a odinofagia, diaforesis y adenomegalias inguinales. Ingresa
por presentar dolor y deformidad a nivel de cadera izquierda
tras ser movilizada en cama.
Tres días después desarrolla
insuficiencia respiratoria requiriendo intubación orotraqueal y
aminas. Radiológicamente con
radiopacidades bilaterales de
aspecto nodular y ocupación
alveolo intersticial. Se inició
protocolo por probable cáncer pulmonar con enfermedad
metastásica, realizando serie
ósea observando múltiples
lesiones líticas en trocánter y
diáfisis de fémur izquierdo. Se
manejó con antimicótico, cefotaxima y medidas generales.
Dada la condición no se pudo
realizar AMO ni biopsia ósea.
No se realizó traqueostomía.
Continuó con deterioro gradual
presentando asistolia y muerte
tras 20 días hospitalizada.
Hallazgos histopatológicos:
Adenocarcinoma de glándula
tiroides (lóbulo derecho) de
tipo insular poco diferenciado,
con metástasis múltiples a ambos pulmones, hígado, bazo,
suprarrenal izquierda, ambos
riñones, cadenas ganglionares
cervicales bilaterales, hilios
pulmonares, mediastinales, del
hilio hepático, retroperitoneales, metástasis óseas a cráneo,
costillas, clavícula derecha,
vértebras dorsales y lumbares,
ambas crestas ilíacas y lóbulos
frontales, parietales, cerebelo
y duramadre. Comentarios:
este tipo de tumor es más frecuente en mujeres, con una
incidencia del 5% de todas las
neoplasias tiroideas. Además
suele presentarse en edades
más avanzadas en comparación en el papilar y folicular.
Con frecuencia al momento
del diagnóstico, la mayoría
presenta un mayor tamaño
tumoral además de alto riesgo
de presentar lesiones metastásicas. Conclusiones: durante
el presente caso el deterioro
fue progresivo y como único
hallazgo las múltiples fracturas
patológicas y metástasis pulmonares. La mayoría de este
tipo de neoplasia es de difícil
diagnóstico por lo inespecífico
de los síntomas, además de una
tasa elevada de mortalidad ya
que suele tener un patrón más
agresivo en comparación con
los carcinomas diferenciados
de tiroides.
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Sarcoma mieloide. Reporte de
tres casos
Alejandro Quintin Barrat Hernández,1 Edgar Pérez Barragán,2
Nazhira Torres Neme3
1
Médico adscrito de Medicina
Interna
2
Residente de tercer año de
Medicina Interna
3
Residente de cuarto año de
Medicina Interna
UMAE 189 Adolfo Ruiz Cortines, IMSS
Introducción: el sarcoma mieloide (SM) una neoplasia rara, y
de difícil diagnóstico, definida
por la presencia de células
mieloides inmaduras en un sitio
extramedular. Puede preceder o
asociarse a la Leucemia aguda
u otros trastornos mieloproliferativos. Edad, tamaño y sitio
de aparición son variables y
determinan la sintomatología.
Caso 1: hombre de 22 años con
tumoración de 2 cm en axila
izquierda, manejada como
absceso con remisión parcial.
Recurrencia 2 meses después
con crecimiento rápido, hasta
20x15 cm, necrosis, ulceración, fiebre y pérdida ponderal.
Reporte inicial de patología,
Linfoma. Inmunohistoquímica
(IHQ) reportó mieloperoxidasa
(MPO) +++, CD45 ++ y CD68
+, compatible con SM. Inmunofenotipo (IFT) en médula ósea
(MO) sin células neoplásicas.
Inició tratamiento con Idarrubicina y Ara-C, al terminar primer
ciclo presenta necrosis de lesión con desprendimiento y en
el segundo, remisión de ésta.
Caso 2: mujer de 38 años. Acude con síndrome de vena cava
superior. Se detecta por TAC
tumor mediastinal con compresión de la vía aérea. Se biopsia
por toracoscopía. IHQ con
expresión para CD45, CD43,
MPO, lisozima y CD117. MO
sin blastos. Cariotipo normal.
Inicia quimioterapia de inducción con esquema 7+3, dos
ciclos de quimioterapia de
consolidación temprana y uno
de tardía usando dosis altas de
ARA-C + Antracíclico. TAC por
emisión de positrones 4 meses
después sin evidencia actividad
tumoral. Se envía para trasplante autólogo de MO. Caso 3:
masculino de 24 años. Debutó
con lumbalgia, adenopatías
cervicales e inguinales; diagnóstico de Leucemia mieloide
aguda (LMA) M5, con afección a piel y cerebro, recibió
citarabina + daunorrubicina.
Cuadro de oclusión intestinal
con hallazgo quirúrgico de
tumoración en ciego reportado
como proceso inflamatorio agudo y crónico abscedado. Ocho
meses después con aumento
de volumen de tejidos blandos
en hemiabdomen derecho, sospecha de infiltración de LMA.
Se realiza biopsia, reporte de
IHQ CD34 +++, CD117+++,
MPO +++. Ahora en segundo
tratamiento de segunda línea
por SM. Discusión: el sarcoma
mieloide es una neoplasia rara
se han estimado 2 casos por
millón de habitantes. La IHQ
con expresión de MPO, CD68,
y CD34, es útil para detectar
diferenciación mieloide y diagnóstico definitivo del sarcoma
mieloide. El tratamiento sigue
protocolos utilizados en LMA,
tengan o no afección en MO.
La pobre incidencia del sarcoma mieloide y ausencia datos
clínicos específicos, hace de
este reto diagnóstico.
Síndrome de Parinaud, manifestación frecuente de patología
poco frecuente, reporte de
caso
Juan Esteban Aguilar Esquivel,
Carolina Candelaria Ramírez
Gómez, José Humberto Arcos
Corea
Hospital General de México
Introducción: también llamado
síndrome mesencefálico dorsal,
síndrome del acueducto de
Silvio, síndrome pretectal o síndrome de Koeber-Salus-Elschnig.
Se produce por afectación del
tectum, pretectum, tegmentum
y sustancia gris periacueductal,
siendo las alteraciones neurooftalmológicas su manifestación
más frecuente. Se caracteriza
por la presencia de: parálisis
de la supraversión, con reflejos
oculocefálicos verticales conservados, anisocoria, corectasia,
corectopia, reacción disociada a
la luz y acomodación, arreflexia
pupilar, nistagmo de retracciónconvergencia detectable en la
supraversión de la mirada, signo de Collier, signo de lid lag,
pseudoparálisis del abducens
e inclinación de la cabeza.
Sus causas más frecuentes son:
tumores pineales, ictus y trau-
S87
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
matismos. Presentación del
caso: mujer de 57 años, antecedente de cáncer de mama de
7 años de diagnóstico, recibió
tratamiento quirúrgico, quimio
y radio terapia, con seguimiento
anual en servicio de Oncología,
cursando durante ese periodo
asintomática, acude al servicio
de Neurología por cefalea de 9
meses de evolución, opresiva,
holocraneana, de predominio
matutino, intensidad 7/10, disminuye en el transcurso del día
4/10, acompañada de nausea,
y a la exploración física hay
incapacidad a la supraversión
ocular y anisocoria, integrándose síndrome de Parinaud y
cefalea secundaria, se solicita
Resonancia Magnética donde
se evidencia reforzamiento y
aumento de tamaño en glándula
pineal a la administración del
contraste, lesión ocupativa de
la región pineal. Se realizan
estudios de extensión imagenológica, encontrando en
radiografía de tórax imágenes
nodulares de manera bilateral
de predominio basal derecho,
gammagrama óseo con datos
de actividad tumoral a nivel de
III y IV arco costal izquierdo,
ante los hallazgos anteriores
se consideró como tumoración
pineal metastásica de primario
en mama. Discusión: los tumores cerebrales de la región
pineal son poco frecuentes.
Las metástasis a la pineal son
incidentales e incomunes y
ocurren en el curso tardío del
cáncer. Representan 0.4 a 3.8%
de tumores sólidos. Se considera
S88
la diseminación es hematógena
por ausencia de barrera hematoencefálica en esta estructura,
la localización primaria más
común es pulmón, seguida de
mama. El diagnóstico se confirma mediante la realización de
RM craneal, determinación de
marcadores tumorales en sangre
y/o LCR (para su diferenciación
con tumores germinales) y estudio histológico.
Enfermedad de Castleman
unicéntrica paramediastinal.
Caso clínico y revisión de la
literatura
LE Andrade Morelos, JF Flores
Pérez, JA Lara Sánchez, R Ovilla
Martínez, A Cabrera García
Medicina Interna, Hospital
Ángeles Lomas, Huixquilucan,
Estado de México
Introducción: la enfermedad
de Castleman es un trastorno
benigno raro caracterizado
por hiperplasia de tejido linfoide que puede desarrollarse
en un sólo sitio (unicéntrica)
o en diversas localizaciones
(multicéntrica). Su etiología es
poco clara, pero la presentación
histopatológica se puede dividir
en variantes hialina vascular,
de células plasmáticas o mixta,
siendo la primera más frecuente en la forma unicéntrica. A
continuación, presentamos un
caso clínico de enfermedad
de Castleman unicéntrica con
presentación asintomática y de
localización paramediastinal.
Descripción del caso: femenino de 21 años que inició al
presentar dolor torácico de leve
intensidad, sin datos relevantes
a la exploración física. En una
radiografía de tórax se identificó
una masa parahiliar derecha,
por lo que se solicitó tomografía
computarizada, observándose
tumoración paramediastinal
con dimensiones aproximadas
de 7.1 x 5.9 x 5.4 cm. Se realizó toracotomía para biopsia
escisional, lográndose sólo
resección parcial por involucro
de vena cava superior. El reporte
histopatológico fue de enfermedad de Castleman del tipo
hialino vascular. Se descartó
enfermedad multicéntrica por
medio de PET. Comentarios:
la enfermedad de Castleman
unicéntrica, a pesar de ser generalmente benigna, requiere
tratamiento debido a su curso
progresivo asociado con involucro de estructuras circundantes,
como en este caso. La cirugía
se considera el tratamiento
más adecuado en la forma unicéntrica cuando es resecable,
siendo curativa en casi todos los
casos. No existe un consenso
respecto al tratamiento en formas irresecables; la radioterapia
se considera una opción, pero
la respuesta es muy variable
y, por la localización en este
caso particular, se prefirió el
uso de agentes quimioterapéuticos, observando una respuesta
favorable. Conclusión: la enfermedad de Castleman es una
entidad benigna rara con un
espectro clínico muy amplio
que debe ser considerada como
un diagnóstico diferencial en
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
enfermedades linfoproliferativas, en vista que en su forma
unicéntrica suele tener un buen
pronóstico.
Metástasis cutáneas como recurrencia de cáncer de mama:
reporte de caso
Y López Bueno, S Méndez Flores, G Liceaga Craviotto
Servicio de Medicina Interna,
Hospital General Regional
núm. 1 Dr. Carlos MacGregor
Sánchez Navarro, IMSS, México, DF
Introducción: las metástasis
cutáneas son raras (0.7-9%)
pueden ser señal temprana de
malignidad o representar recurrencia de un tumor primario
e indican mal pronóstico. Su
aparición ocurre dentro de los
5 años del diagnóstico inicial
del carcinoma. Descripción
del caso: mujer de 80 años con
cáncer de mama tipo lobulillar,
diagnosticado 10 años previos,
recibió FEC, vinorelbina y GC
(6 ciclos en dos años previos).
Fue hospitalizada por indiferencia al medio, oliguria y disnea
de medianos esfuerzos, sangrado de lesiones cutáneas que
habían aparecido un año previo
en tórax y brazo izquierdo. Se
encontró con palidez, deshidratada, derrame pleural derecho y
dermatosis diseminada a tórax
y extremidad superior izquierda
con neoformaciones exofíticas
induradas y eritematosas; ulceradas, fácilmente sangrantes.
Laboratorios a su ingreso con
Hb 7.5 g Hto 24.2% Cr 1.90mg
Urea 89.5mg K 5.86. Tomografía de tórax con derrame
pleural de pulmón izquierdo
e hiperdensidades en parénquima pulmonar sugerentes
de metástasis. Citológico de
líquido pleural sin evidencia de
células neoplásicas malignas.
La biopsia cutánea encontró
una neoformación de células
monomorfas de núcleo central,
tinciones de inmunohistoquímica revelaron: Ki-67(+),
C-erbB-2(-), ER(+) y PR(-), se
diagnosticó metástasis de cáncer de mama. Comentarios:
las metástasis cutáneas de
neoplasias internas se producen
frecuentemente en la mujer
por cáncer de mama y en el
hombre por cáncer de pulmón.
La invasión cutánea ocurre con
frecuencia por extensión directa
o diseminación linfática, la vía
hematógena es menos común.
La mayoría de las metástasis
cutáneas se presentan como
nódulos intradérmicos o subcutáneos únicos o múltiples, que
pueden ulcerarse y presentar
sangrado. Las complicaciones
más frecuentes son infecciones,
dolor y hemorragias. Conclusiones: el reconocimiento
oportuno de metástasis cutáneas ofrece una mayor visión
acerca del pronóstico de la
enfermedad, sin embargo, conocer las complicaciones que
se pueden derivar de éstas,
son importantes para mejorar
la calidad de vida de estos pacientes. Se presentó el caso de
una paciente que ingresó por
falla renal con desequilibrio
hidroelectrolítico, secundario a
deshidratación. Además de sangrado de metástasis cutáneas,
que contribuyó a hipovolemia
y lesión renal. En conclusión,
identificar estas tipos de lesiones de manera correcta y
oportuna, podría mejorar la
calidad de vida.
Síndrome de compre sión
medular como única manifestación en mieloma múltiple IgA
Tannya Velázquez Gaspar, Paola Castro Cortés, Alejandra
Ruiz Fuentes, Adriana Aguiñiga
Rodríguez, Rosario Dorantes
Romandia
Servicio de Medicina Interna,
Hospital General de Zona núm.
48, IMSS, México, DF
Introducción: entre las manifestaciones clínicas iniciales
poco frecuentes del mieloma
múltiple esta el síndrome de
compresión medular siendo el
dolor dorsolumbar el síntoma
mas frecuente causado por actividad lítica vertebral que puede
ocasionar colapsos vertebrales
y ser causa de compresión
medular. Resumen: femenina
59 años con hipotiroidismo de
16 años en tratamiento. Inicia
3 semanas previas con dolor
en región glútea bilateral extendiéndose hasta la cara posterior
de los muslos se agrega disminución de la fuerza muscular
de miembros inferiores con
parestesias y disestesias llegando a imposibilitar la marcha, se
pierde sensibilidad superficial
y profunda con nivel sensitivo
S89
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
en L4-L5, mantiene control
de esfínteres. A su ingreso,
sin adenomegalias, cardiopulmonar sin compromiso,
sin visceromegalias. EFNL;
funciones mentales superiores
conservadas, sin alteración en
nervios craneales, en sistema
motor; tono y trofismo conservado, con fuerza en miembros
superiores 5/5 y miembros inferiores 0/5, REMS; ++/++++ en
miembros inferiores. Cerebelo;
eudiadococinesias y eumetrias.
Babinski bilateral, marcha no
valorada. Sistema autónomo
conservado. Gabinete: GLUC
87, NA 142, K 3.7, CA 8.2
CREAT 0.8, PT 7.4, ALB 2.7,
BT 0.5, FA 77, TGO 24, DHL
667, GGT 40, DEP CREAT 120
ML/HR, LEUC 6.5, HGB 13.5,
HTC 30, PQT 337, TSH 17.9,
T3 28, T4 6, VSG 55. AMO
células plasmáticas mayor del
20%, electroforesis: IgA presente, cadena ligera Kappa.
Tomografía: cambios discales
degenerativos mínimos en columna toracolumbar, lesiones
líticas y blásticas en columna
toracolumbar, sacra, clavículas,
costillas y huesos coxales, sin
estenosis focal del conducto
raquídeo ni hernias. Comentario: el síndrome de compresión
medular es la primera manifestación solo en el 7% de los
casos de mieloma múltiple por
lo que ante esta manifestación
es importante tener en mente la
posibilidad diagnóstica con el
fin de no retrasar el tratamiento
correcto. Alrededor del 40% de
los pacientes con diagnóstico y
S90
tratamiento oportuno llegan a
tener una respuesta adecuada,
las nuevas terapéuticas y el desarrollo de la cirugía ortopédica
espinal en la ultima década han
mejorado la evolución ofreciendo una calidad de vida con
alivio del dolor e incremento en
la funcionalidad.
Tumor neuroendocrino metastásico
Francisco Javier López Maldonado, Mariana Delgado
Villa, Leticia Alejandra Orozco
Mendoza
Servicio de Medicina Interna,
Hospital General de Mexicali, Mexicali, Baja California,
México
La identificación de ZES se
está volviendo cada vez más
complicada, con un retraso
actual en el diagnóstico desde
la presentación inicial de los
síntomas de 5.2 años debido
al uso común de IBPs, ya
que los síntomas pueden ser
enmascarados con dosis convencionales. A continuación
se describe un caso asociado.
Descripción del caso: mujer de
46 años de edad sin antecedentes de importancia, con 2 años
de evolución con enfermedad
ácido péptica caracterizada
por epigastralgia y pirosis,
además de dolor tipo cólico
en hipocondrio derecho. En
una endoscopía de tubo digestivo alto se encontró gastritis,
úlceras antrales múltiples y
duodenitis erosiva. Una prueba
de ureasa resultó positiva y se
administró omeprazol y tratamiento de erradicación para H.
pylori. Por continuar con dolor
cólico en hipocondrio derecho
se realizó US de hígado y vías
biliares, que mostró una lesión
hepática en el lóbulo derecho.
Fue referida al instituto para
su estudio. A su ingreso la paciente continuaba con datos
de EAP. Los exámenes de laboratorio mostraron resultados
normales. La panendoscopía
mostró gastropatía eritematosa
y tres úlceras duodenales en
fase de cicatrización. La TC
mostró un tumor en el lóbulo
derecho del hígado y otro en
el segmento III que reforzó
con el medio de contraste. Una
biopsia hepática informó tumor
neuroendocrino. En la evaluación hormonal se encontró:
gastrina: 19,500 pg/mL, resto
normales. El gammagrama
con octreótido corroboró la
lesión hepática, además de
una lesión en la cola del páncreas. La paciente se sometió
a hepatectomía derecha extendida, pancreatectomía distal y
esplenectomía. Las tinciones
para gastrina y glucagón de
este tumor neuroendocrino
metastásico fueron positivas.
Comentarios y Conclusiones:
los gastrinomas son tumores
neuroendocrinos que ocurren
en el 0.1% de los sujetos con
úlcera péptica y en el 2% de
aquéllos con úlcera péptica
recurrente. Aproximadamente
el 25% de los gastrinomas
se asocian a MEN1; en este
caso el gastrinoma parece ser
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
esporádico. El diagnóstico se
sospecha por el cuadro clínico
y los niveles de gastrina, que
generalmente son mayores de
1000 pg/mL. El octreoscan se
prefiere por tener mayor sensibilidad que otros estudios en
la localización del tumor. En el
tratamiento de la enfermedad
metastásica hepática se recomienda realizar la resección
de metástasis cuando anatómicamente es posible, además
de análogos de somastostatina
para tratar los síntomas y dudosamente la progresión de la
enfermedad.
Anemia hemolítica autoinmune: fenómeno paraneoplásico
asociado con leucemia linfocítica crónica
Teresa Ivonne Gonzaga López,
María Berenice Rodríguez y
Rodríguez, Araceli Cruz Rodríguez, Triana Salgado Muñoz,
Isaac Morones Esquivel, Mónica
Cavazzani Silva, Francisco Javier
Mijangos Huesca, Luis Javier
Castro D’Franchis, Abraham E
Reyes Jiménez
Servicio de Hematología, Departamento de Medicina Interna,
Hospital Central Norte, Petróleos Mexicanos, México, DF
Introducción: los procesos autoinmunes son complicaciones
en enfermedades linfoproliferativas, en particular de la
leucemia linfocítica crónica
(LLC). Las 3 condiciones asociadas son la anemia hemolítica
autoinmune (AHA), púrpura
trombocitopenica autoinmune
y aplasia pura de células rojas.
De estos la AHA tiene una
frecuencia del 3-37%. Descripción del caso: masculino
de 60 años, carga genética
para diabetes, hipertensión y
leucemia, tabaquismo, etilismo
y exposición a tóxicos negados.
Leucemia linfocítica crónica
diagnosticada hace 11 años
debutando con 103,000 leucocitos a expensas de linfocitos,
con aspirado de médula ósea
(AMO) con infiltración linfocítica, inmunofenotipo CD20 93%,
CD10-, CD19-, CD3 80%, CD8
11.6%, CD34-, CD45 100%
indicándose 6 ciclos con fludarabina, ciclofosfamida y
rituximab. Recaída hace 7 años
tratado con prednisona 50mg +
clorambucilo 2 mg, se realiza
nuevo AMO con inmunofenotipo CD19 84.7%, CD20 81%,
CD79 39.6%, CD5 95.5%,
CD38 14.5%, reiniciándose
quimioterapia y con 6 recaídas.
Sin tratamiento, con hemoglobina normal viaja a Canadá y en
forma súbita presenta anemia
grave siendo transfundido con
5 concentrados eritrocitarios
y trasladado a nuestra unidad.
Ingresa con Hemoglobina 5.30,
Hematocrito 15.8, leucocitos
38.6, linfocitos 27.4, plaquetas 78.000, reticulocitos 0%,
deshidrogenasa láctica 1359,
bilirrubina total 1.23, indirecta
0.7, COOMBS directo positivo.
A la exploración con adenomegalia cervical derecha, de
1.5cm, móvil y esplenomegalia,
resto normal. Identificándose
anemia hemolítica autoinmune
se inicia tratamiento con metilprednisolona sin respuesta,
continua rituximab, inmunoglobulina y hemotransfusión
fenotipo similar, último reporte
de hemoglobina de 7.6 gramos continuándose manejo
inmunosupresor con azatioprina y ciclosporina, después
de 21 días egresa a control
externo y sesión de quimioterapia por persistente actividad
de LLC. Comentario: la infiltración de médula ósea por
células leucémicas incapacita
la respuesta eritropoyética a la
anemia evitando el aumento
de reticulocitos como en este
caso. Conclusiones: existe una
asociación importante entre
estadios avanzados de LLC,
actividad y riesgo de AHA, así
como el uso de fludarabina,
el cual disminuye en combinación con ciclofosfamida.
El desarrollo de citopenias en
cualquier estadio de la enfermedad no tiene impacto en la
supervivencia.
Osteosarcoma extraóseo. Reporte de caso
Georgina Martínez Flores, Marlid Cruz Ramos, Saúl Campos
Gómez
Centro Oncológico Estatal ISSEMYM
Reporte de caso: femenino
de 38 años, tía paterna finada
de cáncer no especificado.
Refiere cuadro clínico de 2
años caracterizado por la
presencia de tumor localizado en escapula izquierda, el
S91
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
cual aumenta de tamaño de
forma progresiva, así como
presencia disnea de medianos
a pequeños esfuerzos los últimos 2 meses. A la exploración
física se integra síndrome de
derrame pleural izquierdo,
resto de exploración física
sin alteraciones. Laboratorios
reportan fosfatasa alcalina
1064 UI/L. Tomografía de
tórax con hallazgos en relación a imagen mediastinal de
probable origen tumoral, con
múltiples focos de extensión
hacia pleura posterior y anterior. Se realizó excéresis del
tumor con reporte patológico
de sarcoma pleomórfico de
alto grado. Paciente con diagnóstico de osteosarcoma extra
óseo, que por hallazgos clínicos, estudios de laboratorio y
gabinete se indica tratamiento
médico con quimioterapia
dando tratamiento a base
de adriamicina y cisplatino.
El osteosarcoma se define
como tumor maligno del esqueleto caracterizado por la
formación directa de hueso
inmaduro o tejido osteoide
por las células tumorales. Los
osteosarcomas extraóseos
son neoplasias poco comunes, ocupan el 1-2% de los
sarcomas de tejidos blandos
y aproximadamente 2-4% de
todos los osteosarcomas. Se
presenta en la edad adulta
entre los 50 y 60 años, con
una edad media de 53 años.
Su sitio de localización se
da en sitios alejados de las
extremidades siendo intesti-
S92
no delgado, timo, pulmón,
pleura, mediastino, cuello y
tiroides. En las extremidades
el sitio más frecuente es la
escapula y tiene pobre respuesta a la quimioterapia.
Tiene un pobre pronóstico,
teniendo una supervivencia a
los 5 años del 22 – 66%. Los
osteosarcomas extra óseos que
se presentan en mediastino
son extremadamente raros,
con solo 6 casos reportados
en la literatura, de los cuales
5 eran de sexo masculino.
Los tumores se localizaban
en el mediastino anterior o
superior y tenían un tamaño
aproximado de 10cm. La quimioterapia con doxorubicina
mas bebacizumab ocasionan
disminución del tumor, a su
vez, se ha visto una adecuada
evolución posoperatoria en
las resecciones de metástasis
cardiacas, mediastinales o de
sistema nervioso, lo que refleja una mayor supervivencia y
mejor calidad de vida en estos
pacientes.
Enfermedad poliquísitca del
adulto y cáncer
Monica Cavazzani Silva, María
Berenice Rodríguez Rodríguez,
Ofelia María Rosales del Real,
Teresa Ivonne Gonzaga López,
Adriana Paula Matamoros Mejía, Vianey Gómez Guzmán,
Ciro Marco Vinicio Porras Méndez, Abraham Emilio Reyes
Jiménez, Luis Javi
Servicio de Medicina Interna,
Hospital Central Norte Petróleos Mexicanos, México, DF
Introducción: la enfermedad
poliquística del adulto es un
complejo de manifestaciones
quísticas en distintos tejidos,
de ellas, la renal es la más frecuente (1:600), la enfermedad
quística hepática no parasitaria
tiene una prevalencia de 0.130.6%, el número y tamaño de
los quistes correlaciona con
la edad, más frecuente en
mujeres y se asocia con poliquistosis renal. Del 1-3% de
quistosis hepatorrenal presenta
quistes en otros órganos. Las
neoplasias quísticas pancreáticas son el 10% de las lesiones
quísticas pancreáticas siendo
el seudoquiste el más frecuente
y hasta 10% de la poliquistosis del adulto se acompaña
de aneurismas cerebrales. La
neoplasia asociada en afección renal es cáncer de células
claras, en el caso de páncreas
e hígado los cistoadenomas.
Descripción del caso: femenino de 71 años con diabetes
mellitus tipo 2 e hipertensión
arterial sistémica. Acude por
dolor abdominal agudo, a la
exploración solo destaca ascitis. FA 742, GGT 1095, TGO
39, TGP 17. Tomografía de
abdomen con ascitis, quistes
hepáticos, 5 quistes renales
izquierdos y 4 derechos y en
cabeza de páncreas y dilatación de la vía biliar. Tomografía
de cráneo con quiste aracnoideo temporal izquierdo.
Paracentesis negativa a células
neoplásicas y CPRE y toma de
biopsia de tumor de ámpula
de Vater con adenocarcinoma
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
moderadamente diferenciado
invasor. Comentarios: la poliquistosis comprende distintos
espectros incluyendo afección
renal (la más frecuente), hepática (en segundo lugar) y
pancreática además de otras
manifestaciones extraintestinales (aneurismas cerebrales). Su
asociación con cáncer depende del grado de poliquistosis
así como la presentación de
quistes en distintos tejidos
pero generalmente son estirpes
poco comunes. En el caso de la
paciente presenta sintomatología abdominal con quistes con
localización renal, hepática y
ámpula de Vater con diagnóstico de adenocarcinoma que
por lo general presenta patrón
obstructivo como en el caso.
Conclusión: en la enfermedad
quística la mayoría de las lesiones son benignas sin embargo
la clave es la vigilancia y el
seguimiento de los pacientes
con sintomatología persistente
no justificada haciendo hincapié en el uso de la tomografía
sobre la ecografía. La mayoría
de las neoplasias asociadas
se diagnostican en exploraciones quirúrgicas pero la
biopsia percutánea con aguja
y laparascopia son de utilidad.
Se concluye que tiene enfermedad poliquística la cual se
asoció con malignidad.
Linfoma cutáneo angiocéntrico
de células T tipo hidroa vacciniforme. Reporte de caso
Alejandro Maya Gutiérrez,
Johanna Elizabeth Paredes
Sánchez, Eduardo Martínez
Sánchez, Antonio Cruz Estrada
Hospital General de México
MS, mujer de 20 años, sin antecedentes de importancia. Inicia
su cuadro tres meses previos a
fecha de ingreso al presentar
múltiples pápulas en ambas
encías, luego aparece úlcera en
paladar blando poco dolorosa
de bordes regulares de 1.2x2
cm, y aumento de volumen en
región submandibular y mejilla izquierda, fiebre, nausea
y vómito; ingresa a Medicina
Interna para estudio, se biopsia paladar blando y ganglios
submandibulares. Durante
su estancia mejoró sintomatología con antipiréticos, se
egresó para continuar estudio
por la consulta externa. Un
mes después, inicia con tos
en accesos no productiva de
predominio nocturno, fiebre
no cuantificada, escalofríos
y diaforesis nocturna, acompañada de rinorrea hialina
y edema palpebral, dos días
después odinofagia y disfagia,
recibe tratamiento en medio
externo sin mejoría, se agrega
hipoacusia y otalgia derecha,
náusea, vómito y cefalea EVA
9/10, además de parestesias en
extremidades, palpitaciones y
sensación de angustia, ingresa
a urgencias por taquicardia
supraventricular. A la EF edema
palpebral, narina izquierda con
costras hematicas, cavidad oral
con cicatriz en paladar blando
derecho de 2cm de diámetro.
Glándulas salivales submaxila-
res con aumento de volumen,
induradas, bordes regulares, no
dolorosas y adenopatías bilaterales de 2x2 cm de consistencia
blanda, sin cambios de color o
temperatura, taquicardia sin
otros agregados, abdomen
normal, en piel presenta múltiples lesiones diseminadas a
cara y extremidades, algunas
en tronco, caracterizadas por
pápulas con costra hemática
central, pruriginosas de menos
de 1cm, resto normal. BH, QS,
ES y PFH normales, DHL 433
UI/L, PCR, FR, ANAs, complemento y EGO normales,
b2-microglobulina 4,44 mg/dL
(1.42-2.52). Reporte de biopsias: conglomerado ganglionar
cervical con hiperplasia mixta
de ganglios linfáticos; paladar
duro con sialoadenitis linfocítica crónica. Evoluciona
tórpidamente con ataque al
estado general, fiebre, edema
facial y extensión de lesiones
dérmicas, presentando induración y aumento en su
diámetro además aparecen
algunas vesículas sobre lesiones ya descritas, se realiza
biopsia de piel que reporta:
Linfoma cutáneo angiocéntrico
de células T tipo hidroa vacciniforme. Conclusión: Forma
rara y agresiva de entidad que
afecta principalmente a niños y
adolescentes de Latinoamérica
y Asia, con afección dérmica
generalizada, así como edema facial, se asocia infección
por EBV, el pronóstico es generalmente malo con pobre
respuesta a tratamiento.
S93
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Síncope como presentación de
paraganglioma abdominal
Maricela Beatriz Rocha Carrillo,
José Enrique Cruz, Gabriela
Liceaga Craviotto
Servicio de Medicina Interna,
Hospital General Regional Carlos McGregor Sánchez Navarro,
IMSS, México, DF
Introducción: los paragangliomas
son tumores neuroendocrinos
raros de células derivadas de la
cresta neural y secretan catecolaminas. Los extraadrenales
representan el10%del total de
paragangliomas. Generalmente
los parasimpáticos se encuentran
en el cuello y lo simpáticos a lo
largo de la cadena simpática;a
proximadamente75%surgen en
el abdomen. La presentación
clínica más frecuente son las
crisis hipertensivas, y menos frecuentes cuadros de ortostatismo
y síncope, relacionados a paragangliomas vagales o carotideos.
A continuación se presenta un
caso de paraganglioma abdominal con presentación inicial
de síncope. Resumen: mujer
de 75 años con antecedentes
de DM2, HAS, hipotiroidismo
primario, parálisis de Bell, EVC
isquémico. Ingresa al servicio de
urgencias por presentar pérdida
súbita del estado de alerta de 5
minutos de duración. Ingresó
al servicio de medicina interna
con TA 90/60 mmHg, FC 70’,
FR20x’, Temp 36º Glasgow 15,
cardiopulmonar y abdomen sin
alteraciones, se solicita Holter,
ecocardiograma, TC de cráneo
y doppler carotideo sin altera-
S94
ciones. Durante su estancia la
paciente presentó con episodios de hipertensión arterial,
diaforesis profusa, ortostatismo.
Laboratorios generales y perfil tiroideo sin alteraciones. La TC de
suprarrenales sin alteraciones,
TC de abdomen se observa tumoración abdominal de 43x58a
nivel inetrcavoaortico de cuerpos vertebrales L3-L4. Niveles
de catecolaminas orina: totales
678.1 mcg/24 h, adrenalina 6.8
mcg/24 h, noradrenalina 616.1
mcg/24 h.Se realizó gamagrama con I131MIBG con lesión
intercavo aortica a nivel de L3
redondeada de bordes bien
definidos con densidad (33UH)
y calificaciones periféricas de
44x39mm, se asocia a captación
importante del radiofármaco.
Probable paraganglioma. Se
somete a resección quirúrgica
de tumoración con hallazgos
de tumor intercavo aórtico de
10x10cm infiltrando vena cava
en su pared anterior con infiltración a aorta con reporte
histopatológico de paraganglioma. Conclusiones: el síncope es
una presentación que representa
menos del 10%en el la clínica
de los tumores neuroendocrinos, generalmente asociados
a paragangliomas vagales o
carotideos, principalmente de
origen parasimpatico o generado por compresión. Dentro
del abordaje diagnóstico de un
paciente con síncope posterior a descartar la causas más
frecuentes que lo originen se
deberá buscar asociación con
tumores neuroendocrinos, por
lo que es importante la sospecha
de tumores neuroendocrinos en
los pacientes con síncope adecuadamente estudiados.
Metástasis óseas a nivel lumbar
como forma de presentación
de adenocarcinoma gástrico
Pedro de Jesús Ventura Ramos,
Gerardo Callejas Hernández
Servicio de Medicina Interna,
Hospital General Dr. Fernando
Quiroz Gutiérrez, ISSSTE, México, DF
Introducción: el adenocarcinoma gástrico representa el 15
a 57 % de cánceres gástricos se
sabe por la literatura que las metástasis más frecuentes en este
tipo de cáncer son: hepáticas
y pulmonares, las óseas representan un 10%, de éstas el 20%
son a nivel lumbar. Descripción:
masculino de 61 años de edad,
alcoholismo y tabaquismo intensos; lumbalgia crónica de 8
años, sin etiología determinada
en tratamiento con AINES, internamiento 2 meses previos
por HTDA secundario a úlcera
gástrica. Inició 3 días previos a
su hospitalización con aumento
de dolor a nivel lumbar de tipo
punzante, de intensidad 7/10
con irradiación a región glútea
y extremidad pélvica izquierda
ocasionando disminución de
los arcos de movilidad llegando
a incapacitar la deambulación,
acompañada de parestesia, agregándose náusea sin vómito. E.F:
TA: 110/70 mmHg, FR: 21 PM,
FC: 114 LPM, Temp: 36.2ºC,
adenopatía a nivel cervical y su-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
praclavicular izquierdo de 1 cm,
cardiopulmonar sin alteraciones,
abdomen globoso a expensas de
líquido de ascitis no a tensión,
resto normal, en región lumbar dolor y con irradiación a
miembro pélvico izquierdo.
Laboratorios: Leu. 16.6 con
Linf: 6.6, HB: 9.9, PLT 38 mil,
TP: 40% USG hepático reporta
datos de hepatopatía crónica,
TAC de columna: lesiones líticas
a nivel T9-T11, L4-L5, gammagrama óseo reporta patología
ósea infiltrativa; por linfocitosis
y adenopatías se realiza AMO
con reporte normal y biopsia
de ganglio supraclavicular que
reportó carcinomatosis poco
diferenciada de patrón sarcomatoide, enviándose a estudio de
inmunohistoquímica el cual reportó adenocarcinoma gástrico
poco diferenciado metastásico.
Comentarios: este caso llama
la atención debido a la notable
falta de clínica digestiva, aunque
se cuenta con el antecedente de
HTDA, la endoscopía y biopsias
gástricas no revelaron malignidad, así mismo nunca existió
por estudios de imagen evidencia de metástasis hepáticas o
pulmonares y fue la patología
lumbar la que encaminó a iniciar el protocolo de estudio y
a través del cual se concluyó el
diagnóstico, haciendo de este
caso una presentación atípica.
Conclusiones: la lumbalgia es
un problema común dentro de
la población, en ocasiones no
se le da la importancia debida
y no es estudiada a fondo, un
dolor lumbar no siempre es se-
cundario a un proceso mecánico
y, aunque un porcentaje muy
bajó tendrá como causa alguna
otra etiología, siempre será importante estudiarla para detectar
oportunamente patologías que
pudieran manejarse de manera
oportuna.
Crisis hipercalcémica en el
paciente geriátrico como manifestación de adenocarcinoma
paratiroideo
A Carrasco Mexia, AE Márquez
Pelayo, D Rodríguez Pontones,
N Arias Ponce, BG García
Duarte
Servicio de Geriatría, Hospital
General Regional 46, IMSS,
Guadalajara, Jalisco
Introducción: la crisis hipercalcémica es una complicación
del hiperparatiroidismo primario (HPTP), requiere diagnóstico
y tratamiento médico-quirúrgico urgente. Se debe al acumulo
del Ca sérico que no puede ser
depurado por el sistema renal.
Su incidencia (entre el 4-6,7%
de los HPTP) es baja, existe
escasa información acerca de
sus peculiaridades clínicas y
patológicas. Una causa es el
Carcinoma paratiroideo, neoplasia extremadamente rara,
su incidencia se calcula en
0.015/100,000 habitantes, no
hay diferencias en cuanto al
sexo, raza o grupos geográficos.
Descripción del caso: hombre,
70 años, con hipertensión arterial diagnosticada hace 1 año,
sin tratamiento con farmacos,
tabaquismo activo. Ingresó con
trauma craneal leve debido a
caída de su altura por mareo,
con bradilalia, bradipsiquia,
confusión leve, paresia corporal derecha e hiporreflexia
simétrica que 72 h después se
recuperó totalmente, con nódulo palpable en región tiroidea
izquierda, dolor abdominal,
estreñimiento y gonartralgia.
Los paraclínicos mostraron Ca
12.6 mg/dL, PTH 1823.4 pg/
mL, creatinina 3.2 mg/dL. Tomografía simple cráneo-cuello:
calcificación en hoz y tienda
cerebelosa, confirmó crecimiento paratiroideo izquierdo.
Gammagrama óseo: actividad osteoblástica en 5º y 7º
arco costal,escapula izquierda.
Tratamiento inicial para hipercalcemia con poca respuesta,
se indicó acido zolendrónico 4
mg con mejoría del Ca 8.6 mg/
dL. Se resecó tumor en cuello
de 4cm compatible con adenocarcinoma paratiroideo. PTH
posterior 140 pg/mL, Ca 8.4
mg/dL. Comentario: se desconoce la etiología del carcinoma
paratiroideo, esta asociado al
gen Rb1 y HRPT2. La mayoría
son funcionales, la clínica se
debe a hipercalcemia, el valor
promedio es 15-16 mg/dL o 3-4
mg/dL encima del límite alto
normal. El 95% de los casos
son sintomáticos al diagnóstico, 30-76% presentan masa
firme, 10% tienen disfonía por
compromiso del nervio laríngeo
recurrente. Los criterios histológicos (1993) son crecimiento
invasivo,macronucleólos y actividad mitótica. El tratamiento
S95
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
se basa en escisión quirúrgica
amplia. El seguimiento es con
niveles de Ca y P, la complicación es la recurrencia y el
síndrome del hueso hambriento. Este paciente cuenta con
criterios clínicos, bioquímicos
e histológicos de esta patología. Conclusión: por la baja
incidencia de esta neoplasia,
es vital la sospecha diagnóstica ante la presencia de crisis
hipercalcémica y tumoración
en área tiroidea, sobre todo en
ancianos que son más sensibles
a los síntomas, ya que el diagnóstico temprano favorece el
pronóstico.
Calcinosis cutánea paraneoplásica: reporte de un caso
María Fernanda Arroyo Ruiz,
G Paulino Camacho, A Olvera
Acevedo
Medicina Interna, Hospital de
Especialidades, Centro Médico
Nacional La Raza, IMSS, México, DF
Introducción: se reporta caso
de paciente femenino con calcinosis cutis, sin sintomatología
agregada y diagnóstico final
de linfoma de Hodgkin (LH).
Descripción del caso: femenina de 55 años, antecedente
de exposición a humo de biomasa y diagnóstico reciente
de hipercalciuria absortiva en
manejo con hidroclorotiazida.
Acude por lesiones en pulpejo de dedos 1 a 3 de mano
izquierda de 10 años de aparición, inicialmente puntiformes
y agudizada significativamente
S96
hace 1 año, presentándose en
conglomerados, el más grande
de 1x1cm, duras y blanquecinas
con eritema circundante, dolor
punzante ocasional y salida de
material cálcico a la presión; 6
meses previos a su ingreso, con
adenomegalias en niveles II, III y
IV, duras, no dolorosas, móviles
y no fijas a planos profundos,
niega diaforesis nocturna o
pérdida de peso. Biometría
hemática, electrólitos séricos
y urinarios sin alteraciones,
radiografía de manos con calcinosis extraarticular en dedos
izquierdos 1 a 3, radiografía
de tórax con ensanchamiento
mediastinal superior, tomografía
de tórax con conglomerados
ganglionares mediastinales de
hasta 60x45mm retrocardiacos,
biopsia escisional de ganglio
cervical reporta LH clásico subtipo celularidad mixta. Se envía a
Oncología para tratamiento. Comentario: la calcinosis cutánea
es un trastorno caracterizado por
el depósito de sales de calcio en
la piel, que de acuerdo al mecanismo fisiopatológico se clasifica
en distrófica, metastásica, iatrogénica, idiopática y calcifilaxis.
Dentro del grupo de calcinosis
distróficas se encuentran las asociadas a tumores principalmente
dermatológicos; sin embargo
se encuentran reportados en la
literatura 2 casos de calcinosis
asociada a malignidad no dermatológica en pacientes con
dermatomiositis y en cada caso
se asoció a linfoma extranodal
y osteosarcoma. No existe tratamiento específico para este
tipo de calcinosis más que el
tratamiento de la enfermedad
oncológica. Conclusiones: la
calcinosis cutánea es un trastorno poco común cuyo estudio
debe abarcar alteraciones hidroelectrolíticas, metabólicas,
enfermedades reumatológicas
y finalmente oncológicas; en la
paciente se descartó alteraciones en metabolismo de calcio
y fósforo, hiperparatoriodismo,
lupus eritematoso sistémico,
esclerosis sistémica o localizada. Finalmente se demostró
LH clásico subtipo celularidad
mixta en estudio histopatológico
de adenopatía cervical.
Quilotórax no traumático asociado con linfedema primario
idiopático: Reporte de un caso
Moisés Hinojosa Bujaidar, Diego Ceballos Ávila, O Guerrero
Soto, Sandra Mosqueda Lunar,
Alma Aguilar
Departamento de Medicina Interna, Hospital General de Zona
y Medicina Familiar 02, IMSS,
Irapuato, Guanajuato
Introducción: el linfedema
primario de las extremidades
asociado a un exudado pleural
es una manifestación clínica
ampliamente conocida. Sin
embargo, la coexistencia de dicho proceso con un quilotórax
es extremadamente rara. En la
bibliografía médica solamente
han sido publicados cinco
casos bien documentados.
Describimos un nuevo caso
de quilotórax asociado a linfedema primario. Caso clínico:
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
paciente de 17 años de edad
con diagnóstico de linfedema
idiopático primario de miembro pélvico izquierdo a los 12
años de edad. Acude a urgencias con disnea a los pequeños
esfuerzos, la exploración física
mostró TA 100/60 mmHg, FC
100x’, FR 32, TEM 36.5. Sin
adenopatías y/o hepato-esplenomegalia, taquipnea, aleteo
nasal, disminución movimientos amplexión y amplexación
en hemitorax derecho con
ausencia de murmullo vesicular y matidez integrándose un
síndrome derrame pleural derecho. Laboratorios: Hb 15.2 g/
dL, plaquetas 271,000 cel/mL,
leucocitos 8100 cel/mm3, PMN
75.4%, linfocitos 17%, glucosa 71 mg/dL, BUN 10 mg/dL,
urea 24 mg/dL, creatinina 0.7
mg/dL, colesterol 99.0 mg/dL,
triglicéridos 35 mg/dL, sodio
143 mEq/L y potasio 4.1 mEq/L,
proteínas totales 3,800 mg/dL,
albúmina 1.7 g/dL, DHL 350.
Se realizó radiografía de tórax:
derrame pleural derecho del
100%. Toracocentesis: líquido
de apariencia lechosa, pH
8.0, leucocitos 470 cel/mm3,
polimorfonucleares 81%, mononucleares 19%, glucosa 98
mg/dL, proteínas totales 4400
mg/dL, DHL 241, colesterol total 82 mg/dL y triglicéridos 741
mg/dL. Tinción de Gram, Ziehl
Neelsen, tinta china y cultivos
y células malignas negativo.
TAC tórax. Derrame pleural
derecho; sin adenopatías, infiltrados y/o lesiones sugestivas
de neoplasia. Comentarios:
el quilotórax se define, clínicamente, como la presencia
anormal de líquido de aspecto
lechoso en el espacio pleural
que se origina en el sistema
linfático gastrointestinal. Es
una entidad poco frecuente, de
etiología diversa, cuya causa
principal es la lesión del conducto torácico. Las asociación
de quilotórax no traumático y
linfedema primario es rara y
solo se han descrito 6 casos
en la literatura; incluyendo
nuestro caso.
Derrame pleural bilateral
secundario a linfangioleiomiomatosis: reporte de un
caso
Ariadna Aguiñiga Rodríguez,
H Garibay Chávez, JR García
Díaz, IG Verdines Rodríguez, T
Velázquez Gaspar, JO Duarte
Flores
Servicio de Neumología, Hospital General La Raza, IMSS,
México, DF
Introducción: la linfangioleiomiomatosis es una enfermedad
rara, que consiste en una proliferación anormal de células
musculares inmaduras que crecen alrededor del parénquima
pulmonar, que condiciona a
insuficiencia respiratoria. Afecta de manera predominante a
mujeres jóvenes, en edad fértil.
Presentamos el caso de una
paciente con derrame pleural
como manifestación inicial
de linfangioleiomiomatosis
femenino de 19 años de edad,
con antecedente de esclerosis
tuberosa diagnosticada a los
5 años de edad, ingresa por
presentar dolor torácico, de
predominio de lado izquierdo, acompañado de disnea
que evolucionó de mMRC II a
mMRC III, así como pico febril
de 38° de manera aislada, a
la exploración física presenta
matidez a la percusión en bases
de ambos hemitórax, así como
ausencia del ruido respiratorio
bilateral, integrando síndrome
de derrame pleural, radiografía de tórax con presencia de
radiopacidad homogénea en
ambas bases, compatible con
derrame pleural bilateral, se
decide colocación de Sonda
Endopleural en ambos hemitorax, con adecuada reexpansión
pulmonar, posterior retiro de las
mismas. Se realiza TACAR de
tórax, la cual reporta lesiones
bulosas y quistes subpleurales,
con patrón en vidrio esmerilado. Se programa biopsia
pulmonar, que reporta múltiples
lesiones nodulares, rodeadas
de músculo liso, compatible
con linfangioleiomiomatosis.
Conclusión: la linfangioleiomiomatosis suele presentarse,
a nivel pulmonar, como un
derrame pleural espontáneo,
sin causa aparente, además de
que tiene fuerte asociación con
la esclerosis tuberosa, como
en el caso de nuestra paciente,
quien cumple con todas las
características principales de la
enfermedad (mujer joven, edad
fértil, con esclerosis tuberosa,
derrame pleural espontáneo),
confirmándose el diagnóstico
S97
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
por biopsia. Hasta el momento,
no existe un tratamiento efectivo y seguro para la enfermedad,
sino únicamente sintomático.
Retención hídrica como primera manifestación de mieloma
múltiple. Reporte de caso
Diego López Macías, Jorge
Reyes Hernández, Virginia Sánchez
Medicina Interna Unidad 110,
Hospital General de México Dr.
Eduardo Liceaga, México, DF
Introducción: mieloma múltiple representa el 10% de
las neoplasias hematológicas.
Mayor incidencia en hombres,
caracterizado por destrucción
ósea, falla renal, anemia e hipercalcemia. Sus síntomas son
fatiga, dolor óseo e infecciones
recurrentes. Masculino de 44
años, antecedente de Diabetes
mellitus secundaria a pancreatitis alcohólica. Inicia 2 meses
previos por fatiga y edema en
extremidades inferiores que
disminuye con el reposo y
aumenta a la deambulación.
Un mes después posterior a
esfuerzo físico presenta lumbalgia, intensidad 8/10, con
irradiación a región suprapúbica. Dos días después se
agrega debilidad y parestesias
en miembros inferiores que
fueron progresando hasta la
incapacidad para la deambulación en lapso de 1 semana,
mialgias generalizadas, edema
en áreas de declive, poliaquiuria y tenesmo vesical. Ingresa
a urgencias donde presenta
S98
alucinaciones visuales y auditivas, fiebre, disminución de
volúmenes urinarios y anasarca.
A la exploración con palidez de
tegumentos, anasarca, derrame
pleural bilateral, fuerza muscular 1/5 y disminución de reflejos
ostetendinosos en miembros
inferiores, miembros superiores
con fuerza muscular conservada. Sensibilidad térmica, álgica
y propioceptiva conservadas.
Urea 83.5, creatinina 1, glucosa
198, albúmina 1.5, proteínas
totales 6.1, colesterol 63, triglicéridos 181, leucocitos 14,300,
Hb 11, plaquetas 190,000, Na
134, K 5.3, Ca 7.5, proteína
Bence-Jones en suero cadena
lamda 12.7 g/dL, cadena kappa
15.6 g/dL, TFG 66.53 mL/min,
microproteínas 450 mg/24 h.
Líquido pleural con características de exudado. IgG 2150
(751-1,560 mg/dL), IgA 593
(82-453 mg/dL). Electromiografía miopatía más polineuropatía
sensorimotora del tipo degeneración axonal. Aspirado medula
ósea moderadamente hipercelular, moderado incremento
de células plasmáticas neoplasicas y depresión eritroide y
conservación granulocitaria y
linfocitaria. Número de células
plasmáticas 21%. Conclusión:
dentro del espectro de las
enfermedades de discrasia de
células plasmáticas, el síndrome de POEMS una forma rara
de mieloma múltiple, se define
por la presencia del desorden
de células plasmáticas monoclonal y polineuropatía, que se
puede acompañar de mieloma
osteosclerótico, enfermedad de
Castleman, organomegalia, endocrinopatía, edema, cambios
de piel y papiledema. No todos
los pacientes presentan todos
los criterios al momento del
diagnóstico, pero debe haber
una relación temporal sin una
causa atribuible. La sobrevida
es del 99% a 13.8 años.
Enfermedad de Hodgkin clásica extraganglionar hepática
primaria
Gyna Alejandra Altamirano
Solórzano, Norma Ortega Gutiérrez, Cindy Ledesma De la
Cruz
Medicina Interna, Hospital General Regional núm. 1 Carlos
Macgregor Sánchez Navarro,
IMSS, México, DF
Introducción: la enfermedad
de Hodgkin extraganglionar
se registra alrededor de 15 al
30% de los casos. Los síntomas obedecen a la afectación
del parénquima y no haber
sido demostrada la afectación
de ganglios linfáticos, sangre
periférica y medula ósea. El
diagnóstico se realiza casi exclusivamente mediante biopsia
quirúrgica. Debido a la falta de
especificidad de las manifestaciones clínicas la mayoría de
estos casos son diagnosticados
post-mortem. Descripción del
caso: hombre de 39 años de
edad sin antecedentes personales patológicos. Inició su
padecimiento 10 meses previos
caracterizado por fiebre de
39°C de predominio nocturno,
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
diaforesis, pérdida de peso de
30 kg en el mismo tiempo,
tos productiva blanquecina,
agregándose náusea y vómito,
dolor en hipocondrio derecho
e intolerancia a la vía oral. A
la exploración física: palidez
generalizada de tegumentos,
hipotrofia muscular y hepatalgia. En exámenes paraclínicos:
hemoglobima de 9 g/dL normocítica hipocrómica, electrólitos
normales, TGO: 39 UI/L, TGP:
21 UI/L, bilirrubina total: 8.87,
directa: 6.39, Alb 1.9 GGT:
134 líquido cefalorraquídeo:
normal. TAC toraco-abdominal:
hepato-esplenomegalia sin
evidencia de ganglios. Se descartó tuberculosis, hepatitis B
y C, VIH. Panel TORCH (IgG
positivo para citomegalovirus).
B2 microglobulina 4592 UI/L,
marcadores tumorales negativos. fosfatasa alcalina 510
UI/L, DHL: 229 UI/L. Factor
reumatoide < 20 mg/dL, ANA,
negativos. VSG 16 mm/h. Hemocultivos y mielocultivos sin
desarrollo bacteriano. Endoscopia: gastropatía eritematosa de
antro. Biopsia gástrica: gastritis
aguda erosiva. AMO: medula ósea hipercelular (90%) a
expensas de serie mieloide
y megacariocitica. Relación
mieloide eritroide 5: 1 Biopsia
de Hueso: Displasia de serie
mieloide y megacariocítica.
Biopsia de hígado: prueba de
inmunohistoquímica linfoma
de Hodgkin clásico con infiltración periportal CD30 positivo y
LMP1 positivo. Conclusión: en
pacientes con clínica sugestiva
de probable linfoma sin sitio
específico para su confirmación
realizar búsqueda intencionada
de presentación extraganglionar
con enfoque a los focos primarios más comunes.
Tumor de células pardas en el
cuerpo del esfenoides secundario a hiperparatiroidismo
primario por adenocarcinoma
paratiroideo
José Miguel Hinojosa Amaya,
René Rodríguez Gutiérrez, Dionicio Ángel Galarza Delgado
Hospital Universitario Dr. José
Eleuterio González
Introducción: en su etapa terminal, el hiperparatiroidismo causa
movilización de osteoclastos,
formando tumores de células
pardas. Caso: paciente femenino de 53 años. Madre con
HAS, cardiopatía isquémica
y EVC isquémico, Padre con
hipotiroidismo, abuela con CA
hepatocelular. Refiere exposición a humo de biomasa. APP:
HAS de 8 años de evolución
tratada con losartan 50 mg c 12
horas y furosemida 20 mg c 12
horas. Nefrolitiasis hace 1 año
en 2 ocasiones, asociado a dolor
lumbar. Estreñimiento crónico.
Fractura de tobillo izquierdo en la
juventud. Resección de fibroadenoma mamario e histerectomíaa
hace 14 años. Resección de
granulomas en la encía inferior.
Acude por pérdida de la visión
periférica bilateral que le ocasiona chocar contra objetos en el
campo visual externo y hallazgo
de tumoración a nivel del clivus,
por lo que se envía a la consulta
de medicina interna para valoración preoperatoria de biopsia
transesfenoidal. Se documenta
hipercalcemia de 15.2, por lo
que se decide interna. EF normal,
a excepción de paralisis de VI par
craneal izquierdo. Hb 9.67 HCV
83.0 HCM 27.2 WBC 4.32 Plaq
272 TP11.6 TTP 29.2 INR 1.04
BUN 24 Creat 1.0 Prot 6.6 Alb
3.9 Glob 2.7 Na 140 Cl 104.6
K 4.8 Ca 13.1 PO <1.0 Mg 1.5.
La hipercalcemia fue manejada
con solución salina intravenosa
y furosemida. Se realizó aspirado
de médula ósea, biopsia transesfenoidal de la lesión (negativa
para células plasmáticas) y PTH
intacta (1322 pg/mL). La biopsia
del tumor esfenoidal compatible
con tumor de células gigantes.
Gammagrama de paratiroides
positivo para la demostración
de adenoma paratiroideo, que
se reseca y se diagnostica adenocarcinoma paratiroideo. Se
realiza hemitiroidectomía del
lado derecho. Comentarios: en
la literatura existes sólo 2 reportes de tumores pardos en el
cuerpo del esfenoides, ya que el
lugar mas común de aparición
es en los huesos maxilares, que
en esta paciente también había
evidencia de dichos tumores.
Conclusiones: la medición de
PTH es el parteaguas en el estudio de la hipercalcemia, con
o sin tumor, los tumores pardos
representan la etapa final del
hiperparatiroidismo y se manifiestan como tumores de células
gigantes en presencia de PTH
elevada.
S99
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Tumor germinal extragonadal
tipo coriocarcinoma
Roxana Vázquez Ramírez
Hospital General Regional Dr.
Rafael Pascacio Gamboa, Tuxtla
Gutiérrez, Chiapas
Introducción: el coriocarcinoma es una neoplasia
trofoblastica altamente maligna
, puede ser clasificado como
gestacional y no gestacional
basado a si es o no secundario a
embarazo. Puede ocurrir varios
meses o años después del último embarazo, el intervalo más
largo entre un último embarazo
y coriocarcinoma se ha reportado de 22 años. Descripción
del caso: femenina de 24 años
de edad, sin APP de importancia, AGO: menarquia: 12 años
ritmo irregular IVSA 21 años.
Gesta: 1 A: 1 (hace 2 años)
FUM: no especifica. Cuadro de
2 meses de evolución de cefalea, progresiva, holocraneana,
acompañada de disminución
progresiva de agudeza visual
con posterior amaurosis total
bilateral y hemiplejia derecha,
a su ingreso con vomito en
proyectil y CCTCG. EF: Glasgow 14, midriasis bilateral,
ausencia de reflejo fotomotor
y consensual, parálisis de 3ero
y 6to PC, hemiplejia derecha. TAC de cráneo simple
con presencia de 2 lesiones
hiperdensas en región frontal
izquierda y región occipital
derecha, USG abdomen superior y pélvico sin alteraciones,
RX de tórax normal. Se realiza
resección quirúrgica de lesión
S100
frontal izquierda reportándose
sugerente de tumor trofoblasto. Inmunohistoquímica con
anticuerpos de HGC positivo.
AFP normal y fracción beta de
HGC de 291,590 Miu/MI. Se
concluye DX: coriocarcinoma
y se inicia manejo con QT y
posteriormente RT. Comentario: el coriocarcinoma es un
tumor de células germinales
no germinomatoso representa
el 5% de TCG de SNC, manifestándose con aumento de
la presión intracraneal con
perdida visual, polidipsia, y
poliuria, pubertad precoz, y
mujeres en edad reproductiva
ciclos menstruales irregulares. Puede ser gestacional y
no gestacional son diferentes
en origen genético, inmunogenicidad, sensibilidad a la
quimioterapia y pronóstico,
el coriocarcinoma gestacional
presenta composiciones variantes con material genético
paterno, es considerado un
aloinjerto por lo tanto tiene
mayor inmunogenicidad y
reacciona bien a la quimioterapia con mejor pronóstico
para el paciente. Los análisis de
polimorfismo microsatélite podrían ser la mejor opción para
determinar su clasificación.
Conclusiones: la finalidad de
presentar este caso clínico es
asociada al limitado número
de casos registrados con esta
entidad diagnostica, así como
hacer énfasis en el pronóstico
desfavorable que implica un
diagnóstico tardío como es el
caso de nuestra paciente.
Linfoma TNK nasal en granulomatosis con poliangeítis,
reporte de un caso
Fátima Margarita Rodríguez-Dávila,1 Sergio Alberto Mendoza
Álvarez2
1
Residente de segundo año de
Medicina Interna
2
Médico adscrito al Departamento Clínico de Medicina
Interna
Hospital de Especialidades,
Centro Médico Nacional La
Raza, México, DF
Introducción: masculino con
diagnóstico de granulomatosis con poliangeítis, con
fiebre de origen desconocido
en estudio resultando linfoma TNK nasal. Descripción
del caso: masculino de 41
años de edad con antecedente
de sinusitis crónica (4 años),
glomerulonefritis pauciinmune por biopsia renal(4 años)
en tratamiento previo con
ciclofosfamida(dosis acumulada 10.8 g), biopsia nariz:
necrosis en placa con abundantes colonias bacterianas.
Inflamación aguda y crónica inespecífica. Inicia PA 4
meses previos a su ingreso
con fiebre intermitente de
predominio vespertino. Se
realizan hemocultivo, urocultivo, mielocultivo, cultivo
de secreción bronquial,baar
en expectoración y líquidos
corporales,cultivo de micobacterias negativos. VHB ,VHC,
VIH no reactivo, ANA y ANCA
negativo, PPD(+) 14 mm. TAC
torácica nódulos de distribu-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
ción subpleural. TAC abdomen:
hepatoesplenomegalia. Broncoscopia: úlcera faríngea(toma
biopsia),proceso inflamatorio
bronquial bilateral. Se hace
diagnóstico de poliangeítis con
granulomatosis ,por nódulos
pulmonares, glomerulonefritis
pauciinmune, inflamación
oral-nasal, BVAS 4, decidiéndose inducción a la remisión
con pulsos de metilprednisolona posteriormente azatioprina
50 mg VO c/12 h, trimetoprim/
sulfametoxazol 160/800 mg
VO c/12 h. Se realiza biopsia
hepática ante sospecha de
TB diseminada vs linfoma,
resultado: esteatohepatitis.
Paciente sin mejoría de cuadro
.Se recibe biopsia de úlcera
faríngea: linfoma de células
TNK de tipo nasal ulcerado
positivo para CD56 y granzima. Comentarios: la GPW
es una vasculitis sistémica
necrosante, con afectación
multiorgánica, se caracteriza por ser ANCA(+), aunque
40% cursa sin anticuerpos(+).
Hasta 90% afectación tracto
respiratorio, 3-13% pueden
cursar con úlceras orales. La
fiebre en estos pacientes puede
ser indicador de actividad ,de
presentarse de forma aislada
deben descartarse otras causas.
El linfoma TNK es una rara
entidad de mal pronóstico,
constituye 1.5% de los linfomas no Hodgkin y se debe
considerar en diagnóstico
diferencial de GPW. Existen reportes de casos aislados en los
que las 2 entidades coexisten.
Conclusiones: no se conoce la
relación entre granulomatosis
con poliangeítis y linfoma. La
inflamación crónica y uso de
ciclofosfamida pueden ser factores de riesgo. El diagnóstico
diferencial entre úlcera por
GPW y linfoma TNK requiere
de inmunohistoquímica. El
pronóstico de paciente linfoma
TNK 85% mortalidad 1 año.
Carcinoma gástrico mixto
adenoneuroendocrino en un
paciente joven. Reporte de un
caso
Sonia Elena Reyes Meza, HL
González Barba, DM Escobedo
Paredes, CM Tornero Romo, GC
Osuna Anguiano, MD Urzua
Orozco
Medicina Interna, Hospital General Regional núm. 46, IMSS,
Guadalajara, Jalisco
Introducción: el carcinoma
mixto neuroendocrino es poco
frecuente, hasta el 2012 solo
60 casos se habían reportado
en la literatura, con una media de 65 años. Caso clínico:
masculino de 36 años que
inició dos meses previos con
dolor abdominal en epigastrio
e hipocondrio derecho, tipo
punzante de intensidad moderada, sin irradiaciones, náuseas,
vómito gastrobiliar, hiporexia,
saciedad temprana, ictericia,
coluria y pérdida de peso (10
kg). A la exploración física
con caquexia, ictericia generalizada, nódulo de Virchow y
hepatoesplenomegalia; resto
sin hallazgos relevantes. Se
reportaron ELISA para VIH, Ac
Anti VHC y Ags-VHB negativos,
amilasa 169 U/L, lipasa 446U/L,
fosfatasa alcalina 715 mg/dL,
ALT 189 U/L, AST 138 U/L,
bilirrubinas totales 14.1 mg/
dL, bilirrubina directa 11.9 mg.
Ultrasonido de hígado y vías biliares reportó hígado de aspecto
granular y ecogenicidad aumenada, esplenomegalia, vesícula
sin litos, sin dilatación de vía biliar intra ni extrahepática. ANA
positivo 1:320, antiDNA negativo, IgG 1080 mg/dL, IgA 424
mg/dL. Ac IgG e IgM anti CMV
negativos, Ac Anti VEB 129 UI/
mL (<20, positivo >20), Ac antimitocondriales negativo, ACE
1.6 ng/dL, Ca 19-9 12.69 U/mL.
Tomografía abdominal contrastada reveló ascitis, pared del
estómago con bordes irregulares, estenosis píloro-duodenal,
reforzamiento de cuello de la
vesícula y acentuación de vía
biliar intra y extrahepática.
Endoscopia reportó neoplasia
infiltrante ulcerada no exofítica en incisura angularis que
involucra curvatura menor en la
porción proximal del cuello de
la unión con el antro y a nivel
de rodilla duodenal e infiltración tumoral por compresión
extrínseca. Histopatológico
confirmó adenocarcinoma difuso pobremente diferenciado
con células en anillo de sello y
diferenciación neuroendocrina,
inmunohistoquímico positivo
para cromogranina A (30%).
Se estadificó como T4N3M1
siendo candidato solo a manejo
paliativo. Conclusiones: cabe
S101
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
resaltar la edad del paciente,
la presentación con ictericia y
asociación a infección con VEB.
Los carcinomas gástricos mixtos
son raros; todos los casos se
han reportado como informe de
caso, por lo que su pronóstico
y comportamiento biológico
no han sido claros, este caso
se presentó con factores de
mal pronóstico al momento del
diagnóstico. Es importante no
subestimar síntomas gastrointestinales en pacientes jóvenes
y realizar un abordaje diagnóstico completo.
Linfoma no Hodgkin difuso
de células grandes tipo B, primario cutáneo. Reporte de un
caso atípico
Paulina Rita Corona Castillo,
Ana Kala Díaz Noriega, Noé
Romero, Perla Esmeralda Flores
López
Servicio de Medicina Interna,
Centro Médico ISSEMyM Ecatepec, Estado de México
Introducción: el linfoma no
Hodgkin representa aproximadamente el 90% de los
linfomas. De los subtipos el
linfoma difuso de células B
grandes es el más frecuente,
representa aproximadamente el
30-40%, en México representa
58%. La clasificación clínica
puede ser nodal o extranodal.
Un 40% son de localización
extranodal, dentro de estos se
encuentra el linfoma primario
cutáneo que representan menos del 4.5% de los casos y se
caracterizan por ser tumores
S102
malignos de bajo grado, con
comportamiento indolente y
buen pronóstico. Descripción
del caso: femenino de 72 años
de edad con diabetes mellitus
tipo 2, neuropatía periférica;
Hipertensión Arterial Sistémica, Enfermedad renal crónica
estadio 3b de KDOQI e hiperlipidemia. Inicia con lesiones
dérmicas en región frontal, piel
cabelluda y antebrazo, caracterizadas por placas necróticas
de 1 a 7 cm de diámetro, con
base eritematosa, de bordes
mal definidos, de coloración
violácea, induradas, rugosas,
rodeadas de telangiectasias, de
crecimiento progresivo y dolorosas; agregándose síntomas
B, diaforesis de predominio
nocturno de hasta 3 veces por
semana y fiebre vespertina diaria y pérdida de peso, se realiza
biopsia, resultado neoplasia
linfoide maligna de alto grado
que infiltra extensamente piel
y tejido subcutáneo subyacente, inmunohistoquímica con
CD20 positivo, CD3 negativo ,
CD 30 negativo, Pax5 positivo,
CD79a positivo, Ki67 40%.
Se estadifica de acuerdo a
TNM T3bN2M0, presentando
pronóstico desfavorable. Comentarios: presentó ulceración
de las lesiones y síntomas, las
lesiones cutáneas suelen ser
asintomáticas y en general los
síntomas son raros. La diseminación a otros órganos es rara,
sin importar el patrón de crecimiento, esta neoplasia tiene
un excelente pronostico, con
supervivencia a cinco años de
95%, solo se requiere de terapia
sistémica en los pacientes con
enfermedad cutánea extensa.
Sin embargo la paciente presentó un curso clínico atípico
rápidamente progresivo con
lesiones diseminadas. Conclusiones: se concluyó como
linfoma primario cutáneo difuso de células B grandes. Se
comportó de manera atípica,
presentándose a edad mayor
a la esperada, en una mujer,
múltiples lesiones, rápidamente
progresivo, con alta agresividad
siendo un curso raro para esta
enfermedad.
Leucemia linfoblástica aguda
manifestada con síndrome de
Trousseau
Estefanie Villanueva Rodríguez,
Martha Elizabeth Segovia
Guardado, Merit del Carmen
Hernández Sánchez, Mario
Antonio Cerecedo Rosendo,
Viridiana Montserrat Mar Torres
Servicio de Medicina Interna
y Hematología, Hospital Regional de Ciudad Madero de
Petróleos Mexicanos, Ciudad
Madero, Tamaulipas
Introducción: el síndrome de
Trousseau, descrito por primera vez en 1865, es una serie
de eventos tromboembólicos
como trombosis vascular migratoria, microangiopatía, diátesis
hemorrágica aguda, coagulación intravascular diseminada,
endocarditis no bacteriana
trombótica, trombosis venosa
profunda, trombosis pulmonar/
mesentérica y evento cere-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
brovascular en pacientes con
cáncer. Prevalencia de 1-11%,
relacionada principalmente
con cáncer de pulmón, páncreas y ovario. Descripción
de caso: varón de 37 años,
hermana fallecida por metástasis pulmonar y cerebral,
se desconoce primario, tabaquismo +. Inicia con dolor en
talón derecho y limitación de
marcha, siendo diagnosticado
de fascitis plantar, tratamiento
con esteroide local y AINEs
sin respuesta. Posteriormente
el dolor se irradia a región
posterior de pierna, aumento
de volumen y temperatura
local, área equimótica en cara
medial de rodilla, red venosa
colateral, Homans y Olow
positivo, pulsos conservados.
LEU 8.5, NEU 4.4, LINF 3.9,
Hgb 11.9, Hto 35.2% y PLT
88000; ultrasonido doppler
de MPD con trombosis venosa
profunda en vena poplítea derecha y tronco tibio-peroneo.
Se descarta anticoagulación
por plaquetopenia. Dos meses después presenta astenia,
adinamia, bacteremia, fiebre y
adenomegalias paratraqueales,
cervicales, pre y postauriculares, axilar bilateral e inguinales,
blandos, móviles, de 1-2 cm.
Control bioquímico LEU 8.2,
NEU 1.5, LINF 6.1, PLT 65000,
DHL 1018, perfil viral negativo,
hemocultivos y urocultivo negativo, TAC de cuello, abdomen
y pelvis sin alteraciones. Frotis
en sangre periférica con blastos, siendo diagnosticado con
Leucemia linfoblástica aguda
inmunofenotipo PRE B, CD 19,
10 y 34+, TDT+. Recibió tratamiento quimioterapéutico y
anticoagulante, a pesar de ello
múltiples recaídas y trombosis
venosa profunda humeral,
falleciendo un año después.
Comentario: los eventos tromboembólicos inexplicables son
una clave para el diagnóstico
de neoplasia oculta como en
el presente caso tomando en
cuenta que es un paciente
joven, sin factores de riesgo
conocidos para embolismos
venosos y baja probabilidad de
origen oncológico. Conclusión:
la prevalencia de síndrome de
Trousseau como manifestación
de malignidad solo se ha descrito 9% en leucemia aguda,
ahí radica la importancia de
estudiar su origen ya que aún
no está claro si la estrategia
de cribado extensa pudiera
traducirse en un aumento en la
detección de cáncer en etapa
temprana y una disminución en
la morbimortalidad relacionada
con el cáncer.
Tumor retroperitoneal, presentación atípica de linfoma
no Hodgkin
Jair Herrera Méndez, Alba Dinorah Pacheco Vázquez, Víctor
Hugo Rosales Salyano
Hospital General de México,
Departamento de Medicina
Interna
Introducción: los tumores retroperitoneales primitivos (TRP)
constituyen una entidad infrecuente dentro de la patología
tumoral (0.07-0.2% de todas las
neoplasias del organismo). Son
de diagnóstico tardío y mayormente malignos, siendo el más
frecuente linfoma. Descripción
del caso: se presenta el caso de
paciente masculino de 56 años
de edad con antecedente de
tabaquismo. Refirió presentar
6 meses previos a su ingreso
dolor, punzante y continuo en
región lumbar con irradiación
a miembro pélvico derecho, a
lo que se agregó edema ascendente hasta llegar a genitales y
pared abdominal y postración.
Además se acompañó de fiebre
nocturna, acompañada de lesiones purpúricas diseminadas
y pérdida de 6 kg de peso en 2
meses. El examen físico reveló
petequias en tronco, abdomen
y extremidades, circulación
venosa colateral porto-cava superior, edema escrotal y de toda
la extremidad inferior derecha.
No se identificaron adenopatías. Bioquímicamente curso
con anemia normocítica normocrómica, lesión renal aguda
e hipercalcemia. La resonancia
magnética revelo probable sarcoma dependiente del psoas
con compromiso de uretero derecho y estructuras vasculares.
El resultado histopatológico fue
linfoma B de células grandes.
Por la extensión tumoral no
fue candidato a radioterapia.
Conclusiones: los pacientes con
linfoma B de células grandes
varían en cuanto a presentación
clínica, pronóstico y respuesta
al tratamiento. Se trata de un
linfoma agresivo, que al no dar
S103
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
tratamiento la sobrevida va de
semanas a meses, por lo que la
sospecha diagnóstica es crucial,
sin embargo, en casos atípicos
como éste, dicho diagnóstico
puede ser difícil y por tanto,
retrasar el inicio de tratamiento.
Linfohemangiomatosis
asociada con coagulación intravascular diseminada
Citlali Fernández Vivar, Ana
Lilia Peralta Amaro, Olga Lidia
Vera Lastra, Fabiola González
Márquez
Departamento de Medicina
Interna, UMAE Hospital de
Especialidades Dr. Antonio
Fraga Mouret, CMN La Raza,
México, DF
Introducción: enfermedad inusual aparece en los 2 primeros
meses de vida, predominio femenino. La presentación en aparato
digestivo es 52%. Desarrollo:
mujer de 35 años, linfohemangiomatosis diagnosticada al año
de edad. Quirúrgicos: 9 resecciones de hemangiomas externos,
cesárea 2003 y esplenectomía
en 2009. Síndrome anémico
diagnostico en 2009 secundario
a perdidas digestivas crónicas.
AGO menarca 12 años, ritmo
irregular, FUM 2011 (embarazo
actual 6 SDG) IVSA 21 años
PS 2 G2 C1 P0 A0. PA Inicia el
29/04/2014 con sangrado transvaginal de moderada cantidad
sin datos de urgencia obstétrica,
acude a medico particular que
realiza USG endovaginal concluyendo embarazo y a HGR donde
se realiza prueba inmunológica
S104
de embarazo siendo positiva y
US abdominopélvico con reporte
de probable hemangiomatosis,
se le comenta necesidad de
interrupción del embarazo por
riesgo de hemorragia, sin aceptar y se realiza transfusión de
concentrados eritrocitarios por
evacuaciones melenicas escasas
desde un mes previo, a su ingreso
a piso de MI con fatiga, cefalea
holocranenana y tenesmo rectal.
EF abdomen doloroso a la palpación media y profunda en marco
cólico, genitales con hemangiomas en labios mayores, tacto
cervical cérvix anterior, reblandecido, orificio cervical interno
cerrado, sangrado transvaginal
escaso no fétido, múltiples tumores en paredes vaginales.
Extremidades con hemangioma
en cara lateral de rodilla derecha
y maléolo derecho. Glucosa 90,
Cr 0.8, Hb 7.1, HCT 25.2% VCM
68.9 CMHC 28 plaquetas 242mil
leu 4.8 neut 2.4, linf 1.6, TP
11.8, TPT 30.2, INR 1.02, USG
doppler. Lesión ocupativa de
localización paraórtica izquierda
con extensión a hueco pélvico
(hemangioma). USG abdominopèlvico utero gestacional con
presencia de embrión con latido
cardiaco. Colonoscopia lesiones
saculares en recto-sigmoides que
ocluyen el 90-95% de la luz,
llegan hasta 60cm del margen
anal. Comentario: son tumores
de alta mortalidad entre 5090%. Sin tratamiento, la tasa de
mortalidad es de 77%. Paciente
con mal pronóstico ya que por
los factores de crecimiento,
aumento de la vascularidad y
volumen sanguíneo en el embarazo existe mayor proliferación y
crecimiento de las tumoraciones.
Conclusión: en la paciente debido al mal pronóstico se sesionó
por Ginecoobstetricia y comité
de ética el tratamiento definitivo
concluyendo en aborto farmacológico, la importancia del caso
clínico es por ser poco frecuente
y el dilema ético, la paciente
presentó durante su evolución
CID y finalmente fallece.
Tamponade y síndrome de vena
cava secundario a tumor germinal primario de mediastino.
Reporte de caso
Mireya Citalli Pérez Guzmán,
José Elihú Cuevas Castillejos,
Guillermo Martos, Raquel Gerson
Centro de Oncología, Centro
Médico ABC, México, DF
Introducción: los tumores
germinales primarios de mediastino tipo seminoma puro
son entidades raras que representan el 2%, son tumores de
crecimiento lento que usualmente son asintomáticos al
diagnostico, reportamos el
caso de un paciente que debuto como síndrome de vena
cava reportado en la literatura
hasta el 12% y sin reportes
de caso en la literatura como
tamponade. Reporte de caso:
masculino de 17 años de edad
quien inició su padecimiento 7
meses previos a su ingreso con
constipación nasal y disnea de
medianos esfuerzos, se agrego
dificultad respiratoria la cual
fue incrementando, hasta ser
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de pequeños esfuerzos el día de
su ingreso. Ingresó a urgencias
por incremento de dificultad
respiratoria, con tomografía
externa que documentó imagen hiperdensa homogénea
en mediastino anterior y datos
de compresión de vena cava
superior. A la exploración con
edema, rubicundez de cabeza
y cuello, red venosa colateral.
Se ingresó a medicina interna,
donde se toma ecocardiograma evidenciando tamponade
grave, se realizó drenaje pericárdico, extrayendo 350 ml de
líquido hemático, con toma
de biopsia de tumoración mediastinal. En piso presenta
dificultad respiratoria, desaturacion, broncoespasmo, motivo
por el cual se fue trasladado
a terapia intensiva, donde
se realizó fibrobroncoscopía
que evidenció compresión
extrínsica tumoral de ambos
bronquios, biopsia tumor mediastinal y ventana pericárdica.
Se mantuvo con ventilación
mecánica invasiva así como
apoyo de aminas por 5 días.
Reporte preliminar de Histopatología tumor germinal se
solicitan marcadores tumorales
que muestran elevación de gonadotropina coriónica humana
(2338 mg/dL), alfafetoproteina
normal, se incia quimioterapia
con BEP (bleomicina, etopósido y cisplatino) y medidas
antilisis tumoral. Con posterior
disminución de GCh a 730 mg/
dL, requirió apoyo con estimulador de colonias y aislamiento
en piso por 5 días. Se egreso
sin complicaciones. Reingreso
para segundo ciclo de BEP
donde se realizó PET con masa
mediastinal de 119 x 65 x
118mm SUV max 2.8, metástasis subpleurales suv max 6.2.
Actualmente en 3 ciclo BEP,
HCG 0 mg/dl y disminución de
masa tumoral. Conclusiones:
se reporta el caso de un tumor
mediastinal poco frecuente,
con debut aun mas inusual, el
cual a pesar de tratarse de un
tumor con mal pronostico por
ser radiorresistente a diferencia
de los seminimas testiculares,
ha mostrado una adecuada
evolución con manejo con
quimioterapia BEP.
Carcinoma neuroendocrino del
timo manifestado como síndrome de Cushing: reporte de caso
Guadalupe Robledo Barriga,
Bruno Ali López Luis, Salomon
Barrios López
Centro Médico Nacional Adolfo
Ruiz Cortines, IMSS, Veracruz,
Veracruz
Ha habido un aproximado
de 47 casos de carcinoma
neuroendocrino productor de
ACTH en la literatura. Se reporta un caso de síndrome de
Cushing que llevo al diagnóstico de un tumor neuroendocrino
del timo productor de ACTH.
Masculino de 37 años enviado
a esta unidad con antecedentes
de diabetes mellitus tipo 2 de
8 meses de diagnóstico hipertensión arterial de 8 meses de
diagnostico, hipertiroidismo de
1 año de diagnostico tratado
con tiamazol 5 mg al día. Inicia
su padecimiento hace 8 meses
con hiperglicemia e hipertensión asociado a edema pedio,
obesidad centrípeta así como
abundante panículo en región
cervical y submandibular a su
ingreso el cortisol matutino de
58,4 mcg/dL (5-25), posterior a
prueba de supresión con altas
dosis dexametasona de 32.6,
acth 48.3 pg/mL (6.0-46), sodio
145, potasio 1.9, cloro 91, t3l
1.6 pg/mL, t4l 0.8 ng/dL, TSH
0.6 UI/mL, ácido 5 hidroxi indol acético 12.2 mg/24 horas
(adultos 0-14), cromogranina a
18 ng/mL (1.9-15), prolactina
45 ng/mL, hg <01 ng/mL (0.484.78) somatomedina c (igf-1)
185.2 ng/mL. Resonancia magnética craneal: normal, Tac
toracoabdominal: mediastino
con congomerado ganglionar
prevascular de bordes bien
definidos heterogéneo con
diámetros de 44x34x38 que
genera. efecto de volumen
asi como múltiples adenomegalias. resto de la tomografía
normal. Rastreo con octreotide
111-in-octreotide: positivo
para la búsqueda de actividad
secundaria a actividad parahiliar derecha Se realiza por
cirugía de tórax resección de
la tumoración mediastinal
sin complicaciones obteniendo una masa de 8x4x7 la
cual se envía para estudio
histopatológico reportando:
carcinoide timico, sinaptofisina negativa, cromogranina
A positiva 3+ en 100%, cd 56
positiva 3+ en 100%, ki67 3+
S105
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
en 0.002%, acth positiva 3+ en
20%. Conclusiones: los tumores neuroendocrinos del timo
son tumores raros actualmente
hay unos 400 tumores reportados en la literatura mundial
tumores son agresivos con
pobre pronóstico a largo plazo
sin embargo la sobrevida de
nuestro paciente ya rebaso las
expectativas actualmente en
tratamiento con octreotide.
Es de destacar que aproximadamente 1/3 de los pacientes
carcinoma neuroendocrino de
timo se presentan con endocrinopatías y 28% son secretores
de ACTH . al sospechar una
fuente ectópica de ACTH la
tomografía de tórax está indicada en pacientes en la cuarta
década de la vida.
Dolor abdominal crónico y
recurrente: manifestación temprana de adenocarcinoma
duodenal primario metastásico. Presentación de un caso
Carlos Alberto Rodríguez Martínez, Guillermo Flores, Martín
Armando Ríos Ayala, Paolo
Alberti Minuti, José Fabián Martínez Herrera, Francisco Javier
Ramos Aguilar, Daniela Salinas
Morales
UMAE Centro Médico Nacional
Siglo XXI, IMSS, México, DF
Introducción: el intestino delgado es un sitio poco frecuente
de presentación de neoplasias
primarias. El duodeno ocupa
el primer lugar en frecuencia.
Entre los tumores malignos
del duodeno, el adenocar-
S106
cinoma duodenal primario
(ADP) es el más frecuente,
característicamente tiene una
presentación insidiosa con
síntomas inespecíficos. En
nuestro país existen pocos
reportes sobre la patología
duodenal, y específicamente
sobre la neoplasia maligna
duodenal, por lo anterior
reportamos un caso de adenocarcinoma duodenal primario.
Caso clínico: femenino de 65
años aparentemente sana y
sin antecedentes de importancia. Acude por síntomas
abdominales de tres años de
inicio caracterizados por dolor
abdominal difuso, y generalizado asociado a distención
abdominal, con remisiones y
recurrencias frecuentes. Hace
2 meses se agrego náuseas
y vómito posprandial tardío
que evoluciono a inmediato
y en las ultimas dos semanas
intolerancia a la vía oral. Fue
hospitalizada en dos ocasiones
por deshidratación severa. Radiografía abdominal muestra
distención de asas y ausencia
de gas distal. Colon por enema
normal. Serie esofagogástrica
estenosis intraluminal en la
tercera porción duodenal.
Endoscopia alta normal. Se
realiza enteroscopia con toma
de biopsia reportando infiltrado inflamatorio crónicos.
La tomografía abdominal evidenció un tumor en la tercera
porción de duodeno con estenosis del mismo, involucrando
además cabeza, cuello y cuerpo del páncreas y estructuras
vasculares y retracción de
omento, se somete a cirugía
con plan de derivación gastroyeyunal y toma de biopsia
para documentar histología
y planear manejo sistémico,
durante el transoperatorio
se reporta carcinomatosis
peritoneal, con índice de sugarbaker de 26, por actividad
de menos de 1 cm pero mayor
a 0.5 cm, que condicionaba
poca movilidad de raíz del
mesenterio y del intestino
delgado, así como actividad
en paredes gástricas de mismas características, el reporte
histopatológico definitivo documento adenocarcinoma
primario de duodeno. Discusión: el adenocarcinoma
primario del duodeno es un
tumor maligno poco frecuente, de presentación insidiosa y
que con frecuencia representa
un reto diagnostico para el
clínico. Alrededor del 1-15%
de los tumores de duodeno
se encuentran en la primera
porción, 50-75% en la segunda porción, 14-33% en la
tercera parte, y 5-17% en la
cuarta porción del duodeno.
Hay un retraso medio de 2-15
meses desde el inicio de los
síntomas hasta el momento del
diagnóstico.
Linfoma de Hodgkin esternal
concurrente con absceso fúngico: reporte de caso
David Martínez Oliva,1 Jorge García Méndez,2 Martín Granados
García,3 Lorena Barrón Hernández,4 Eduardo Cervera Ceballos5
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Departamento de Medicina
Interna Fundación Clínica Médica Sur
2
Departamento de Posgrado y
Educación Médica Continua,
Instituto Nacional de Cancerología (INCan)
3
Departamento de Cabeza y
Cuello, INCan
4
Departamento de Dermatología
1
Introducción: el linfoma primario óseo representa 3-5% de
tumores óseos. Incluye linfoma
Hodgkin (LH) y no Hodgkin
(LNH). El involucro óseo de LH
es +/-20%; la vía de infiltración
es hematógena. La columna
toracolumbar es la más involucrada. La afección esternal
es extensión de mediastino; la
var. esclerosis nodular es la más
frecuente y un reto al semejar
osteomielitis o tuberculosis
ósea. Caso clínico: mujer 26
años, O/R Chihuahua. 8 meses
antes inició con tumor esternal,
duro sin dolor, fiebre, malestar
general o pérdida ponderal.
USG imagen compatible c/
fibroadenolipoma. Un mes
después un gamagrama óseo
reportó osteoma osteoide. Al
siguiente mes en biopsia reporta absceso agudo-crónico con
afección fibroadiposa y muscular; los estudios genómicos
(+) para M. tuberculosis, Coccidiodes sp y Nocardia sp. Inicia
tratamiento con posaconazol
posteriormente voriconazol
sin mejoría. ELISA (-) para
VIH. 4to mes en TAC tórax
conglomerado ganglionar hi-
percaptante con adenopatías
paraaórticas. 7mo mes TAC
con mayor tumor mediastinal
y pared torácica. En Centro
de Referencia se realizó esternectomía y resección tumoral.
El reporte histopatológico fue
LH var. esclerosis nodular
con formación de absceso
de tejidos blandos y hueso.
Se inició QT BEACOPP con
adecuada respuesta. Se agregó
brentuximab-ntiCD30- hasta
agosto/2014. Sin recurrencia
de LH o infección. Discusión:
la incidencia de LH es de 2.7
casos por 100,000 hab/año,
más frecuente en hombres
jóvenes y > 60 años. Localización más común es ganglionar
cervical-supraclavicular, +
de 50% de pacientes tienen
masa mediastinal, tos, disnea y
SVCS; 25% síntomas generales
y sólo 10% síntomas B. 5-8%
c/afección médula ósea. La
localización primaria ósea es
predominantemente columna
torácica lumbar; el involucro
esternal es raro. En casos de
la literatura médica la presentación usual es una masa que
invade tejidos blandos y hueso.
Es más frecuente la var. esclerosis nodular. Diagnósticos
diferenciales son osteomielitis
aguda o tuberculosa, granuloma eosinofílico, otros tumores
óseos, sarcoma. Los datos más
comunes son tumor, dolor y
fractura patológica. Es imperativa la histopatología. El %
de respuesta al tratamiento es
alto. Conclusión: Se presenta
caso de mujer joven con LH
esternal-absceso torácico y
cuestionable reporte molecular
(+) a 3 patógenos diferentes
con diagnóstico definitivo LH
var. esclerosis nodular-absceso.
Este caso insidioso sin manifestación sistémica enfatiza
que el linfoma puede semejar
infección crónica.
Pancreatitis aguda secundaria
a lupus eritematoso sistémico,
reporte de un caso
Fabián Oscar Cortés Cortés,
Héctor Infante Sierra, Cintya
Barajas Toledo, Guadalupe
Ferrer Burgos, Neftalí Miguel
Martínez, Celia Peña Alcántara
Servicio de Medicina Interna,
Hospital de Especialidades de la
Ciudad de México Dr. Belisario
Domínguez, México, DF
El lupus eritematoso sistémico
(LES) es una enfermedad autoinmune inflamatoria capaz
de afectar cualquier aparato
y sistema, 50% cursan con
manifestaciones a nivel de
sistema digestivo, reportándose pancreatitis en el 0.4 a 1.1
por cada mil pacientes con
LES y cursando como manifestación inicial en el 22%.
Femenino de 21 años de edad,
quien refiere fotosensibilidad
desde la infancia en manejo
intermitente por dermatología,
niega antecedentes quirúrgicos,
consumo de medicamentos y
toxicomanías. Inicia su padecimiento tres meses previos a su
ingreso con fiebre de 39ºC de
predominio nocturno, artritis
en articulaciones periféricas,
S107
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
presencia de lesiones en cavidad oral, diagnosticándose
infección viral por facultativo
sin presentar mejoría, se agrega
dolor abdominal en epigastrio,
transflictivo, intensidad 9/10,
náusea y vómito. Ingresa con
mal estado general, paraclínicos reportando bicitopenia:
linfopenia y trombocitopenia,
lesión renal con proteinuria,
alteración de pruebas de función hepática, elevación de
amilasa y lipasa tres veces el
límite superior, corregida la
falla renal se realiza tomografía
de abdomen reportando pancreatitis edematosa Balthazar
B. Posteriormente presenta
crisis convulsivas tónico clónico generalizadas, se realiza
punción lumbar y Tomografía
de cráneo sin alteraciones, se
agrega visión borrosa bilateral
de manera súbita por lo que es
valorada por oftalmología con
diagnóstico de neurorretinopatía. En base al antecedente
de alteraciones hematológicas,
fotosensibilidad, exantema
malar y úlceras orales a la exploración física se solicita Ac
anti-DNA doble cadena 20 UI/
mL (positivo >15 UI/mL), Ac
anti-nucleares positivo moteado
fino 1:320 (negativo <1:40), C3
y C4 bajos estableciéndose el
diagnóstico de lupus eritematoso sistémico con compromiso
gastrointestinal, neurológico,
renal, mucocutáneo, oftalmológico y hematológico por lo que
es trasladada a Unidad Hospitalaria a servicio de Reumatología
para su manejo. La mayoría de
S108
las complicaciones gastrointestinales relacionadas con
LES son causadas por vasculitis
y deposición de complejos
inmunes respondiendo bien a
los corticosteroides y agentes
inmunosupresores, hasta un
57% de los casos puede desarrollar complicaciones, con una
tasa de mortalidad del 45%. El
diagnostico precoz y tratamiento oportuno son esenciales para
mejorar el pronóstico. Discernir
la etiología de la pancreatitis
sigue representando un reto
diagnóstico al internista.
Amiloidosis sistémica por
depósito de cadenas ligeras
Kappa, un reto diagnóstico
MG López Cruz, G Gómez
Ochoa, G Ordoñez Vázquez,
E Hernández Ruiz, G Pérez
Bustamante
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad de Oaxaca, Oaxaca
de Juárez, Oaxaca
La amiloidosis es una rara y
compleja enfermedad, la incidencia estimada es de 9 casos
por millón de personas por año.
Resulta del mal plegamiento de
proteínas con potencial amiloidogénico. Hay depósito en la
gran mayoría de los tejidos del
organismo generando disfunción. Existe una amplia cantidad
de manifestaciones y hallazgos
clínicos, lo que resulta en un
reto diagnóstico. Femenino de
60 años de edad, hipertensa de
más de 20 años de evolución,
un mes antes de su ingreso a
nuestro hospital, presentó mal
estado general, tos seca, disnea
de medianos a pequeños esfuerzos, hipotensión y taquicardia.
Acudió a valoración médica documentándose derrame pleural
bilateral y en los exámenes de
laboratorio solicitados reporto
péptido natriurético elevado (1
740 pg/mL), el ecocardiograma
transtorácico con fracción de
expulsión conservada (55%) y
datos de cardiopatía restrictiva,
el electrocardiograma mostró
pobre progresión del 1 vector
de V1-V4 y disminución del
voltaje de complejos QRS. Se
realizó cateterismo cardíaco
reportando arterias coronarias
normales, otros estudios solicitados documentaron proteinuria
de 24 h en rango subnefrótico
(2,900 mg) e hipotiroidismo
primario. Por los datos de cardiopatía restrictiva, proteinuria
e hipotiroidismo primario se
inició protocolo de estudio por
la sospecha de enfermedad
infiltrativa. Los hallazgos de
los estudios solicitados fueron:
cadenas ligeras en orina de tipo
Kappa, biopsia de hueso positiva
a cadenas Kappa por inmunohistoquímica, la biopsia de grasa
parda periumbilical y de mucosa
rectal negativas a tinción de rojo
Congo. Posteriormente se tomó
biopsias endomiocardicas, se
realizo tinción de rojo Congo,
polarización de rojo y tioflavina
T siendo positivas. Se concluyó
el diagnóstico de amiloidosis
sistémica de cadenas Kappa
de alto grado, con afección
cardiaca demostrada, probable
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
renal y tiroidea. Se inició tratamiento de sustitución hormonal
tiroidea y quimioterapia con
ciclofosfamida, dexametasona y
bortezomib. El pronóstico de la
amiloidosis sistémica es pobre,
aún con el tratamiento adecuado. Los pacientes tienen una
sobrevida media de uno a dos
años después del diagnóstico,
pero cuando tienen afectación
cardíaca la sobrevida disminuye
de forma considerable a 6 meses, después de haber iniciado el
primer cuadro de insuficiencia
cardíaca.
Enfermedad de Still. Reporte
de un caso
Tania Adriana Luna Zúñiga,
Mariana Paola González Mora,
Miguel Alejandro Flores Morales, Héctor Infante Sierra, Ana
María Calderón Escutia
Hospital de Especialidades de la
Ciudad de México Dr. Belisario
Domínguez
Introducción: la enfermedad de
Still del adulto es una enfermedad inflamatoria autoinmune
poco común, con presentación entre los 16 y 35 años.
Su incidencia se estima en 0.4
por cada 100,000 habitantes.
Su etiología es desconocida,
aunque se ha asociado a agentes infecciosos de tipo viral
y bacteriano, sugiriendo que
estos pueden actuar como desencadenantes en un huésped
genéticamente predispuesto.
Cursa con manifestaciones
sistémicas que incluyen: fiebre intermitente mayor de 39°
acompañada de rash evanescente asalmonado, artralgias
o artritis, linfadenopatía, hepatoesplenomegalia, serositis,
leucocitosis con neutrofilia,
elevación de reactantes de fase
aguda, ferritina sérica >3000
ng/mL y de enzimas hepáticas.
Su diagnóstico es de exclusión.
Descripción del caso: masculino de 26 años, con antecedente
de internamiento previo un año
atrás, secundario a fiebre de origen desconocido, tratado con
AINES, sin ulterior seguimiento.
Inicia cuatro días previos a su
ingreso con faringitis severa, fiebre y ataque al estado
general, automedicandose
trimetroprim-sulfametoxazol
sin adecuada evolución, por
lo que acude con facultativo
quien prescribe antibiótico y
dosis única de hidrocortisona
sin mejoría, motivo por el que
acude a esta unidad. A la exploración presenta poliartritis,
adenopatías cervicales, dermatosis diseminada a tronco y
parte proximal de extremidades
caracterizada por lesiones maculopapulares asalmonadas.
Leu17400 Neu15600 Hb14 g/
dL, Plq231000 AST56 ALT67
D H L 2 6 8 FA 3 4 4 G G T 4 2 3
PCR14.9mg/dL VSG37mm/h. FR
y ANA negativo, ferritina 6241
ng/mL. Fosfatasa alcalina leucocitaria: 79 UI/mL. Hemocultivo,
urocultivo y mielocultivo negativos. AMO: sin alteraciones.
Serología viral, Salmonella,
Shigella, sífilis y perfil TORCH
negativos. Epstein-Barr VCAIgG:
2.90, VCAIgM: 0.33. Radio-
grafía tórax, ecocardiograma
y ultrasonido abdominal sin
alteraciones. TC toracoabdominal: esplenomegalia 150 mm.
Comentario: masculino de la
tercera década de la vida cursando con cuadro compatible
con Enfermedad de Still, muy
probablemente iniciado desde
internamiento previo hace 1
año, pero que en esta ocasión
gracias a un intenso protocolo
de estudio fue posible llegar al
diagnóstico. Acorde a criterios
de Yamaguchi con 4 criterios
mayores y 4 criterios menores
(S: 96%; E: 92%). Conclusiones:
paciente que fue manejado
con AINES y prednisona 50 mg
cada 24 h con remisión clínica
y bioquímica a la segunda semana de egreso. Actualmente
en seguimiento.
Síndrome de Goodpasture.
Reporte de un caso
Joaquín Moreno Moreno, Marisol Hernández López, Yolanda
Gálvez Molina
Servicio de Medicina Interna,
Hospital General de Cuernavaca Dr. José G Parres,
Cuernavaca, Morelos
Introducción: en 1958, Stanton
y Tange, describieron 9 pacientes con hemorragia pulmonar
y glomerulonefritis a la que
llamaron síndrome de Goodpasture tras un reporte hecho
por Ernest Goodpasture. Descripción del caso: femenina
de 30 años de edad, sin antecedentes de importancia. Inicia
padecimiento una semana
S109
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
previa a su ingreso con cefalea,
malestar general, odinofagia,
rinorrea, tos seca en accesos y
disnea. Se agregan hemoptisis,
hipotensión y dificultad respiratoria siendo referida a este
hospital. Ingresa somnolienta,
pálida, taquicárdica, con tiraje
intercostal, disminución del
murmullo vesicular bilateral y
hemoptisis, paraclínicos con
reporte de hemoglobina 6.6 g,
azoados normales, INR 1.18 y
alcalosis respiratoria. Se inicia
tratamiento con cristaloides,
oxígeno, hemotransfusión,
oseltamivir y ceftriaxona. Pese
a ello continúa con disnea,
taquipnea de 50, saturación
de 64% por lo que se inicia
ventilación mecánica, evidenciando hemorragia transcánula
de 250cc e hipoxemia severa
en la gasometría. Tras 24 horas, la paciente continúa con
compromiso respiratorio pese
a AMV y hemodinámico requiriendo aminas y persistiendo
con hemorragia transcánula,
500 cc en 24 horas, se aumentan parámetros ventilatorios
sin lograr saturación >60%
con pO2 43, radiográficamente
con patrón algodonoso bilateral, hemoglobina control
de 6.8 y aumento progresivo
de azoados. Cursadas 48 horas, la paciente presenta paro
cardiorespiratorio no revirtiendo a maniobras de RCP.
Hallazgos histopatológicos:
hemorragia pulmonar masiva
y necrosis fibrinoide en riñones
e inmunohistoquímica con anticuerpos antimembrana basal
S110
glomerular. Conclusión: estudios genéticos relacionan esta
entidad con HLA-DRB1-1501
y 1502. La incidencia mundial
es de 0.5-1 caso por millón
de habitantes al año con pico
de incidencia en la tercera y
séptima décadas de la vida. La
presentación típica inicia con
malestar general, fatiga y pérdida de peso y posteriormente
con síndrome reno-pulmonar
caracterizado por insuficiencia
renal rápidamente progresiva
y hemorragia pulmonar. El
tratamiento consiste en dosis
elevadas de esteroides, ciclofosfamida y plasmaféresis. Se
reporta el presente caso por la
baja incidencia mundial.
Enfermedad de Marburg: variante de esclerosis múltiple
JO Duarte Flores, IL Candelaria
Zavala, A Cabrera Rayo, CE
García Gutiérrez, EE Castellanos
Pedroza
Servicio de Medicina Interna,
Hospital General de Zona núm.
48, IMSS, México, DF
Centro Médico Nacional La
Raza, IMSS, México, DF
Introducción: las enfermedades
desmielinizante del SNC tienen
un amplio espectro de presentación, entre ellas se encuentra
la variante de Marburg de esclerosis múltiple, presentamos el
caso de una paciente. Objetivo:
identificar la enfermedad de
Marburg como variante de esclerosis múltiple. Descripción:
femenino de 33 años de edad,
sin comorbilidades. Anteceden-
te de cefalea de baja intensidad,
sin exacerbantes que remite con
analgésicos. Inicia cuadro con
cefalea de moderada a severa
intensidad con foto y sonofobia
sin nauseas ni vómito, valorada
en urgencias, recibe manejo
con paracetamol y se egresa
por mejoría. 24 horas más tarde
persiste con cefalea progresiva,
deterioro del estado de alerta,
habla incoherente y desorientación, nueva valoración donde
requiere AMV por deterioro
neurológico. Punción Lumbar
con hiperproteinorragia y RM
sospecha de encefalomielitis
diseminada aguda. A su ingreso
con AMV, pupilas isocóricas
normoreactivas, oculocefalicos
con limitación supraversión
y mirada horizontal derecha,
mirada primaria a la izquierda,
motor hipotonía, fuerza no
valorable, REMS 3/4 generalizado, Babinski izquierdo.
Recibe metilprednisolona con
mejoría radiológica y clínica,
semana posterior, postura tónica generalizada, movimientos
clónicos, desviación de la
mirada a la izquierda, mayor
deterioro de la fuerza derecha,
Babinski derecho, limitación
completa a los movimientos
de supra e infraversión, IRM
control con mayor número de
lesiones captantes de gadolinio
con confluencia, involucra sustancia blanca periventricular,
continua con metilprednisolona
con mejoría en movimientos
oculomotores. Remite postura
tónica posterior a impregnación
con DFH, posteriormente con
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
ausencia de respuesta motora al
nociceptivo, mirada indiferente,
pobre evocación de oculocefalicos y asimetría facial. IRM
control con mayor extensión de
lesión. Se inicia inmunoglobulina con mejoría clínica. Se retira
AMV en estatus de traqueostomía adecuada tolerancia, se
egresa. Fallece tras oclusión
de cánula de traqueostomía.
Estudio anatomopatologico
que reporta esclerosis múltiple
variedad Marburg. Comentarios: la enfermedad de Marburg
evoluciona hasta la muerte del
paciente y la identificación
del cuadro clínico es difícil.
Conclusión: la enfermedad de
Marburg es una variante aguda,
fulminante y poco frecuente
de la Esclerosis Múltiple que
evoluciona a un compromiso
del tronco encefálico.
Granulomatosis con poliangeítis parotídea bilateral como
manifestación inusual, revisión
de un caso
A Aguiñiga Rodríguez, R Dorantes Romandía, L Castro
Castrezana, T Velázquez Gaspar
Medicina Interna, Hospital General de Zona núm. 48, IMSS,
México, DF
Introducción: granulomatosis
con poliangeítis vasculitis de
origen autoinmune de vasos
pequeños; etiología desconocida, afecta principalmente
tracto respiratorio superior, inferior y riñones. Incidencia
anual: 5-10 casos por millón.
Edad promedio 68 años. Se
presenta con síntomas inespecíficos, inicia de forma
localizada, progresando a
una forma multisistémica con
mal pronóstico en los primeros dos años sin tratamiento.
Los hallazgos histológicos:
son inflamación necrotizante,
formación de granulomas, vasculitis de pequeños y medianos
vasos. El diagnóstico es clínicopatológico. La presencia de
anticuerpos frente al citoplasma de neutrófilos confirma el
diagnóstico. Descripción del
caso: femenino de 62 años,
inicia hace 6 meses con tumoración parotídea bilateral,
hipoacusia bilateral, pérdida
de peso de 10 kg en 6 meses.
Acude por debilidad de extremidades inferiores simétrica
y distal. En el internamiento
presentó uveítis anterior y coroiditis posterior. EF: Palidez
de tegumentos, Nariz en silla
de montar, crecimiento de
parótidas de forma bilateral,
de bordes regulares, sin adenomegalias, cardiorrespiratorio
sin compromiso, abdomen sin
alteraciones, fuerza muscular
de extremidades inferiores
4/5. EGO proteínas 10 mg/
dL, eritrocitos >100x campo.
Glucosa 143, urea 47, BUN
22, Cr 1.5, leucocitos 21.8,
Hb 6.3, hto 20.7, VCM 76,
plaquetas 830mil, PCR 44.33,
VSG 41 mm 3, ANCAc 1:40.
Radiografía de tórax: imagen
radiopaca basal derecha. TAC
de tórax lesiones nodulares en
ambos pulmones con centro
hipodenso por necrosis, al-
gunas cavitadas. TAC cabeza
y cuello sinusitis maxilar y
esfenoidal, destrucción de tabique nasal, lesiones quísticas
en ambas parótidas. Biopsia
de mucosa nasal inflamación
granulomatosa. Se inició metilprednisolona y ciclofosfamida
disminuyendo el tamaño de las
parótidas, pero con progresión
de la falla renal sin respuesta
al tratamiento y muerte. Comentarios y Conclusiones: la
afección de granulomatosis y
poliangeítis de glándulas parótidas es una manifestación rara
presentando una incidencia
de menos del 1 al 4%. Dentro
de las glándulas salivales, la
parótida es la que principalmente se afecta siguiendo las
glándulas submandibulares y
sublinguales. Requerimos reconocer estas manifestaciones
inespecíficas, ya que de no
ser tratada de forma oportuna
la supervivencia a un año es
solo del 18%, siendo la causa
de muerte más frecuente la
falla renal.
Enfermedad de Still como
causa de fiebre origen desconocido: reporte de caso
Isaac Morones Esquivel, José
Oscar Terán González, Luis
Javier Castro D’Franchis, Dulce
Valeria Copca Nieto, Maricarmen Lagunas Alvarado, Rodolfo
Ramírez del Pilar, Adriana Paula
Matamoros Mejía, Dushan Meza
Oviedo, Triana Salgado Muñoz
Servicio de Medicina Interna,
Hospital Central Norte de Petróleos Mexicanos, México, DF
S111
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Introducción: la enfermedad de Still del adulto es
una enfermedad de etiología
desconocida y una de las
causas de fiebre de origen
desconocido. Su incidencia
es de 0.22-0.34 por 100.000
personas, no hay estudios de
laboratorio patognomónicos,
por lo que se requiere de una
alta sospecha diagnostica.
Los criterios de Yamaguchi
tienen una sensibilidad de
hasta 93.5% y especificidad
del 80% para establecer su
diagnóstico. Presentación de
caso: femenina de 57 años
con antecedente de diabetes
mellitus 2, tratada con insulina
detemir y metformina en adecuado control (HbA1c 5.7%).
Acude por fiebre vespertina
de 4 semanas de evolución,
no cuantificada, sin síntomas
agregados. 5 días después
se agregan lesiones máculo
papulares, eritematosas, no
pruriginosas, hipertérmicas, en
tronco, extremidades superiores e inferiores; faringodinia,
sin respuesta a fexofenadina. A
su ingreso: fiebre 39ºC, artralgias, y lesiones dermatologías.
Leucocitos 16,700, neutrófilos
13,700 (82.03%), linfocitos
1,900, eosinófilos 100, hemoglobina 15.5 g/dL, plaquetas
290; VSG 32 mm/h, examen
general de orina normal. Inicia
tratamiento con antihistamínico y analgésico disminuyendo
lesiones dérmicas, con mejoría del dolor, persiste con
fiebre. Biopsia de piel con
inflamación inespecífica. TGO
S112
y TGP normal, cultivos, hepatitis B, C, TORCH, VIH, VDRL,
ANA, c-ANCA, p-ANCA, anti
DNAds, aFL negativos. Factor
reumatoide 13 UI/mL, PCR
17.5 g/L, ferritina 4615 ng/mL.
Comentario y Conclusión:
los criterios de Yamaguchi
incluyen mayores (fiebre, leucocitosis con más de 80% de
neutrófilos, rash, artralgias) y
menores (odinofagia, linfadenopatía, elevación de enzimas
hepáticas, factor reumatoide/
ANA negativo); haciendo
diagnostico con 4 mayores o 3
mayores y 2 menores. Nuestro
paciente presenta 4 mayores y
2 menores. La ferritina sérica
se ha descrito como marcador
de diagnóstico, actividad y
monitorización de la efectividad del tratamiento. El
93.4% de los pacientes con la
enfermedad de Still presentan
elevación hasta por más de 5
veces el valor normal como
es este caso, acompañada
de manifestaciones clínicas
características. El tratamiento
se basa en AINES y esteroide,
el pronóstico es favorable para
la vida.
Vasculopatía inducida por cocaína adulterada: presentación
de caso
Edith Rubí Luis Ojeda, 1 Miguel
Ángel Solís Bravo, 1 Alfredo
Israel Servín Caamaño, 1 Elvira
Graciela Alexanderson Rosas,
1
Manuel Flores Ibarra,1 Ivonne
Arellano Mendoza, 2 Cecilia
Eugenia Pulido Collazos2
1
Servicio de Medicina Interna
Servicio de Dermatología
Hospital General de México Dr.
Eduardo Liceaga, México, DF
2
Introducción: la cocaína es
una droga ilícita con efecto
psicoestimulante, vasoconstrictor y procoagulante; cuya
afección en piel se caracteriza
por microangiopatía trombótica
y/o vasculitis. Es adulterada con
sustancias como levamisolm
que se asocia a vasculopatía
por cocaína, manifestada como
púrpura en pabellones auriculares y región cigomática, patrón
retiforme en tronco y extremidades, acompañada de pérdida
de peso, artralgias, artritis, adenopatías, neumonía, úlceras
orales e infecciones severas.
Descripción del caso: hombre
de 39 años con antecedente de
artralgias migratorias asimétricas de 7 meses de evolución,
pérdida de peso de 20 kg en 6
meses y consumo de cocaína
hasta 6 veces al mes durante
10 años. Inicia 7 días previos al
ingreso con placas purpúricas
y ampollas hemorrágicas en
brazos, piernas, región cigomática y pabellones auriculares
que se tornan necróticas con
formación de escara. Se toman
paraclínicos que reportan; fosfatasa alcalina 207 U/L, GGT
94 U/L, DHL 279 U/L, VSG 44
mm³/h, PCR 59.8 mg/L, fibrinógeno 425 mg/dL. p-ANCA 300
U/mL, c-ANCA 265.2 U/mL y
ANA1:40 y FR de 25.4 UI/mL,
filtrado glomerular 125 mL/min
y proteinuria de 250 mg/24 h.
Biopsia de piel con abundante
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
infiltrado linfohistiocitario y
depósitos de IgG, IgM e IgA
en unión dermoepidérmica. Se
diagnostica vasculitis leucocitoclástica asociada a consumo de
cocaína probablemente contaminada con levamisol iniciando
tratamiento con esteroides y
azatioprina mejorando cuadro
clínico. Se egresa a 16 días de
hospitalización. Comentarios:
la vasculopatía cutánea asociada a cocaína contaminada
con levamisol es emergente y
constituye un reto diagnóstico,
pudiendo confundirse con vasculitis primaria ANCA positivas,
la principal ayuda diagnóstica
es la respuesta clínica a la
suspensión del consumo de
cocaína y la regulación de pruebas serológicas en 2-14 meses.
El tratamiento es empírico y
se basa en cese del consumo
de cocaína, tratamiento local
y sistémico con esteroides,
metotrexato o ciclofosfamida,
injertos de piel y amputaciones.
Sin embargo, el riesgo/beneficio
de la inmunosupresión aún no
está establecido. Conclusiones:
es difícil distinguir la vasculopatía relacionada a cocaína
de la asociada a condiciones
reumatológicas, principalmente
aquellas secundarias vasculitis
sistémicas, siendo imperativo
descartarla para ofrecer mejoría
clínica.
Enfermedad por modelantes,
¿una enfermedad del siglo XXI?
Xochitl Jiménez Jiménez, Gabriela Liceaga Craviotto, Silvia
Méndez Flores
Hospital General Regional núm.
1 Carlos MacGregor Sánchez
Navarro, IMSS, México, DF
Introducción: la enfermedad
por modelantes se caracteriza
por síntomas inespecíficos
desde una afección local (paniculitis por modelantes) hasta
sistémicas, secundaria a la aplicación de una sustancia ajena
al organismo, que son utilizadas para modificar el volumen
y contorno de áreas corporales.
Las sustancias más utilizadas
son sustancias oleosas, parafina, petrolato, aceites, silicona
y colágeno. Descripción del
caso: mujer de 27 años de
edad, niega toxicomanías, alergias y transfusiones. COMBE
negado. Acude por dermatosis localizada en miembro
pélvico derecho en cara interna, caracterizada por la
presencia de placa de 15 cm
de diámetro, constituida por
una cicatriz atrófica, en el
centro una úlcera superficial
de fondo sucio. La piel que
rodea la zona de la cicatriz
hiperpigmentada de aspecto
esclerodermiforme. Refiere 4
años de evolución, cambiando en dicho periodo. Inició
como cuadro de celulitis que
evolucionó hacia una ulcera
de 10 cm de diámetro, recibió
múltiples antibióticos, parches
y sistema VAC sin respuesta
satisfactoria; posteriormente
se realizó un injerto autólogo
sin adecuada adherencia, nuevamente ulcerando en zona
central. En este internamiento,
por la evolución de la dermatosis se realizó biopsia para su
estudio histopatológico y cultivo, con objetivo de descartar
infecciones por micobacterias,
hongos o proceso neoplásico
subyacente. En la histología
se observaron granulomas a
cuerpo extraño y espacios
quísticos de tamaño variable.
Se reinterrogó a la paciente y
aceptó antecedente de inyección de material modelante de
origen no especificado hace
10 años. Comentarios: en el
caso no supimos la sustancia
infiltrada; siendo importante
ya que contribuyen al síndrome
clínico y severidad las caracteristicas propias del adyuvante.
La paciente había omitido las
aplicaciones en la adolescencia. Fue el estudio histológico
que demostró espacios quísticos y granulomas a cuerpo
extraño diagnosticándose así
complicación local tardía de
modelantes (lipo-granuloma
esclerosante). Conclusiones:
pese a la prohibiciones del uso
de sustancias modelantes, su
uso persiste, convirtiéndose en
un problema de salud pública.
Las sustancias modelantes no
son inertes y tienden a comportarse como antígenos. La
ignorancia en la farmacocinética de este tipo de sustancias
por personal que las aplica,
favorece que las complicaciones locales y sistémicas de la
enfermedad por adyuvantes
sigan presentes, generando
así graves secuelas e incluso
la muerte.
S113
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Síndrome de sobreposición
(rupus). Reporte de un caso
Shendel Vilchis González, 1
Rogelio Zapata Arenas,1 Carlos
Escalante Penagos2
1
Medicina Interna
2
Servicio de Reumatología
Hospital General de México,
México, DF
Introducción: se denomina
rupus al síndrome de sobreposición que se presenta en
pacientes que cumplen criterios de clasificación para
artritis reumatoide y lupus eritematoso sistémico. Es una
condición poco frecuente que
se caracteriza principalmente
por involucro articular. Se han
reportado poco mas de 100
casos a nivel mundial. Descripción del caso: hombre de 47
años de edad sin antecedentes
de importancia. Ingresó a hospitalización por cuadro de un
mes de evolución de poliartritis
simétrica aditiva que involucró
pequeñas y grandes articulaciones hasta llevarlo a clase
funcional IV. Para el abordaje
de su artropatía se solicitaron
laboratorios documentándose
proteína C reactiva en 233, factor reumatoide positivo en 241 y
anticuerpos anti-péptido cíclico
citrulinado positivos en más
de 900. Las radiografías de las
manos con osteopenia yuxtaarticular, disminución de espacios
articulares con anquilosis de carpo, erosión marginal en primera
metacarpofalángica izquierda y
quistes subcondrales. Además,
durante su hospitalización se
S114
documentó leucopenia de 3800,
linfopenia de 700 y proteinuria
en examen general de orina. Por
esto, se solicitó determinación
de proteínas en orina de 24
horas con 1.1 g, tasa de filtrado
glomerular en 100 mL/min,
hipocomplementemia de C4
y C3 así como seropositividad
para anticuerpos antinucleares
por inmunofluorescencia 1:640
homogéneo y anti-DNAdc 120
cumpliendo criterios ACR 2010
para artritis reumatoide y criterios SLICC 2012 de clasificación
para lupus eritematoso sistémico. En base a lo anterior se inició
tratamiento con azatioprina y
glucocorticoides y se programó
para biopsia renal. Conclusiones: el rupus es una entidad
muy poco frecuente, definido
como la superposición de lupus
eritematoso generalizado (LES)
y artritis reumatoide (AR). En la
mayoría de los casos descritos el
cuadro clínico inicia como una
poliartritis simétrica y erosiva
con factor reumatoide y/o anticuerpos antipéptido de citrulina
(anti-CCP) positivos a los que se
agrega manifestaciones clínicas
(mucocutáneas, hematológicas
y serositis) de LES y anticuerpos específicos (anti-ADNds
y/o anti-Sm). Es infrecuente el
compromiso renal o del sistema
nervioso central.
Polimiositis, caso clínico y revisión bibliográfica
Jessica Martín Tebar,1 Michel
Villatoro Villar,1 Enrique Figueroa Genis,2 David Hernández
Pérez,2 María Del
Residente de Medicina Interna
Especialista en Medicina
Interna
Sala de Medicina de Mujeres,
Hospital Central Militar, Secretaría de la Defensa Nacional
1
2
Introducción: paciente femenina de 26 años con dermatosis
localizada a rostro, un mes
de evolución manejada inicialmente como lesiones por
exposición a luz solar; sin
embargo inicia con debilidad
de las 4 extremidades, predominando en las inferiores,
comenzando con dolor muscular que progresó a debilidad y
finalmente imposibilidad para
la marcha, se evidenció elevación de enzimas musculares
así como enzimas hepáticas.
Presentación del caso: se
recibe paciente en urgencias
con dos meses de evolución
desde la primera manifestación clínica, agravándose 15
días antes de su ingreso. A la
exploración presenta hiperpigmentación cutánea en la
totalidad del rostro. Extremidades superiores e inferiores
con fuerza muscular proximal
2/5, distal 4/5. En virtud de la
alta sospecha de polimiositis y
el cuadro de hiperCKemia, se
inicia manejo con hidratación
parenteral y alcalinización
de la orina para evitar lesión
renal. La paciente es valorada
por reumatología y continúa
con esteroides intravenosos,
alquilante e inmunomodulador. Plan de aplicación de
ciclofosfamida+MESNA y
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
metilprednisolona en forma
mensual a completar ciclo de
6. Por parte de dermatología
sin ameritar biopsia de piel y
únicamente con tratamiento
con emolientes y filtro solar,
descartándose dermatomiositis
por no cumplir criterios, sin
presentar lesiones dermatológicas características. Para
confirmar diagnòstico se realiza electromiografía con datos
de polineuropatía motora y
sensorial de las cuatro extremidades y datos de degeneración
axonal moderada. Miopatía de
probable origen inflamatorio.
Y biopsia de mùsulo compatible con miopatía inflamatoria
tipo polimiositis. Se completó
tratamiento multidisciplinario
incluyendo a rehabilitación,
pudiéndose egresar a la paciente tras 13 días de estancia
hospitalaria con mejoría
clínica. Comentarios: la importancia de este caso clínico
consiste en que es importante
tener la mente abierta a todas
las posibilidades diagnosticas
cuando se presentan síntomas
que pueden parecer sutiles, de
tal forma que lo que hace a un
internista mejor no es pensar
en un solo diagnóstico sino en
toda la gama de diagnósticos
diferenciales. Conclusiones: la
miopatía inflamatorio idiopática es un diagnostico diferencial
que debemos de considerar en
pacientes con dolor o debilidad muscular así mismo, la
importancia de contar con una
base sólida en los conocimientos dermatológicos.
Anemia hemolítica con autoanticuerpos mixtos secundaria a
lupus eritematoso sistémico:
reporte de caso
Humberto Baldomero Castellanos Sinco, R Álvarez Cruz, JN
López Taboada, DM Dueñas
Tamayo, JR García Díaz, JO
Duarte Flores, Velázquez Gaspar, JA Cortés Sarabia, C Del
Moral Stevenel
Medicina Interna, Hospital General de Zona núm. 48, IMSS,
México, DF
Introducción: la anemia hemolítica autoinmune se clasifica
según las propiedades térmicas
de los anticuerpos, la de tipo
mixta presenta de 7 al 8 % de
los casos (anticuerpos IgG que
reacciona a 37ºC e IgM que
reacciona en frío). Gran parte
de los casos es de naturaleza
idiopática; el 20 al 40% es
secundario a lupus eritematoso sistémico y otro porcentaje
a linfomas de Hodgkin y no
Hodgkin. El 50% de las anemias hemolíticas autoinmunes
son secundarias. Descripción
del caso clínico: femenina de
55 años, sin antecedentes patológicos. Síndrome anémico
de 6 meses de evolución, rash
malar tras exposición solar,
ictericia, coluria. Exploración
física palidez e ictericia +,
rash malar, hepatomegalia 2
cm y esplenomegalia 10 cm.
Citometría hemática Hb 9.8
g/dL, Hto 5.2%, RBC 0.44 x
106/mL, VGM 117.1 fL, HCM
222.7 pg, ADE 15.3%, leucocitos 4.65 x 103/mL, neutrófilos
1.87 x 103/mL, plaquetas 187 x
103/mL. Reticulocitos: 10.9%.
VDRL positivo, BT 2.24 mg/
dL. DHL 234 U/L. Anticuerpos
antinucleares, anti DNA y Sm
positivos. C3 y C4 negativos.
IgG 1220 mg/dL (70-1800),
IgA 52 mg/dL (100-480), IgM
736 mg/dL (60-250). Antiglobulina poliespecífica positiva
1:4, antiglobulina monoespecífica positiva para IgG y C3d.
Anticuerpos antieritrocitos,
autoanticuerpos; positivos: anti
sistema Rh +, anti complemento, anti H y anti i activo a 4 y
22°C, título 1:256. Aloanticuerpos negativos. Se concluyó
lupus eritematoso sistémico,
se descartó sífilis. Se trató
con azatioprina, prednisona y
hematínicos. Actualmente sin
citopenias. Comentarios: la
anemia hemolítica se presenta
aproximadamente en el 9 al
22% de pacientes lúpicos.
Es fundamental establecer
diagnóstico diferencial de
anticuerpos fríos o calientes
para el tratamiento correcto,
en el tipo mixto se trata de
forma similar al de anticuerpos
calientes. Conclusión: se concluyó anemia hemolítica de
anticuerpos mixtos secundaria
a lupus eritematoso sistémico,
una entidad poco frecuente, sin
embargo con pronóstico bueno
debido a una respuesta muy
favorable a esteroides.
Mujer con enfermedad cavitaria pulmonar reporte de caso
Alejandra Ruiz Fuentes, Luis
Carlos Álvarez Torrecilla, Pa-
S115
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
mela Teresa Mendoza Barradas,
Ivette Denisse Bonilla Gudiño
Hospital Regional 1º de Octubre, ISSSTE, México, DF
Introducción: la asociación
de tuberculosis pulmonar con
granulomatosis de Wegener es
rara. Ambas características clínicas semejantes que incluyen la
enfermedad cavitaria pulmonar.
caso clínico de una paciente
con características clínicas,
hallazgos de laboratorio e imagen correspondientes a ambas
enfermedades, lo que representa
un reto de diagnóstico y tratamiento. Descripción del caso:
femenina de 56 años. Carga
genética para DM2. Hipertensión arterial sistémica de 2 años.
Diagnóstico de tuberculosis
pulmonar, seis meses de tratamiento Dotbal. Padecimiento
2 años con hipoacusia súbita
izquierda. Seis meses después
pérdida progresiva de la agudeza
visual y exoftalmos izquierdo,
hiperemia conjuntival bilateral y
oftalmodinia, artralgias, astenia,
adinamia; hallazgo radiográfico
de masa pulmonar, realización
de broncoscopia, se descarto
proceso neoplásico e infeccioso,
sin embargo, se dio tratamiento
por 6 meses para tuberculosis
pulmonar, biopsia pulmonarfibrosis. Se realiza lobectomía
izquierda. inicia nuevamente
eritema conjuntival izquierdo
progreso a ser bilateral y oftalmodinia, visión borrosa, ataque al
estado general, disnea y pérdida
de peso 10 kg. Se diagnosticó
vasculitis sistémica y queratitis
S116
ulcerativa periférica con FR y
C-ANCAS positivos y sedimento
urinario activo, se dieron 3grs de
metilprednisolona. Se concluye
Wegener con afección ocular, pulmonar, renal (síndrome
nefrítico) y ótica (hipoacusia persistente bilateral. Comentarios:
el diagnóstico diferencial de la
enfermedad cavitaria pulmonar
actividad de la enfermedad,
proceso infeccioso y, en última
instancia, cáncer. Los títulos altos
de anticuerpos y la presencia
de nódulos se relacionan con
actividad. En los países en vías
de desarrollo, la enfermedad
infecciosa pulmonar cavitaria
es la tuberculosis, que tiene
características clínicas y radiológicas semejantes a la GPA.
Hay informes que destacan la
presencia de cANCA en el 40%
de los pacientes con tuberculosis. Conclusiones: la GPA y la
tuberculosis pulmonar tienen
características clínicas semejantes. la afectación pulmonar con
cavidades, hemoptisis, fiebre y
pérdida de peso, y los pacientes
con tuberculosis en tratamiento
pueden presentar positividad
para anticuerpos. Pocos casos informados de asociación de GPA
y tb. Nuestro paciente reviste interés. Enfatizamos la obligación
de investigar siempre un proceso
sistémico en pacientes con enfermedades infecciosas a pesar de
que las características clínicas y
paraclínicas no lo sugieran.
Aterosclerosis acelerada como
dato pivote para el diagnóstico
de lupus eritematoso sistémico
María Fernanda Arroyo Ruiz,1
A Marmolejo Rodríguez, 1 F
Briceño Moya2
1
Residente de tercer año de
Medicina Interna
2
Médico adscrito al Departamento Clínico de Medicina
Interna
Hospital de Especialidades,
Centro Médico Nacional La
Raza, IMSS, México, DF
Introducción: se reporta caso
de paciente masculino con
lupus eritematoso sistémico
(LES), aterosclerosis acelerada
(ATA) como dato pivote para
el diagnóstico. Descripción
del caso: masculino de 49
años, índice tabáquico 1.2
cajetillas/año, IMC 25.82 kg/
m2. Cursa con hiperbaralgesia
de ambas manos, disminución
de la temperatura, llenado
capilar retardado y pulsos radiales y cubitales disminuidos
bilaterales, lesión isquémicanecrótica en segundo dedo
izquierdo; eritema facial, cuello
con piel de naranja, derrame
pleural izquierdo, signo de la
ola positivo; hipoalbuminemia,
linfopenia, hipocomplementemia, Anti DNA 890 UI/mL, PCR
3.8 mg/L. USG doppler con placas fibroadiposas y ateroma con
estenosis en arterias radiales,
cubitales y tibiales bilaterales.
Se concluyen los diagnósticos
de LES con afección mucocutánea, serosa y hematológica,
y ateromatosis con insuficiencia
arterial secundaria. Se manejó
con prednisona, cloroquina,
atorvastatina, cilostazol y ni-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
fedipino; presenta mejoría de
los síntomas, limitación de
necrosis, restablecimiento de
pulsos y laboratorios normales
a los 2 meses. Comentarios: estudios con cohortes extensas en
pacientes con LES a nivel mundial, han reportado prevalencia
combinada de angor pectoris,
infarto del miocardio (IAM) y
muerte súbita de 6.6-8.9%; así
mismo, mujeres jóvenes con
LES tienen 2.3 veces más riesgo
de ser hospitalizadas por IAM,
presentándose éste hasta 50
veces más en mujeres lúpicas
de 35 a 44 años, en comparación con mujeres de la misma
edad en el estudio Framingham.
El mecanismo del desarrollo
de ATA en éstos pacientes es
incierto, se sospecha de una
combinación de los factores de
riesgo cardiovascular (FRCV)
tradicionales con los mediadores inflamatorios propios de
la enfermedad. Conclusiones:
la importancia de los FRCV
convencionales en el aumento
de la carga de la aterosclerosis
en la población con LES está
bien documentada, se reporta
el caso por ser la ATA el primer
dato del cuadro clínico, siendo que ésta suele presentarse
en promedio 10 años después
del diagnóstico de LES. El tratamiento específico del LES
continúa siendo la piedra angular en éstos pacientes. Sin
embargo, los esfuerzos deben
intensificarse para tratar agresivamente los FRCV tradicionales
y otros factores modificables,
siendo que los eventos cardio-
vasculares mayores representan
una de las tres primeras causas
de muerte éstos pacientes.
Granulomatosis con poliangeítis con afección limitada.
Reporte de caso
Maricarmen Lagunas Alvarado,
María Laura Georgina Rodríguez Rosales, Valeria Copca
Nieto, Wendy Josefina Santillán
Fragoso, Triana Gabriela Salgado Muñoz, Isaac Morones
Esquivel, Teresa Ivonne Gonzaga López, Dinorah Alemán
Domínguez, Dian López González
Servicio de Medicina Interna,
Hospital Central Norte, Petróleos Mexicanos, México, DF
Introducción: las vasculitis son
un grupo heterogéneo de enfermedades caracterizadas por
infiltración leucocitaria y daño
a la pared vascular, puede haber
pérdida de la integridad del
vaso, compromiso del lumen
con isquemia y necrosis. Se
clasifican según el tamaño, tipo
de vaso y localización. El mecanismo exacto detrás de estos
trastornos no está claro y pueden involucrar órganos aislados
o múltiples. Caso: femenina de
32 años, antecedente de sinusitis, sin enfermedades crónicas.
Cuadro de 2 días de evolución
con fiebre, artralgias, púrpura
diseminada. Se presenta con
fiebre de 38.5° C, púrpura palpable que no desaparece a la
digito presión en extremidades
superiores, inferiores, glúteos
y tórax anterior, artritis en mu-
ñecas, rodillas y codos, puente
nasal deprimido. Exámenes de
laboratorio: leucocitos 11.2,
neutrófilos 7.1, linfocitos 3.2,
urea 26.3 mg/dL, creatinina
0.58 mg/dL, velocidad de sedimentación globular 11 mm/h,
proteína C reactiva 2.31 g/L.
Anticuerpos: anticitoplasma de
neutrófilo cANCA 1:20. Val. de
ref. ≤1:20, Anti-DNA 0.6 Ul/
mL. Val. de ref. ≤ 9.6 uL/mL.
Factor reumatoide 11 UI/mL,
C3 164 mg/dL, C4 48 mg/dL.
Biopsia de piel: vasculitis aguda con abundantes neutrófilos,
necrosis fibrinoide en vasos de
pequeño y mediano calibre
de dermis superficial consistente con granulomatosis de
Wegener. Fue tratada con prednisona, presentando remisión
de las lesiones. Discusión: la
granulomatosis con poliangeítis
(Wegener) tiene manifestaciones cutáneas en 50% de los
casos. Es una enfermedad rara
de causa no definida, con
incidencia de 0.4 casos por
100,000 habitantes, más frecuente en hombres mayores
de 40 años. Es una vasculitis
granulomatosa necrotizante
que afecta vías respiratorias
superiores, inferiores y glomérulos, asociada con anticuerpos
anticitoplasma del neutrófilo
(ANCA). El tratamiento inicial
es con glucocorticoides que
pueden combinarse con cilofosfamida o rituximab. La
granulomatosis con poliangeítis
limitada a un órgano es más
frecuente en mujeres jóvenes,
con mayor posibilidad de evo-
S117
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
lución crónica y más afectación
del tracto respiratorio superior,
principalmente el puente nasal.
En este caso se trata de una
paciente que no corresponde al
grupo etario más frecuente, que
debutó con lesiones dermatológicas sin afección pulmonar ni
renal, cANCA normal (5% de
los casos), siendo ilustrativo de
la variante de granulomatosis
con poliangeítis con afección
limitada.
Rabdomiolisis por ejercicio
AE Morales Hernández, MQ
Trejo Mondragón, RR Pérez
Rodríguez, DR Hernández Salcedo, HE Mejía García
Medicina Interna, Hospital
Ángeles Clínica Londres, México, DF
Introducción: daño celular del
músculo esquelético, que libera
material tóxico intracelular a
circulación sistémica. Lesión
renal aguda es precipitada por
secuestro de líquidos en músculo, disminuyendo volumen
extracelular, activación del sistema nervioso simpático, ADH,
y sistema renina angiotensina,
favoreciendo vasoconstricción,
retención de agua y sodio.
Resultando lesión oxidativa,
daño y obstrucción tubular.
Descripción del caso: masculino de 24 años de edad, inicia
padecimiento 3 días previos
del internamiento, al realizar
actividad física excesiva, presentando posteriormente dolor
leve, aumento de volumen
en extremidades superiores,
S118
astenia, adinamia, y oliguria,
acudiendo a urgencias. Al
ingreso reportan: cr 1.1, u 41,
CPK 100 930.333, mioglobina
583, AST 1197, k 4.7, Mg 1.6,
Ca 7.8, P 4.6, ácido úrico 7, ph
7.63, H3CO3 27, ph urinario
5. Durante el internamiento
se mantuvo volumen urinario
de 200 mL hora, con solución
fisiológica a 400 mL hora, 1
litro dextrosa al 5%, 100 mmol
HCO3, resultando Cr .7, K 3.9,
Ca 9, Mg 2, P 4, CPK 1 332, U
15, ácido úrico 5, PH urinario
6.5. Cursó asintomático, con tolerancia a la terapia hídrica, con
resultado control de CPK a las
24 horas de 86 000 U por litro,
a las 48 horas CPK 360 000 U
por litro, 72 horas CPK 48 067,
96 horas con control de CPK 4
133 u/L, con disminución de la
Cr plasmática de 1.1 y a las 96
horas de 0.7, resolviendo la lesión renal aguda. Comentarios
y Conclusiones: los pacientes
con rabdomiólisis que se asocia
con lesión renal aguda generalmente se presentan con un
cuadro clínico de depleción
de volumen que se debe a la
retención de agua en los músculos lesionados. Por lo tanto,
la importancia de la reposición
agresiva de líquidos en los pacientes, se ha encontrado que
a menudo requieren alrededor
de 10 litros de líquido por día,
sin embargo, esto va regulado
en función de la gravedad de
la rabdomiólisis. La lesión del
riñón es una combinación
de toxicidad directa tubular
mediada por lesión oxidativa
asociada a la mioglobina, el
daño tubular debido a la isquemia, y a la obstrucción túbulo
distal, debida a la precipitación
proteica. El tratamiento estándar para la insuficiencia renal
inducida por rabdomiólisis es la
rehidratación agresiva y es eficaz para los pacientes con una
forma leve de la enfermedad.
Se requiere diálisis en pacientes
con acidosis metabólica severa
y disfunción renal severa relacionada a mioglobinuria.
Monoartritis de rodilla como
manifestación de síndrome de
Good
Malinally Rosas José, Blanca
Alicia Chong Martínez
Servicio de Medicina Interna,
Hospital de Especialidades,
Centro Médico Nacional Siglo
XXI, IMSS, México, DF
El síndrome de Good es una
asociación entre timoma e
inmunodeficiencia primaria
de inicio en el adulto, descrito
por primera vez en 1955, por
el Dr. Robert Good. Se afectan
ambos sexos por igual y la
media de presentación es de
59.1 años. Solo se ha reportado un caso diagnosticado
en la infancia. Los pacientes
con síndrome de Good, tienen
susceptibilidad incrementada
a bacterias, virus y hongos, así
como infecciones oportunistas
relacionadas, tanto a defectos
en la inmunidad celular como
humoral. Las infecciones más
comúnmente reportadas son
del tracto respiratorio superior
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
e inferior. Reporte de caso:
hombre de 44 años, sin alguna condición premórbida.
Como antecedente, refiere
infecciones dérmicas compatibles con tiña corporis de 9
años de evolución, recibiendo
itraconazol, con respuesta adecuada durante el tratamiento,
recidivando al termino del
mismo, sinusitis de 3 años de
evolución, de repetición, y
episodios de diarrea de forma
intermitente y los cuales se
autolimitaban. 9 meses previos
al ingreso, fue realizada cirugía
de tórax, resecando tumoración
pleural. hospitalizado en varias
ocasiones, por infecciones de
repetición colangitis, y empiema izquierdo, con tratamiento
a base de carbapenémico y
vancomicina x 21 días y drenaje con sonda endopleural,
con aislamiento de Morganella
morgagni en hemocultivos y
Streptococcus viridans en cultivo de expectoración. Un mes
previo a su ingreso presencia de
monoartritis de rodilla derecha.
El ingreso por fiebre de 2 semanas y aumento de volumen de
rodilla izquierda. Sus exámenes
de ingreso: Urea 36 mg/dL,
creatinina 0.72 mg/dL, Na+ 132
mg/dL, K+ 4.3 mg/dL, Hb: 10.1
g/dL, leucocitos 5900; linfocitos 1070; plaquetas 450,000.
Se realizó cultivo de liquido
sinovial aislándose Morganella
morganii sp, y Pantoea sp. Hemocultivo: Morganella morganii
sp, panel viral para HVC, HVB,
VIH: negativo. Inmunoglobulinas: IgA: 19 (70-400) IgG: 180
(700-1600) IgM: 1 (40-230) IgE:
0.1 (0-100). Citometría de flujo:
la relación entre células T CD4+
y CD8+ es de 1:1.1 (normal
3:1). Reporte histopatológico
con inmunohistoquímica: CK
(+), CD99 (+), Vimetina (+),
BCL (+) CD34 (+ en vasos sanguíneos, negativa para células
neoplásicas), actina (+ en vasos sanguíneos, negativa para
células neoplásicas), S100 (+
focalmente), CALR (-): timoma
(AB) con células T inmaduras
ante estos hallazgos de hipogammaglobulinemia asociado
con timoma se concluye con
el diagnóstico de síndrome de
Good.
Enfermedad intersticial pulmonar inducida por metotrexato,
a propósito de un caso clínico
Aldo Taurino Vázquez Ruvalcaba,1 Daniel Iván Arroyo
Espinosa2
1
Residente de segundo año de
Medicina Interna
2
Médico internista. Profesor
titular del curso de especialización
Departamento de Medicina
Interna, Unidad Médica de Alta
Especialidad, Centro Médico
Nacional de Occidente, Instituto Mexicano del Seguro Social,
Guadalajara, Jalisco
Introducción: la toxicidad
pulmonar inducida por metotrexato ocurre después de
semanas a meses de uso, se
considera una reacción inmune
idiosincrática, más que un proceso relacionado con la dosis.
Descripción del caso: hombre
de 49 años con antecedente
de polimiositis de 6 meses de
evolución en tratamiento con
prednisona, 2 meses previos se
agregó metotrexato, no hábito
tabáquico ni etílico. Inició una
semana previa con malestar
general, tos seca, dificultad para
respirar progresiva, fiebre de
38º; un médico indicó amoxicilina/clavulanato, sin mejoría
clínica. Fue ingresado a nuestro
servicio por empeoramiento de
dificultad respiratoria en reposo, con persistencia de fiebre.
A la exploración, con dificultad
respiratoria, dependiente de
oxígeno mediante mascarilla reservorio, oximetría pulso 89%,
estertores crepitantes en ambos
tercios pulmonares inferiores.
Su radiografía de tórax con
múltiples opacidades difusas de
predominio basal, espirometría
con restricción leve I/V. Tomografía de alta resolución con
infiltrado intersticial bilateral
de predominio hacia las bases
y zonas de consolidación posterobasales. Cultivos de sangre,
esputo y orina, sin crecimiento.
Se suspendió metotrexato, se
inició manejo con hidrocortisona 2 mg/kg/día, moxifloxacino
400 mg cada 24 horas ante la
sospecha de sobreinfección.
Presentó respuesta favorable en
los siguientes 7 días. Se solicitó
nueva tomografía de alta resolución con resolución del infiltrado
intersticial y zonas de consolidación del 90%. Se egresó al
día 13 con dosis decrecientes
de prednisona, sin dificultad
S119
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
para respirar y sin necesidad de
oxígeno suplementario. Comentario: el diagnóstico se basa en
la evolución, hallazgos clínicos,
anormalidades radiográficas,
ensayo de retirada del fármaco,
lavado broncoalveolar y biopsia
pulmonar. Al no tener acceso a
estos dos últimos, la tomografía
de alta resolución es actualmente
una opción, pues a cada patrón
histológico le corresponde uno
característico en dicho estudio.
El valor predictivo positivo de
la tomografía de alta resolución
alcanza el 96%, permitiendo
obviar la biopsia en un contexto
clínico apropiado. Conclusión:
el tratamiento de la enfermedad
intersticial inducida por metotrexato, incluye retirada del
fármaco así como antibioticoterapia cuando se sospeche
infección agregada. El tratamiento con corticoides acelera
la recuperación.
Síndrome de activación de macrófago como presentación de
lupus eritematosos sistémico.
Caso clínico
Sergio Alberto Mendoza Álvarez, Fabiola González Márquez,
María de los Ángeles Flores
Méndez
Medicina Interna, UMAE Hospital de Especialidades, Centro
Médico La Raza, México, DF
Introducción: el síndrome de
activación de macrófago (SAM)
se caracteriza por la activación
de histiocitos con hemofagocitosis en la médula ósea y otros
sistemas reticuloendoteliales
S120
que se puede manifestar como
presentación grave o complicación de lupus eritematoso
sistémico (LES). Descripción
del caso: mujer de 32 años con
antecedente de preeclampsia
y trombosis venosa de seno
longitudinal y transverso. Tres
meses después inició con
úlceras orales; adenopatías
cervicales, fiebre de 38.5c,
artralgias, neutropenia severa,
anemia y patrón pulmonar
intersticial que evolucionó
con insuficiencia respiratoria,
ameritó intubación orotraqueal
y norepinefrina por estado
de choque, recibió antibiótico empírico para neumonía
atípica y fúngica así como
estimulante de colonia de
granulocitos. Se reportó hepatoesplenomegalia por USG,
un aspirado de médula ósea
(AMO) sin alteraciones y biopsia de hueso que concluyó
trombocitosis esencial. Se
descartó proceso infeccioso
por cultivos. Por sospecha de
enfermedad autoinmune se
solicitó anticogulante lúpico y
anticardiolipinas con resultado negativo, C3: 153 C4: 22,
ANAS 1:320 moteado fino,
anti DNA negativo; Anti RO
67.71 (positivo) anti LA. 2.41
anti SM 8.6 y anti RNP 124.43
(positivo), ferritina 1000 ng/
mL; triglicéridos: 254 mg/
dL. Ante la sospecha de SAM
por hiperferritinemia, hipertrigliceridemia, neutropenia,
hepatoesplenomegalia se solicitó nuevo AMO que reportó
histiocitos y fagocitosis activa.
Se concluyó SAM como presentación de LES con actividad
severa hematológica y pulmonar; se descartó síndrome
mieloproliferativo y se inició
metilprednisolona e inmunoglobulina con mejoría que
permitió retiro de ventilador.
Tres semanas después presentó nuevamente neutropenia,
púrpura trombocitopénica y
vasculitis del SNC. Se indicó
ciclofosfamida con remisión
del cuadro. Comentario y Conclusión: el SAM es un proceso
inflamatorio multisistémico
grave caracterizado por una
excesiva activación y expansión de macrófagos y células
T con hipercitocinemia masiva
cuya incidencia no esta reportada; solo se han reportado
94 casos asociados a LES ya
que la asociación más común
esta reportada en niños con
artritis idiopática juvenil. Es
fundamental un diagnóstico
temprano y tratamiento oportuno debido a que la mortalidad
oscila entre 10 a 20% en estos
casos, pero cuando el diagnóstico se retrasa la mortalidad
aumenta significativamente.
Evento cerebrovascular isquémico en paciente joven, un reto
diagnóstico
Viridiana Montserrat Mar Torres, Martha Elizabeth Segovia
Guardado, Estefanie Villanueva Rodríguez, Mario Antonio
Cerecedo Rosendo, Enrique
González Valderrama, Francisco López Garza
Servicio de Medicina Interna
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
y Reumatología, Hospital Regional de Ciudad Madero de
Petróleos Mexicanos, Ciudad
Madero, Tamaulipas
Introducción: el síndrome antifosfolipídico (SAF) fue descrito
en 1983, se presenta con la
triada de trombosis venosa y/o
arterial de pequeño vaso, morbilidad durante el embarazo
y alteraciones hematológicas
(trombocitopenia y anemia
hemolítica), asociadas por un
título elevado de anticuerpos
antifosfolipídicos (AFL), anticoagulante lúpico (AL) y/o
anticuerpos anticardiolipina
(aCL). Descripción del caso:
mujer de 21 años de edad
con antecedente de epilepsia
diagnosticado en 2007 en tratamiento con DFH hasta 1 año
previo ya que fue suspendido
por embarazo manteniéndose
asintomática desde el 2011.
Por infertilidad fue sometida
a histerolaparoscopia, solo
con hallazgo de ovarios poliquísticos, antecedente de 3
embarazos G3 A3. Inicia su
padecimiento actual a la 1:30
am con crisis epiléptica no
convulsiva destacando síntomas psicóticos, posteriormente
es encontrada con pérdida del
estado de alerta. A la exploración física presenta rash malar
y hemiplejia derecha, por lo
que se decide realizar TAC de
cráneo simple, mismo que no
arroja alteraciones. Se realiza
biometría hemática, solo destacando trombocitopenia de
87,000. Se inicia manejo con
bolos de esteroide y anticoagulación ante la sospecha de
etiología autoinmune de fondo.
A las 72 horas se realiza TAC de
control en la que se objetiva un
infarto en territorio profundo y
superficial posterior de arteria
cerebral media izquierda. Los
estudios inmunológicos destaca
elevación de antiB2 GLI, ACL y
AL, los anticuerpos antinucleares fueron negativos, con lo
cual se llega al diagnóstico de
SAF secundario a LES aunque
los inmunológicos sean negativos, continuando manejo con
anticoagulación, cursando con
favorable evolución se decide
su egreso. Comentarios: el SAF
puede ser primario cuando no
se correlaciona a otra enfermedad; secundario, cuando
se asocia a otras condiciones
patológicas, principalmente
lupus eritematoso sistémico.
La paciente debuto con una
manifestación infrecuente (EVC
isquémico), convirtiéndolo en
un caso interesante para llegar
al diagnóstico de SAF, cumpliendo con los criterios clínicos,
obstétricos e inmunológicos.
Conclusiones: se encuentra bien
establecida la asociación entre
SAF, aCL, y las manifestaciones
clínicas de trombosis venosa
y arterial a cualquier nivel
de la economía. Usualmente
se encuentra asociado a otra
patología autoinmune de base
siendo la más frecuente lupus,
como es el caso de esta paciente
al cumplir con por lo menos 4
criterios diagnósticos para esta
patología.
Tub erculo si s m eníngea y
mielitis transversa en lupus
eritematoso
David Aparicio Hernández,1
Flavio Rojas Castillejos,2 Pablo
Calzada Torres,1 Alejandro Felix
Canseco3
1
Residente de tercer año
2
Residente de cuarto año
3
Médico adscrito
Servicio de Medicina Interna,
Hospital General Dr. Aurelio
Valdivieso, SSA, Oaxaca de
Juárez, Oaxaca
Introducción: la mielitis transversa (MT) en pacientes con
lupus eritematoso sistémico
(LES) se estima en 1-3%, se
presentan dos picos de aparición 10-19 y 30-39 años. La
MT puede asociarse a enfermedades del tejido conectivo,
sarcoidosis, esclerosis múltiple,
infecciones como tuberculosis
(TB), sífilis, patologías virales
(Ebstein-Barr, ECHO, Coxsackie) y neoplasias, por lo que
requiere un abordaje extenso
en la exclusión de múltiples
patologías. Caso clínico: mujer de 32 años, originaria
de Oaxaca, antecedentes de
importancia: LES de 1 año de
diagnóstico en tratamiento
con prednisona 5 mg al dia e
hidroxicloroquina 200 mg al
día. Hipotiroidismo primario
en sustitución con levotiroxina, hospitalización hace tres
meses por neumonía adquirida
en la comunidad. Inicia padecimiento el 05-05-14 con fiebre
de 39.5 grados, predominio
nocturno, diaforesis, tos seca,
S121
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
mialgias, artralgias y cefalea. Al
segundo día parestesias en abdomen y anestesia de miembros
pélvicos, pérdida del control de
esfínteres e incapacidad para
deambular, se integró diagnóstico de MT de T6-T7. Los estudios
de laboratorio y marcadores
inmunológicos sin alteraciones
(Anti-DNA, anti-cardiolipinas
IgM e IgG), punción lumbar con
100 células, 90% mononucleares, hipoglucorraquia (20 mg/
dL), proteinorraquia (300 mg/
dL), aspecto de agua de roca.
Adenosin desaminasa 12.3 en
LCR. Perfil TORCH, tinta china,
PCR para virus y atípicos, Gene
Xpert y cultivos negativos. Velocidades de neuroconducción
sin alteraciones, potenciales somatosensoriales con disfunción
de cordones posteriores distales
a T6. Resonancia magnética
con lesión hiperintensa de T7 a
T12. Concluyendo el diagnóstico de Tuberculosis meníngea
con MT secundaria, se inició
manejo con anti-tuberculosos
y terapia de rehabilitación.
Comentario: en nuestro caso,
la dificultad para establecer
el diagnóstico, era diferenciar
neurolupus (NL) en contra de
neuroinfección secundaria a
inmunosupresores. Uno de
los criterios de exclusión para
diferenciar NL de una neuroinfección es la presencia de
adenosin desaminasa positiva
en LCR y la presentación de
MT relacionada a un cuadro
clínico infeccioso, sin actividad lúpica en otro sistema o
elevación de auto-anticuerpos.
S122
Conclusiones: los síndromes
neurológicos en LES deberán
ser protocolizados para descartar patologías infecciosas,
neoplásicas y autoinmunes
asociadas, principalmente en
aquellos en tratamiento prolongado con inmunosupresores,
antes de iniciar manejo.
Síndrome de Goodpasture
pANCA positivo: reporte de
caso
José Ricardo García de la Peña,
Ángel de Miguel Barrios Balderrama, Ernesto Alejandro
Lozano Sabido, Joel Loeza
Irigoyen, Pablo Jacinto Flores
Santiago, Daniel Iván Arroyo
Espinosa
Servicio de Neumología, UMAE
Hospital de Especialidades,
Centro Médico Nacional de
Occidente, Guadalajara, Jalisco
Introducción: el síndrome de
Goodpasture es la combinación
de hemorragia alveolar difusa,
glomerulonefritis rápidamente
progresiva y anticuerpos antimembrana basal glomerular
(antiMBG). Presentamos un
caso doble positivo con desenlace favorable. Descripción del
caso: mujer de 48 años, inició
con disnea, hemoptisis, fiebre,
diaforesis nocturna, hematuria, proteinuria y elevación de
azoados (creatinina 526 µmol/L,
urea 257 mg/dL). Ameritó apoyo ventilatorio, transfusión y
hemodiálisis. Tomografía de
tórax: patrón retículo-nodular
en parches confluentes en ambos hemitórax. Biopsia renal:
glomeruloesclerosis global
difusa sin vasculitis o granulomas. Inmunofluorescencia
negativa para complejos inmunes (dado la cronicidad y
esclerosis glomerular). ANA,
antiSm, antiDNA, antiRNP,
antiSSA, antiSSB, AgsHBV,
antiHCV y antiHIV negativos.
C3 y C4 normales, cANCA negativos y pANCA positivo ++.
AntiMBG positivos en suero.
Recibió metilprednisolona y
se continuó prednisona oral.
Presentó neumonía nosocomial
e infección de vías urinarias
por Acinetobacter baumanii y
Pseudomonas aeruginosa, esto
impidió tratamiento inmunosupresor con ciclofosfamida.
No hubo disponibilidad de
plasmaféresis. A pesar de limitaciones, se logró recuperación
parcial de función renal (TFG
>30 mL/min). Comentarios: el
síndrome de Goodpasture es
una enfermedad que se presenta con síndrome riñón-pulmón.
Su incidencia es de 0.5 a 1 por
millón de habitantes, con presentación bimodal en la tercera
y sexta década de la vida. El
30% se presenta con serología
positiva para pANCA y antiMBG. La aparición de pANCA
produce lesión glomerular, que
expone la membrana basal y
la cadena alfa 3 del colágeno
tipo IV. Un daño alveolar subsecuente produce reconocimiento
de la membrana basal alveolar
por linfocitos B, producción de
autoanticuerpos y hemorragia
alveolar con respuesta celular
por la proliferación y activa-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
ción de linfocitos T expuestos
al antígeno de alfa 3 (IV)NC1.
Los factores de mal pronóstico
identificados son creatinina en
suero > 500 µmol/L, necesidad
de terapia dialítica y hemorragia alveolar. Es controversial el
significado de la doble positividad para pANCA y antiMBG.
Conclusiones: a pesar de que
no se aplicó tratamiento ideal,
presentó una evolución favorable sin necesidad de terapia
dialítica hasta el momento. Esto
sugiere que la doble positividad en este caso de síndrome
de Goodpasture, confirió un
mejor pronóstico. Esto estaría
en concordancia con algunas
referencias a nivel mundial.
Síndrome reumático paraneoplásico: lupus-like: a propósito
de un caso y revisión de la
literatura
Laura Isela Rivera Ramírez,1 Carlos Rodrigo Escalante Penagos2
1
Residente de Medicina Interna, Servicio de Medicina
Interna
2
Médico Internista, Residente
de Reumatología, Servicio de
Reumatología
Hospital General de México
Introducción: los síndromes
reumáticos paraneoplásicos
son manifestaciones asociadas
con cáncer. El síndrome de
lupus-like se asocia raramente con neoplasias malignas.
Manifestaciones: poliserositis,
fenómeno de Raynaud, neumonitis, poliartritis no deformante,
glomerulonefritis, anticuerpos
antifosfolipídicos y antinucleares. Los tumores sólidos y
anticuerpos antifosfolipídicos
presentan mayor probabilidad
de un evento tromboembólico.
CASO Hombre de 49 años, IT
10 paquetes/año, pérdida de
peso de 27 kg/ 9 meses. En
noviembre del 2013 presentó
poliartralgias, disminución
de la fuerza en extremidades,
astenia, y anemia (Hb de 9
g/dL) inició tratamiento con
hierro, disminuyendo sintomatología. En febrero del 2014 se
agregó marcha inestable, ojo
seco, diaforesis y temblor de
extremidades superiores. A la
exploración física se encuentra
hipotrofia de extremidades,
mioclonias en extremidades
y temblor distal. Cultivos y
pruebas inmunológicas de LCR
normales; anticuerpos antiDNA +, ANA -, aCL IgA +, IgG
+, IgM normal, beta-2 microglobulina normal, p-ANCA +,
anti Ro y anti LA -, consumo de
C3, PCR 12.8 mg/dL. IRM-gadolinio de encéfalo: imágenes
hiperintesas puntiformes en
sustancia blanca y yuxtacorticales en T2 y FLAIR probable
origen vascular; radiografías
de manos y pies normales. Se
inició glucocorticoide a 1 mg/
kg/día, heparina fraccionada y
antiagregante plaquetario con
mejoría parcial. Radiografía y
TAC de tórax: ensanchamiento
mediastinal por tumoración en
mediastino anterior. Se realizó
resección de tumoración, resultado de biopsia compatible con
timoma. Después de la cirugía
se disminuye dosis de esteroide, presentando evolución
favorable con desaparición de
la sintomatología. Comentarios: no cumple con criterios
para enfermedad de tejido
conectivo, sin embargo con
sintomatología y marcadores
reumatológicos, que desaparecen posterior a resección
de timoma, considerándose síndrome paraneoplásico.
Conclusión: es importante reconocer los signos clínicos que
sugieren una neoplasia subyacente, ayudando a distinguir
un síndrome paraneoplásico de
una enfermedad reumatológica
idiopática (rápido inicio, edad,
mala respuesta a los corticoesteroides o inmunosupresores,
distribución atípica de articulaciones afectadas, alteración
de pruebas de laboratorio) para
una rápida detección e inicio
del tratamiento de la neoplasia
subyacente con la curación
de estas manifestaciones reumáticas.
Estenosis subglótica como
manifestación clínica de la policondritis recidivante. Reporte
de caso
KI De la Cruz Rodríguez, JA López Pérez, E Hernández Alonso
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Villahermosa, Tabasco
Introducción: la policondritis
recidivante es una enfermedad
inflamatoria de etiología desconocida que afecta al tejido
S123
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
cartilaginoso. Incidencia de 3.5
casos por año. La mayoría de
los pacientes se realiza el diagnóstico años después de iniciar
la enfermedad. Descripción del
caso: femenina de 17 años, antecedentes de amigdalectomía,
rinitis alérgica. A los 12 años
presento lesiones dérmicas en
forma de pápulas aperladas e
indoloras en abdomen y muslo.
Biopsia de piel, con reporte
histopatológico de proliferación
linfocítica no clasificada. Recibe
inmunoterapia oral desde hace
un año, por reactividad dérmica
a diferentes alérgenos. Hace 3
años inició con sensación de
cuerpo extraño a nivel faríngeo,
accesos de tos durante risas
o posterior a conversaciones
prolongadas, disfonía vespertina, sensación de falta de aire
durante la práctica de deportes,
ocasionalmente estridor. Catalogada como asma al ejercicio
tratada con broncodilatadores
y esteroides en aerosol con
mejoría. Ha presentado artralgia de medianas articulaciones.
Examen físico presenta engrosamiento de ambos pabellones
auriculares a nivel del antihelix,
presenta dolor leve a la presión a
nivel de laringe. Campos pulmonares a la auscultación discreta
rudeza respiratoria con ocasional estridor a la espiración. Se
realiza laboratorios de gabinete
normal, espirometría con patrón
obstructivo no reversible con
broncodilatadores y curvas de
hipoflujo compatible con lesión
a nivel subglótica, TAC de cuello
y tórax se observa disminuido
S124
la luz a nivel de laringe en
80%, laringoscopia se reporto
estenosis subglotica del 80%,
biopsia de glotis con fibrosis
e inflamación crónica e inespecífica y biopsia de pabellón
auricular compatible con policondritis recidivante. Recibió
tratamiento con prednisona y
azatioprina remitiendo el cuadro auricular y disnea pero aun
con persistencia de la estenosis.
Comentario: la policondritis
recidivante es poco frecuente, el
diagnostico es clínico (criterios
de McAdan) la biopsia es una
herramienta de apoyo, la mayoría de los pacientes presenta
otras manifestaciones que retrasa el diagnóstico. Conclusiones:
actualmente se han realizado
investigaciones en relación a la
terapia biología para mejorar las
condiciones clínicas del paciente en caso de manifestaciones
graves, pero debido a su poca
frecuencia esto se ha presentado
limitaciones.
Síndrome antisintetasa. Reporte de caso
Perla Esmeralda Flores López,
Andrés Roberto Lugo Guadarrama, Stephanie Anely Rodríguez
Fabián, Nancy Lourdes Castellanos Sánchez
Servicio de Medicina Interna,
Centro Médico ISSEMyM Ecatepec, Estado de México
El síndrome antisintetasa es
una entidad poco frecuente,
incluida dentro de las miopatías
inflamatorias idiopáticas, que
engloba un subgrupo clínico
caracterizado por miositis, poliartritis, enfermedad pulmonar
intersticial, fiebre, fenómeno de
Raynaud, “manos de mecánico” y anticuerpos antisintetasa.
Femenina de 24 años, sin antecedentes de relevancia, inició
Abril del 2013 con disnea de
medianos esfuerzos, progresiva, acompañada de tos no
productiva, no cianozante,
náuseas sin llegar al vómito y
progreso hasta ser de pequeños
esfuerzos. Exploración física
disminución de movimientos
de amplexión y amplexación,
vibraciones vocales bilaterales disminuidas, estertores en
velcro infraescapulares, saturación del 75% con FIO 2 al
21%. Exámenes de laboratorio
leucocitos 10,910, neutrófilos 6546, linfocitos de 3491,
monocitos de 872, creatinina
0.9 mg/dL, nitrógeno ureico 20
mg/dL. La radiografía de tórax
mostro lesiones en imagen de
vidrio despulido. La tomografía
con imagen en vidrio despulido predomino subpleural y
engrosamiento septal interlobulillar en lóbulos inferiores.
Espirometría 22/08/13 FVC
24%, 910 mL, FEVI 22% 710
mL, REL 78.24. En 2014 curso
con fenómeno de Raynauld, lesiones descamativas simétricas,
hiperqueratósicas, debilidad en
la cintura pélvica 3/5 y escapular 3/5, edema de manos y
lesiones de Gottron en codos,
artritis en carpos, interfalángicas proximales. Exámenes
de laboratorio: anticoagulante
lúpico(-), anticuerpos: anti-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
centrómero (+) 6.4(<3.7), anti
SCL 70 (+) 5( <3.7), anticuerpos
anti-nucleares IgG, moteado
grueso1:80, citoplasmático
1:80, filamentos intermedios
1:40, anti RNP (-), anti SM (-),
anti SSa (-), anti JO (+) de 246.7.
Comentario: como criterios la
Miopatía con debilidad muscular proximal o subclínica
con neumopatia intersticial o
Artritis inflamatoria no erosiva,
síndrome de Raynaud y síndrome seco, no existen criterios
validados para el diagnóstico,
los más usado son Criterios de
Bohan y Peter modificados y
no siempre los pacientes presentan todas manifestaciones,
pero con al menos una manifestación clínica y positividad
de autoanticuerpos permite el
diagnostico de forma razonable. Conclusión: el síndrome
antisintetasa es de importancia
ya que es un padecimiento
raro en reumatología con prevalencia 8/100000 habitantes.
Esta paciente cumple criterios
clínicos y positividad de anticuerpos antisisntetasa y anti JO
y tratamiento con ciclofosfamida actualmente en su séptimo
bolo.
Macroglobulinemia de Waldenström y síndrome nefrótico.
Reporte de un caso
O Ruvalcaba Pérez, M Pacheco
Ruelas, M Xolotl, M Casarrubias, O Vera Lastra
Servicio de Medicina Interna,
UMAE-Especialidades Dr. Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: la macroglobulinemia de Waldenström
(MW) es una neoplasia del
tejido linfoide caracterizada
por gamapatiamonoclonol e
infiltración linfoplasmocitoide.
En México la MW representa
solo el 0.18% de todas de las
neoplasias hematológicas es 11
veces menos frecuente que en
los caucásicos. Objetivo: presentar el caso de un paciente
con macroglobulinemia de
Waldenström que inicio con
un síndrome nefrótico. Resumen: paciente masculino de
83 años de edad con antecedentes de hipertensión arterial.
Inició con edema de piernas y palidez de tegumentos,
falta de fuerza de las extremidadesquienrequirió cirugía
urgencia por hernia inguinal
estrangulada, con hemorragia
postquirúrgica requiriendo re
intervención. Posterior a la cirugía destaca palidez de piel y
tegumentos, edema de piernas
y fuerza muscular 3/5 en ambas
extremidadespélvicas y con
sensibilidad conservada. Cursó
con lesion renal aguda que resolvió con tratamiento médico.
Se inició protocolo de anemia y
síndrome nefrótico. Laboratorio
posterior a la cirugía creatinina 2.3 mg/dL, depuración de
creatinina 80 mL/min, proteínas urinarias en 12.21 g/ 24
h, albúmina de 1.6 g/L, calcio:
8.7 mg/dL, calcio corregido en
10.54, electroforesis de proteínas en sangre anormales. Gama
69.5% (8.40-18.30%), proteína
de Bence Jones negativa e IgM
de 2720 (60-250mg/dL), biopsia de hueso con celularidad
del 80%, con 60% de la celularidad correspondiente a una
infiltración con patrón nodular,
intersticial y en dos celdillas
de tipo difuso de linfocitos
pequeños de aspecto maduro
acompañados de mielofibrosis
grado II-III de Bauermeister.
Biopsia renal cambios isquémicos. Tomografía de tórax y
abdomen normal. Electromiografía: polineuropatía sensitivo
motora desmielinizante con
evolución axonal. Se concluyó diagnóstico de MW y
fue tratado con rituximab y
ciclofosmadia y actualmente
con rituximab y clorambucil,
con respuesta adecuada al
tratamiento, sin proteinuria y
mejoría de la fuerza muscular
y la anemia. Conclusión: el
presente caso cumplió criterios
para MW con inicio atípico
con proteinuria en rangos nefrótico, posteriormente anemia
y polineuopatía. La MW es
una gamapatía que también
debe sospecharse en casos de
neuropatía. Este paciente ha
respondido en forma adecuada
a rituximab y ciclofosfamida.
Esclerodermia asociada a síndrome ASIA
Citlali Fernández Vivar, Ana Lilia
Peralta Amaro, Olga Lidia Vera
Lastra
Departamento de Medicina
Interna, UMAE Hospital de Especialidades Dr. Antonio Fraga
Mouret, Centro Médico Nacional La Raza, IMSS, México, DF
S125
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Introducción: síndrome ASIA:
condición del tejido conectivo
afecta a ciertos individuos posterior a cirugía cosmética. El
silicón puede provocar respuesta
autoinmune a través de su conversión a silicio, asociándose
a aumento de prevalencia de
síndrome de esclerosis sistémica
progresiva-like. Existe posible
asociación entre implantes de
silicona neoplasia y linfomas
en casos aislados. Desarrollo:
mujer de 34 años, antecedente
de LNH angioinmunoblástico
en 2010, recibió esquema de
quimioterapia, primer esquema
con MINE sin remisión, HyperCVAD como segunda línea
con remisión, primera recaída en 2011 con infiltración a
médula ósea recibiendo tercer
esquema. Trasplante de medula
ósea en septiembre del 2011.
Antecedente de inyección de
grasa bovina en glúteos y mamas
2009. PA Inicia hace dos años
con cambios dérmicos a nivel
de glúteos con resequedad y
descamación de piel y aparición
de úlceras, vista por Dermatología con tratamiento con cremas
lubricantes, posteriormente
áreas de hiperpigmentación de
piel y cambios atróficos. Acude
a MI por endurecimiento de
piel de extremidades superiores
de 10 meses de evolución, además de artralgias de un año de
evolución con limitación a la
extensión. EF: rondan 34 puntos, cambios dérmicos difusos
de hiper e hipopigmentación,
región glútea con zonas de
hiperpigmentación intensa y
S126
atrofia, mama con mayor induración, con limitación para
la extensión de articulaciones
pequeñas. ANA 1:320 moteado discreto (anti centrómero),
anti-DNA negativos, Anti-ro
22.4. Biopsia nervio Inflamación perineural. Biopsia de piel
Esclerosis de la dermis, biopsia
de glúteo deposito material
oleoso en dermis con inflamación crónica linfocítica. TC
toracoabdominal crecimientos
ganglionares en ambos lados
del cuello. Comentario: Paciente con antecedente LNH y de
inyección de grasa bovina en
glúteos y mamas, clínicamente
con datos de esclerodermia y anti-centrómero positivo además
se concluyó en un ASIA por las
lesiones en glúteos ante cuadro
clínico recibió tratamiento inmunosupresor con ciclosporina,
micofenolato y metotrexato con
mejoría significativa, continua
en seguimiento por Medicina
Interna. Conclusión: ASIA se
asocia a varias enfermedades autoinmunitarias, la esclerodermia
una principal, la importancia
de detectar en forma temprana
la afección sistémica en estos
pacientes y/o su asociación con
otras enfermedades sistémicas
autoinmunes radica en la oportunidad de iniciar tratamiento
oportuno que mejore el pronóstico de vida.
Síndrome antifosfolipídico asociado con insuficiencia adrenal
en paciente masculino
Flora Abigail Zúñiga Villavicencio, Luis Fernando Gasca
Plancarte, Maribel Mejía Moreno
Medicina Interna, Centro Médico Lic. Adolfo López Mateos,
Instituto de Salud del Estado
de México, Toluca, Estado de
México
Introducción: el síndrome antifosfolipídico (SAF) es una
entidad tradicionalmente descrita en mujeres, hasta en un
80% de los casos. Existen manifestaciones atípicas de este
síndrome, como la insuficiencia
adrenal referida en muy pocas
ocasiones. Descripción del
caso: paciente masculino de
31 años. Antecedentes: etilismo
desde los 18 años, suspendido
hace 4 años, tabaquismo por
10 años. Acude en octubre de
2008, por aumento de volumen
de miembro pélvico derecho y
dolor, documentándose trombosis venosa mediante ultrasonido
(USG) doppler (trombosis venosa profunda desde la vena
femoral, hasta la vena poplítea)
recibiendo anticoagulación con
antagonistas de la vitamina K
por 1 año. En agosto de 2012,
presenta nuevo cuadro de
trombosis en miembro pélvico
derecho corroborado por USG
doppler, por lo que se inicia
protocolo de estudio, antitrombina III 32.62 mg/dL, proteína C
55%, factor V de coagulación
50%, proteína S 76%, homocisteína 5.2 umol/L, siendo
negativos, tiempos de coagulación y azoados normales. Se
reinició anticoagulación por 1
año y medio y posteriormen-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
te se retiró. En abril de 2014
presenta cuadro de náusea,
vómito, intolerancia a la vía
oral, hiperpigmentación de la
piel, hipotensión, hiponatremia
e hipercalemia, así como lesión
renal aguda, por lo que se sospecha insuficiencia suprarrenal,
la cual se corrobora por cortisol
de 1 µg/dl. Se inició prednisona
5 mg cada 24 horas, presentando mejoría del cuadro. Dado
el antecedente de trombosis
e insuficiencia suprarrenal, se
solicitan anticuerpos anticardiolipina IgG positivo 98.16
U/mL, Anticuerpos anti beta 2
glicoproteína IgM negativo 4.6
SM U/mL, anticuerpos antibeta
2 glicoproteína IgG positivo
50.6 SG U/mL, Anticuerpos antinucleares negativo. Con lo que
se corrobora diagnóstico de SAF
e insuficiencia adrenal. Actualmente estable con prednisona
y anticoagulación formal. COMENTARIO: En los cuadros
de trombosis en hombres, se
deben de descartar trombofilias. De forma rutinaria no se
realiza búsqueda de síndrome
antifosfolipídico, dada su baja
prevalencia. La asociación con
insuficiencia suprarrenal se
presenta en 1-2 %. Se vigilará
por 3 años y de no presentar
otra enfermedad acompañante se diagnosticará síndrome
antifosfolipídico primario. Conclusiones: es importante realizar
todo el protocolo para descartar
trombofilias en pacientes masculinos jóvenes y tener presente
manifestaciones poco comunes
de trombosis.
Vasculitis asociada con pANCAS como fiebre de origen
desconocido. Reporte de caso
Mireya Citlalli Pérez Guzmán,
José Miguel Álvarez Blanco,
Antonio Jordan Ríos, Daniel
Toiber Geller
Servicio de Medicina Interna,
Centro Médico ABC, México,
DF
Introducción: la fiebre de origen desconocido se define
como una temperatura mayor
de 38 grados, de 3 semanas
de evolución sin etiología, a
pesar de abordaje como paciente externo, o una semana
de abordaje hospitalario. Actualmente la principal causa
la representan las neoplasias.
Las enfermedades del tejido
conectivo representan el 13%,
las vasculitis p-ANCA. Reporte
de caso: paciente femenina
de 68 años de edad quien ingreso al servicio de medicina
interna por fiebre de un mes
de evolución de predominio
vespertino de hasta 38.5°C
acompañada de escalofríos
que cedía con antipiréticos, se
agregó tos con expectoración
inicialmente hialina y posteriormente mucopurulenta. Es
tratada con múltiples esquemas
antimicrobianos sin mejoría
de sintomatología, asociado a
pérdida de peso de 6 kg. Con
antecedente de tabaquismo IT
13, osteartrosis. Se pancultiva
a su ingreso en pico febril. Se
solicita TAC de tórax la cual
mostró datos de engrosamiento intersticial, asi como panal
de abeja de predominio bibasal. Se solicita determinación
de anticuerpos: ANA, AntiDc
DNA, Anti cadena simple DNA,
PANCA, C ANCA, PPC, anti
RNP-1, SSA, SSB, Anti Scl 70,
antifosfolípidos, anticardiolipinas, anticoagulante lúpico, anti
b2 microglobulinas, así como
serología para TORCH, anti Brucella y quantiferon. Se realizó
ecocardigrama el cual se reportó normal. Durante su estancia
hospitalaria presento picos febriles vespertinos, sin deterioro
hemodinámico, posteriormente
desarrollo flogosis bimaleolar
asi como mancha violácea en
maléolo. Se realizó PET que
mostro actividad metabolica
unicamente a nivel pulmonar
con SUV max 20. Momento
en que se obtuvo positividad
para ANCAS mieloperoxidasa
por ELISA, asi como ANAS 1
a 160 patron homogeneo. Se
realizo biopsia pulmonar por
toracotomía, se diagnosticó
poliarteritis microscópica y se
inicio manejo inmunosupresor.
Conclusión: la fiebre de origen
desconocido representa un reto
diagnóstico para el internista,
un síndrome en el cual cobra
vital importancia una historia
clínica detallada así como la
exploración física minuciosa,
ya que éstas guiarán el abordaje
, permitirán llegar al diagnóstico correcto y se otorgara un
tratamiento adecuado. Reportamos el caso de una vasculitis
por p-ANCA, que si bien no
representa una enfermedad infrecuente, el diagnóstico como
S127
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
fiebre de origen desconocido
resulta complejo.
Síndrome de anticuerpos antifosfolipídicos catastrófico:
reporte de un caso
José Elihú Cuevas Castillejos,
Alain Sánchez Rodríguez, Mireya Citlalli Pérez Guzmán, María
del Carmen Amigo Castañeda
Servicio de Medicina Interna,
Centro Médico ABC, México,
DF
Introducción: el síndrome de
anticuerpos antifosfolipídicos
(SAAF) catastrófico es la forma más grave de SAAF. Esta
rara entidad se caracteriza por
trombosis diseminada principalmente de vasos pequeños
y falla orgánica múltiple. El
diagnóstico requiere un antecedente de SAAF o anticuerpos
antifosfolipídicos positivos,
trombosis en 3 o más órganos
o tejidos en el transcurso de
una semana y confirmación
histopatológica de trombosis de
pequeños vasos. La mortalidad
es alta, aunque un tratamiento
temprano y efectivo que incluya
la combinación de anticoagulante a dosis terapéutica,
glucocorticoides, plasmaféresis
e inmunoglobulina intravenosa
disminuye significativamente la
mortalidad. Presentación del
caso: se trata de una mujer de
37 años de edad sin antecedentes médicos, con un cuadro
de choque séptico secundario
a neumonía por Influenza,
complicado con falla orgánica
múltiple y trombosis arterial en
S128
las cuatro extremidades confirmada por ultrasonido doppler.
Se administraron medidas de
soporte hemodinámico y cobertura antimicrobiana de amplio
espectro. No se documentó
trombocitopenia, hemorragia
clínicamente significativa, datos
de hemólisis, hipofibrinogenemia ni prolongación de tiempos
de coagulación salvo el tiempo de tromboplastina parcial
activada. Se encontró anticoagulante lúpico positivo, por lo
que se administró Rituximab sin
presentar mejoría, decidiendo
su traslado a este hospital. Se
inició manejo con enoxaparina
a dosis terapéutica, 5 bolos de
metilprednisolona y 4 sesiones
de plasmaféresis seguidas de
3 dosis de inmunoglobulina
intravenosa. Se decidió realizar amputación de mano
derecha, pie izquierdo y arco
del pie derecho. El análisis
histopatológico de las piezas
anatómicas enviadas reportó
trombosis microvascular multifocal. La paciente presentó
una adecuada evolución, continuando con enoxaparina
sin presentar nuevos eventos
trombóticos. Comentarios: entre los principales diagnósticos
diferenciales del SAAF catastrófico se encuentran: coagulación
intravascular diseminada y
microangiopatía trombótica.
Si bien el tratamiento de estos
diagnósticos diferenciales puede ser compatible al menos en
parte con el que se administró
a esta paciente, el cuadro clínico de estas enfermedades
no concuerda con el caso de
esta paciente. Conclusiones: el
SAAF catastrófico es una variante grave y rara del SAAF con una
alta tasa de mortalidad que, por
la forma de presentación y complejidad del manejo, constituye
sin duda un reto diagnóstico y
terapéutico.
Síndrome de sobreposición, esclerosis sistémica rápidamente
progresiva y lupus eritematoso
sistémico
Eugenia Saldarriaga, 1 Carlos
Escalante Penagos, 2 Miriam
Reyna,2 Darío Aguirre Hernán,1
Felipe Posada Andrés1
1
Medicina Interna, Hospital
de La Samaritana, Bogotá,
Colombia
2
Servicio de Reumatología,
Hospital General de México
Introducción: se han descrito
casos en que coexisten manifestaciones clínicas y serológicas
de dos o más enfermedades
reumáticas en algunos pacientes. Por otro lado la afección
cardíaca en pacientes con esclerosis sistémica se presenta
en el 15 a 30% de los pacientes
y se debe a fibrosis miocárdica
y disfunción diastólica, generalmente se presenta como
insuficiencia cardíaca y en
raras ocasiones como arritmias
letales. Descripción del caso:
mujer de 24 años de edad con
esclerosis sistémica rápidamente progresiva anti-SCL70
negativo, desde hace 6 meses
con afección a piel (Rodnan
20 puntos), articular (poliartri-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
tis no erosiva), gastrointestinal
(trastornos de la motilidad esofágica) pulmonar (enfermedad
pulmonar intersticial con patrón
restrictivo e imágenes en TACAR
de tórax de vidrio despulido)
y vascular (fenómeno de Raynaud con úlceras digitales e
hipertensión arterial pulmonar
de 65 mmHg) en tratamiento
con ciclofosfamida, Inició de
forma súbita con angina y
palpitaciones documentándose en unidad de urgencias
taquicardia ventricular que
requirió cardioversión eléctrica,
posteriormente se determina
presencia de cilindros granulosos en examen general de
orina y proteinuria en rangos no
nefróticos de 1.5 gramos en 24
horas. Debido a lo anterior se
solicita serología encontrando
anticuerpos antinucleares por
inmunofluorescencia 1:320 patrón homogéneo, anti-DNAdc
positivo e hipocomplementemia de C3 y C4. Durante la
evolución de su estancia intrahospitalaria cursa con muerte
súbita por recurrencia de taquicardia ventricular requiriendo
apoyo mecánico ventilatorio y
colocación de DAI con evolución a estancia intrahospitalaria
prolongada y egreso con pronóstico malo debido a la gravedad
de los órganos afectados. Conclusión: a pesar de ser poco
frecuentes se considera a los
síndromes de sobreposición entidades que comparten criterios
de clasificación para una o más
enfermedades reumáticas como
es el caso de esta paciente en
que los datos pivote fueron la
esclerosis grave y la afección
renal asociada a anti-DNAdc.
Miastenia gravis asociada con
lupus eritematoso sistémico.
Reporte de caso
Sofia Mirely García Trejo, A
Ku González, GA Hernández
García, CD Álvarez Esparza, JA
Huebe Rafool
Servicio de Medicina Interna,
Hospital General de Pachuca,
Pachuca de Soto, Hidalgo
Introducción: la miastenia gravis
es la enfermedad más frecuente
de la transmisión neuromuscular. Incidencia anual de 10 a 20
casos por millón de habitantes.
Presentación entre 20 y 30 años.
El signo cardinal es la debilidad fluctuante en el musculo,
afección ocular en un 50% de
los casos, síntomas bulbares en
15%, y 5% presentan afección
unilateral. El diagnóstico se
realiza con cuadro clínico, electromiografía de fibra única, y
anticuerpos AchR. Asociada con
enfermedades autoinmunes en 5
a 30% (tiroiditis de Hashimoto,
AR y enfermedad de Graves
Basedow, en menor proporción
con LES). Descripción: femenina
de 54 años, LES diagnosticado 5
años atrás, tratada con prednisona, y micofenolato; remisión
clínica. Dos meses con ptosis
palpebral, diplopía, disminución
de la fuerza muscular, disfagia
leve; referida a neurología, se
realiza prueba con edrofonio,
(+), inicia piridostigmina, con
mejoría clínica; electromiogra-
fía; disminución en la amplitud.
Diagnostico de miastenia gravis.
Manejo con esteroide y piridostigmina, evolución satisfactoria.
Comentario La miastenia gravis
es una enfermedad con incidencia y prevalencia bajas, Se
reportan casos de asociación
con enfermedades autoinmunes,
como LES. Pueden diagnosticarse simultáneamente ambas
patologías, y menos frecuentemente pacientes con LES
desarrollan miastenia gravis.
Conclusiones: aunque la asociación de LES con mistenia
gravis es baja, deben realizarse
las pruebas diagnosticas ante
síntomas sugestivos de patología
autoinmune asociada.
Aneurisma de arteria esplénica
secundario a pancreatitis crónica: reporte de un caso
Jorge Alejandro Morales Treviño, Hilda Elizabeth Macías
Cervantes
Unidad Médica de Alta Especialidad Bajío, IMSS, León,
Guanajuato
Antecedentes: la arteria esplénica es el tercer sitio más
común de aneurismas intraabdominales, sólo después de la
aorta abdominal y las iliacas.
Su prevalencia es desconocida,
con un estimado desde el 0.2%
hasta el 10.4%. Hay 400 casos
de aneurismas de arteria esplénica reportados en la literatura.
Objetivo: reportar un caso de
aneurisma de arteria esplénica
como forma de presentación
de sangrado intestinal de ori-
S129
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
gen obscuro. Reporte de caso:
masculino de 69 años de edad,
no enfermedades crónico degenerativas, índice tabáquico
de 50 paquetes/año, ingresa
por evacuaciones melénicas,
dolor abdominal en epigastrio
de 4 meses de evolución, intenso, así como hematemesis.
Hemoglobina al ingreso de 4.8
g/dL. Se realizaron diferentes
endoscopias, solo concluyeron
gastritis. TAC abdominal reporta
masa tumoral con degeneración
necrótico hemorrágica probablemente dependiente de
estómago; tránsito intestinal no
descarta presencia de tumor de
páncreas, se valora de nuevo
TAC, la cual reporta una ulcera
gástrica penetrada versus tumoración pancreática con infiltración
gástrica. Estudios de eritrocitos
marcados negativos. Paciente
continuó con evacuaciones
melénicas, se solicitó nueva TAC
abdominal, en donde se reporta
probable pseudoaneurisma posiblemente de arteria esplénica
con ruptura parcial aparente
hacia asa yeyunal con formación de pseudoquiste, se realiza
angiotomografía en la cual se
muestra pseudoareurisma, siendo programado para colocar
stent pero persistió con datos de
choque hipovolémico llegando
a la defunción, sometiéndose a
necropsia en donde se concluye
aneurisma de la arteria esplénica
de aproximadamente 5 cm, con
fistulización y sangrado masivo a
tubo digestivo, determinándose
como causa predisponente una
S130
pancreatitis crónica. Discusión:
casos reportados en la literatura
son pocos; su etiopatogenia es
desconocida, se ha reportado
a la pancreatitis crónica como
un factor predisponente. Hasta
en un 97% son asintomátaicos,
presentando en un 26% sangrado
digestivo, con mortalidad del
90%. El método de elección es
la angiografía y el tratamiento
depende de su localización
y tamaño, las técnicas endovasculares poseen un éxito en
75-85%, no aptas en aneurismas
con tamaños mayores a 2 cm.
Conclusiones: el presente caso
se abordo como un sangrado
intestinal de origen oscuro, obteniendo un diagnóstico probable
mediante la angiotomografía y el
definitivo con necropsia, en donde se determinó una pancreatitis
crónica como la enfermedad
subyacente.
Melanoma vulvar metastásico
a sistema nervioso central.
Reporte de caso
Sofía Mirely García Trejo, A
Ku González, GA Hernández
García, AL Ramírez Mares, CD
Álvarez Esparza, JA Huebe Rafool, E Aguilar Neri
Servicio de Medicina Interna,
Hospital General de Pachuca,
Pachuca de Soto, Hidalgo
Introducción: los melanomas
mucosos tienen incidencia del
1%; el tipo vulvar ocupa el
18%, su incidencia es de 0.1
por cada 100 000, media de
presentación a los 70 años. Los
síntomas son sangrado vaginal, dispareunia, secreción o
tumoración. Existe ulceración,
hipopigmentacion y satelitosis.
Supervivencia de 24 a 50% a
5 años. Presentan metástasis
a SNC en 12 a 20%. Descripción: femenino 50 años,
ingresa con crisis convulsivas
tónico-clónicas. Exploración
neurológica normal; área genital: presencia de neoformación
exofítica en el labio mayor
izquierdo 4x5cm, indurada,
indolora, sintomatología caracterizada por dolor y sangrado
transvaginal de 1 año de evolución. Biopsia de lesión: reporte
histológico de melanoma maligno. Hallazgos tomográficos:
imagen hiperdensa temporal
izquierda, sugiere metástasis.
Discusión: el melanoma mucoso tiene el segundo lugar
en neoplasias de vulva, altas
tasas de mortalidad. Presentan
prurito, sangrado o tumoración. La paciente debuta con
manifestaciones neurológicas,
demostrándose en TAC lesión
de aspecto metastásico. Tumor
vulvar de aspecto maligno;
confirmación histológica de
melanoma maligno. Evolución tórpida, con deterioro
neurológico rostrocaudal 72
h posteriores al ingreso, que
llevó al fallecimiento. Estas
neoplasias tienen gran capacidad de metástasis al SNC;
suelen ser hemorrágicas, presentan convulsiones, cefalea,
debilidad focal, signos de
aumento de la PIC, entre otros.
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Trabajos libres de investigación
Programa de Farmacovigilancia 2013 del Departamento de
Medicina Interna
José Miguel Hinojosa Amaya,
Francisco Gonzalo Rodríguez
García, Sara Gabriela Yeverino
Castro, Dionicio Ángel Galarza
Delgado
Hospital Universitario Dr. José
Eleuterio González, Monterrey,
Nuevo León
Introducción: los errores en la
medicación (EM), y los eventos adversos en la misma, se
presentan con frecuencia en la
práctica médica diaria. En 1994
se estableció que la vigilancia
de los errores en la medicación es un imperativo ético.
Objetivo: vigilar la seguridad
del paciente hospitalizado en
el Departamento de Medicina Interna, identificando los
errores en la medicación para
prevenir y disminuir eventos
adversos y complicaciones.
Esto de acuerdo a la meta
internacional número 3 de la
seguridad del paciente. Material y método: se realiza la
revisión semanal, sistemática
y aleatoria de 20 expedientes
de pacientes internados en la
sala de Medicina Interna, buscando EM, además de recopilar
reportes espontáneos de EM,
analizando después la taxonomía de cada error, factores de
riesgo desencadenantes para
estos y se plantean estrategias
de prevención. Resultados:
entre el año 2007 y el 2010
se revisaron 266 expedientes
de los cuales 187 (70%) tenía
al menos un error en la medicación e identificándose un
total de 599 errores, teniendo
un índice “Errores detectados/
expedientes revisados” de 2.25
errores por expediente. Tras la
implementación de nuestras
medidas de prevención, en el
2013 hemos revisado 628 expedientes, con 180 errores en
la medicación, teniendo una
disminución a 0.28 errores por
expediente, mostrando un descenso progresivo de los errores
en la medicación. Discusión:
Durante los primeros años del
subprograma se encontró que
los expedientes revisados tenían
un promedio de mas de dos
errores por expediente revisado, con una gran incidencia
de eventos adversos e incluso
defunciones de pacientes. Una
vez que se pusieron en marcha
todos los planes de mejora
anteriormente descritos se ha
observado un descenso progresivo de los EM. Conclusiones:
la vigilancia de los errores en
la medicación es un imperativo
ético, en respuesta a la confianza que la sociedad otorga a
todo el personal de la salud. El
trabajo de nuestro subprograma
ha logrado la disminución de
los errores en la medicación
y aún continuamos con una
tendencia a la baja en los EM.
La cintura hipertrigliceridémica como indicador de factores
de riesgo cardiometabólico
Emma Yazmin Mendoza López,
Jaime Carranza Madrigal
Clínica Cardiometabólica, Escuela de Enfermería y Salud
Pública de la Universidad Michoacana de San Nicolás de
Hidalgo, Morelia, Michoacán
Introducción: la combinación de obesidad abdominal
e hipertrigliceridemia (cintura
hipertrgliceridémica) ha sido
considerada como un indicador
clínico de alteraciones metabólicas y cardiovasculares, sin
embargo esto se ha hecho en
poblaciones caucásicas y se ha
relacionado básicamente con
elevaciones del colesterol-LDL.
El objetivo de este estudio es
determinar si la cintura hipertriglicéridemica (CHTG) se asocia
con otros factores de riesgo
cardiometabólico comparada
con obesidad abdominal con
triglicéridos (TG) normales en
nuestros pacientes. Método:
estudio observacional, analítico, retrospectivo de 426 sujetos
con obesidad abdominal (177
hombres, 249 mujeres), de los
cuales 275 tenían TG > 150
mg/dL y 151 < 150 mg/dL. Se
S131
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
registraron edad, peso, talla,
índice de masa corporal, presión arterial, química clínica,
glucemia de ayuno, glucemia
de 2 h postprandial, insulinemia, HOMAr, perfil de lípidos,
índice tobillo/brazo, íntimamedia carotidea y función
endotelial por vasodilatación
dependiente de flujo. Se realizó
estadística descriptiva, t de Student, c2 y razón de momios con
intervalo de confianza del 95%
con valores de p < 0.05 como
indicador de significancia.
Resultados: los pacientes con
CHTG tuvieron promedios mayores de peso, PAD, colesterol
total, colesterol LDL, insulina,
glucosa en ayuno y glucosa
postprandial, superiores a los
normotrigliceridémicos (NTG);
pero tuvieron promedios de
índice tobillo/brazo, colesterol
HDL y creatinina menores que
los NTg. Además en la CHTG
hubo porcentajes mayores
de hipertensión diastólica,
hipercolesterolemia, disglucemia en ayuno e intolerancia
a la glucosa que los NTG;
pero porcentajes menores en
hipoalfalipoproteinemía e insuficiencia arterial periférica.
La CHTG mostró mayor probabilidad de asociarse con
hipercolesterolemia y disglucemia de ayuno. Conclusiones:
la CHTG es buen indicador de
alteraciones del metabolismo
de la glucemia, de la PA y de
hipercolesterolemia pero no de
alteraciones vasculares ni de
descenso de C-HDL en nuestro
medio.
S132
Hallazgos electrocardiográficos en pacientes con diabetes
mellitus tipo 2 sin cardiopatías
previas atendidos en el Servicio
de Hospitalización de Medicina Interna del Hospital General
Dr. Manuel Gea González a un
año de seguimiento
Iván Darío Hernández Erazo,
Eduardo Wilfredo Goicoechea
Turcott, Itzel Lazcano Romano,
Rosa Elena González Pimienta,
Jazmín Teresa Pozos López
Servicio de Medicina Interna,
Hospital General Dr. Manuel
Gea González, México, DF
Se ha planteado la hipótesis de
que los pacientes con DM tipo
2 asintomáticos y sin cardiopatía previa, con factores de riesgo
cardiovascular que presenten
un ECG normal, este no podría
predecir los eventos cardiovasculares a mediano plazo.
Objetivo: describir cuales son
los hallazgos electrocardiográficos encontrados en pacientes
con DM tipo 2 sin enfermedad
cardiovascular (ECV) conocida
a su ingreso en el servicio de
hospitalización y a un año de
seguimiento en la consulta
externa o reingreso por enfermedad cardiovascular en el
servicio de medicina interna
del Hospital General Dr. Manuel Gea González. Material y
métodos: se analizaron 320 expedientes de pacientes con DM
tipo 2 sin presencia o antecedentes de cardiopatía conocida
y que tuvieron en su expediente
consignado el ECG al momento
de su ingreso a hospitalización
y al menos otro ECG al año
de seguimiento por consulta
externa. Posteriormente se
analizaron y describieron las
variables categóricas mediante
porcentajes o proporciones, las
variables numéricas mediante
promedio (media) ± desviación
estándar. Se analizaron las variables utilizando T de Student
para muestras independientes.
Resultados: se incluyeron 69
pacientes, donde se encontraron alteraciones en el ECG al
ingreso en hospitalización en
35 pacientes (50.7%), de estos,
8 pacientes (22.9%) tuvieron
ECV a un año de seguimiento.
De los 34 pacientes que no presentaron alteraciones del ECG,
10 pacientes (29.4%) tuvieron
ECV a un año de seguimiento.
En el servicio de consulta externa se encontraron cambios ECG
en 51 pacientes a un año de
seguimiento (73.9%), de estos
17 pacientes (33.3%) tuvieron
ECV. La hipertrofia ventricular
derecha e izquierda, cambios
en el segmento ST y la taquicardia sinusal, constituyeron
el 68.5% de las alteraciones
identificadas al ingreso. Al año
de seguimiento por consulta
externa, cambios en el segmento ST y la presencia de onda
Q patológica, constituyeron
el 82.3% de las alteraciones
identificadas. Se produjeron 20
ECV en 18 pacientes (26%). El
infarto agudo de miocardio y
la insuficiencia cardiaca, constituyeron el 83.3% del total de
ECV presentados. Conclusión:
las alteraciones electrocar-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
diográficas más frecuentes en
pacientes con DM tipo 2 sin
ECV conocida a su ingreso en
el servicio de hospitalización
y a un año de seguimiento en
la consulta externa o reingreso
por ECV son la hipertrofia ventricular derecha e izquierda,
cambios en el segmento ST y
la taquicardia sinusal.
Metaloproteasas: su influencia
en el desarrollo de ateroesclerosis coronaria
Carlos Amir Carmona González,1 Nashla Hamdan Pérez,1
Carmen Zavala García,2 Paula
María del Carmen Figueroa
Arredondo, 3 Patricia Soto
Márquez, 4 Guillermo Valero
Elizondo,4 Víctor Gabriel Hernández Chávez, 4 Citlaltepetl
Salinas Lara5
1
Residente de Medicina Interna
2
Departamento de Medicina
Interna
Fundación Clínica Médica Sur,
México, DF
3
Laboratorio de Microbiología
Molecular, Instituto Politécnico
Nacional, México, DF
4
Departamento de Patología,
Hospital de Cardiología del CMN
Siglo XXI, IMSS, México, DF
Introducción: la cardiopatía
isquémica es originada por un
proceso vascular, inflamatorio
crónico, conocido como aterosclerosis, en el desarrollo
del proceso, están implicados
la infiltración de células inflamatorias, musculares, la capa
intima arterial y el acumulo
de componentes de matriz
extracelular. La evolución y
modificación de la placa de ateroma requiere remodelación y
degradación de la matriz extracelular la cual es realizada por
las metaloproteasas de matriz
(MMP’s) quienes a su vez internalizan lípidos y predisponen la
formación de placas ateroscleróticas. Objetivo: correlacionar
la expresión de las MMP’s 1, 9 y
10 de su inhibidor TIMP-1 con
la progresión clínico-patológica
de la aterosclerosis coronaria.
Métodos: Se obtuvieron las
características clínicas del expediente, así como los bloques
de parafina que contenían
tejido de arterias coronarias
provenientes de necropsias, las
cuales se clasificaron acorde a
la American Heart Association
y la Organización Mundial de
la Salud, se realizaron inmunohistoquímicas por triplicado
para determinar la expresión
de MMP’s 1,9,y 10 y del TIMP1, y se midió la expresión de
cada MMP’s con el software
NIS-Elements de Nikon, se
analizaron los resultados con
SPSS versión 19 realizando
la correlación de resultados
clínicos, patológicos e inmunohistoquímicos. Resultados:
se encontró que la expresión
de MMP-9, aumentaba progresivamente, directamente y de
manera significativa conforme
a la gravedad de la lesión ateroesclerótica (p=0.001). Por el
contrario las MMP-1 (p=0.69) y
MMP-10 (p=0.58), no correlacionaron con la gravedad de la
lesión histopatológica, el TIMP-
1 presento mayor expresión que
correlaciono con las MMP-1
(p=0.03) y MMP-10 (p=0.01)
pero no con la MMP-9 (p=0.58)
lo que indica que entre las
metaloproteasas existe un fenómeno de regulación diferente, y
que la MMP-9 se encuentra directamente relacionada con la
evolución del ateroma. Conclusiones: en distintos estudios se
ha demostrado la participación
de algunas metaloproteasas en
el proceso aterogénico, sin embargo las investigaciones se han
centrado en la etapa de desestabilización de la placa y no en su
proceso de formación. Dados
los resultados encontrados la
MMP-9 podría ser considerada
como un marcador potencial
de daño vascular que correlacionaría con el daño presente
a nivel coronario, lo que con
la realización de más estudios
podría permitir evaluar riesgos
y tomar decisiones terapéuticas.
Evaluación de función endotelial en tromboembolismo
pulmonar agudo experimental
A Pacheco Cantú, MA Benavides González, JL Ramos
Martínez, NO Herrera Elizondo, A Niderhauser García, DA
Galarza Delgado
Hospital Universitario y Facultad de Medicina, José Eleuterio
González, UANL, Monterrey,
Nuevo León
I n t r o d u cc i ó n : e l t r o m b o
embolismo pulmonar agudo experimental representa la tercera
causa de muerte cardiovascular
S133
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
solo después de la cardiopatía
isquémica y la EVC; comparten
factores de riesgo en común
edad. Presentando una vía final común de daño endotelial,
inflamación y estado de hipercoagulable. Objetivo: evaluar
la asociación entre trombo
embolismo pulmonar agudo y
disfunción endotelial. Material
y métodos: se utilizó una población de 7 perros mestizos con
acondicionamiento previo de 7
a 10 días. Se realizó sedación en
base a fenobarbital procediendo a intubación y ventilación
mecánica se realizaron electrocardiogramas y ecocardiograma
TT basal así como medición de
función endotelial basal mediante la técnica descrita por
Correti en la arteria femoral.
Se procedió a canalización
de vena femoral por técnica
de Seldinger modificada y colocación de introductor 7FR,
recolectando 5 cc de sangre
permitiendo la formación del
coágulo. Se realiza corte de
coágulo y embolización. Se
midió función endotelial posterior a trombo embolismo
experimental. Posteriormente se
realizó sacrificio del espécimen
realizando estudio patológico.
Estadística. Se realizó prueba de Kolmogorov-Smirnof y
Shapiro Will demostrando distribución normal de los datos.
La prueba de t de Student para
valorar diferencias entre mediciones considerando p<0.05
como significativo. Resultados
y Conclusión: se encontró una
distribución normal encontran-
S134
do diferencia en la medición
de función endotelial pre y pos
trombo embolismo pulmonar
con una media de 0.012286 cm
con un intervalo de confianza
95 de (-.014164-0.038735) con
un valor de p .299. Se demostró
y describió trombo embolismo
pulmonar en cada espécimen
con micro trombos así como
congestión vascular. Los resultados obtenidos no mostraron
cambios significativos en la
función endotelial.
Evaluación diagnóstica del
paciente con dolor torácico no
traumático en el servicio de
urgencias
Henoc Malcampo Mendoza,
Edgar Dehesa López, Alberto
Quintero Pérez, Carlos Alberto
Kawano Soto, Sergio Irizar Santana, Edgar Dehesa López
Departamento de Medicina
Interna, Hospital Civil de Culiacán, Centro de Investigación
y Docencia en Ciencias de la
Salud (CIDOCS), Universidad
Autónoma de Sinaloa
Introducción: la evaluación del
paciente con dolor torácico no
traumático (DTNT) constituye
un reto diagnóstico en el servicio de urgencias. Su abordaje
diagnóstico correcto permite
establecer la causa específica y
tratamiento oportuno. Objetivo:
describir las causas y características epidemiológicas, clínicas,
de laboratorio y gabinete de
los pacientes con DTNT. Metodología: estudio transversal.
Se estudiaron 93 pacientes
consecutivos con DTNT en el
servicio de urgencias. Se recabaron características clínicas
del dolor, electrocardiográficas,
radiográficas, de laboratorio y
perfil cardiopulmonar (BNP y
TropI) para determinar la causa
específica. Resultados: la edad
fue de 63 ± 17 años y 52%
del sexo femenino. En 67.7%
(n=63) el DTNT se debió a síndrome coronario agudo (SICA).
De estos, 31.7% fueron anginas
inestables, 31.7% IAMSEST y
36.6% fueron IAMEST. En el
32.3% (n=30) el DTNT se debió
a una causa diferente al SICA:
insuficiencia cardiaca (53.3%),
infección de vías respiratorias
(20%), taquicardia supraventricular (16.6%), pericarditis
(3.3%) y otras (6.6%). Los pacientes con DTNT por SICA
refirieron más frecuentemente
la localización precordial (98.4
vs 53.3%; p=0.01), mayor intensidad (58.7 vs 6.9%; p=0.01)
e irradiación hacia el brazo
izquierdo (64 vs 34%; p=0.01)
del dolor; en comparación
con pacientes con DTNT no
SICA. La DM2 (38.1 vs 16.7%;
p=0.01) y el diagnóstico previo
de SICA (23.8 vs 3.3%; p=0.01)
fueron más frecuente en los pacientes con DTNT por SICA. Los
pacientes con DTNT por SICA
tuvieron más frecuentemente
una elevación del segmento ST
(41.3 vs 3.3%; p=0.01), infradesnivel del segmento ST (22.2
vs 3.3%; p=0.01) e inversión de
la onda T (30.2 vs 0%; p=0.01);
en comparación con los pacientes con DTNT no SICA.
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
La localización precordial del
dolor (sensibilidad del 98%) y la
intensidad grave del dolor (sensibilidad 92%) fueron los datos
clínicos más sensibles para el
diagnóstico de DTNT por SICA.
El diagnóstico previo de SICA
presentó una especificidad del
97% y un VPP del 94% para el
diagnóstico de DTNT por SICA.
Los datos de isquemia cardiaca
en el electrocardiograma presentaron la mayor sensibilidad
(94%), especificidad (93%) y
valor predictivo positivo (97%)
para el diagnóstico de DTNT
por SICA. Conclusiones: la causa más frecuente de DTNT fue
el SICA. La semiología del dolor
torácico y los hallazgos electrocardiográficos constituyen una
herramienta útil en forma inicial
en el abordaje diagnóstico del
DTNT por SICA.
Alteraciones electrocardiográficas en pacientes con
traumatismo craneoencefálico
severo y su impacto en la mortalidad
Lorena González Rosas, David
Añorve Clavel, Carlos Armando
Orbe Cabrera, José Legorreta
Soberanis, Maritza Carolina
Hernández Guerrero
Unidad de Cuidados Intensivos
Adultos, Hospital General Acapulco, Acapulco, Guerrero
Introducción: el traumatismo
craneoencefálico es un problema grave de Salud Pública que
contribuye de manera importante al número de muertes y
discapacidad permanente en
jóvenes en edad productiva.
Objetivos: Identificar alteraciones electrocardiográficas en
pacientes con Traumatismo craneoencefálico severo y buscar
su impacto en la mortalidad.
Material y métodos: se realizó
un estudio, transversal, descriptivo del 1 de marzo 2013 al 20
abril 2014 donde se estudiaron
pacientes con traumatismo
craneoencefálico severo que
ingresaron a la Unidad de
Terapia Intensiva Adultos del
Hospital General Acapulco. Se
realizó electrocardiograma en
las primeras 24 y 72 horas del
evento traumático y se buscaran
alteraciones del ritmo cardiaco, segmento ST, intervalo QT
y la Onda T. Se excluyeron
pacientes con enfermedad cardiovascular previa, pacientes
con alteraciones electrolíticas
al ingreso y politraumatizados
complejos. Resultados: se analizaron 26 pacientes, predomino
el género masculino, el promedio de edad fue de 42.3 años,
rango 18-102 años (DE 21.4),
moda 18 años de edad. En el
mecanismo del traumatismo
craneoencefálico severo encontramos que el primer lugar
lo ocuparon, los golpes contusos, pues se presentó en 15
pacientes, seguido de accidente
automovilístico en 7 pacientes
y herida penetrante por arma
de fuego en 4. Las anormalidades electrocardiográficas más
comúnmente encontradas fueron la alternancia taquicardia/
bradicardia en 13 pacientes,
intervalo QTc prolongado en
9 pacientes, la alteración en la
onda T se presentó en 7 pacientes y la alteración del segmento
ST en 2 pacientes. Veintiún
pacientes pertenecían al género
masculino, quince se egresaron
por mejoría y hubo seis defunciones, de los cinco pacientes
del género femenino, 4 egresaron por mejoría, y hubo una
defunción. Conclusiones: los
cambios electrocardiográficos
son alteraciones frecuentemente encontradas en pacientes con
traumatismo craneoencefálico
severo, las comúnmente encontradas fueron las alteraciones en
la repolarización, secundaria a
aturdimiento miocárdico neurogénico.
Factores relacionados con
tiempo de retraso en la terapia
de reperfusión en pacientes
con infarto agudo de miocardio
con elevación del segmento ST
en un hospital de tercer nivel
César Leonardo González
Aguilar, Manuel Alfonso Baños
González, Orlando Luis Henne
Otero, Manuel Eduardo Torres
Hernández, Alfonso Baños
García, José C Ruiz Soto, Efrén
Rodríguez Hernández, José
Antonio Gómez Garibay
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Servicio de Cardiología, Villahermosa, Tabasco
Introducción: el infarto agudo de miocardio involucra la
oclusión trombótica total de
la arteria responsable, lo cual
está asociado con arritmias,
S135
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
insuficiencia cardiaca y muerte.
El tratamiento de reperfusión
en las primeras 12 horas de
evolución mediante trombolisis o angioplastia coronaria
primaria limita la extensión
del daño miocárdico y mejora
el pronóstico de estos pacientes. Es de suma importancia
conocer las causas por las
cuales los pacientes acuden
tardíamente a atención médica especializada. El objetivo
del estudio fue determinar los
factores que intervienen en el
retraso prehospitalario en pacientes que ingresan al Hospital
Regional de Alta Especialidad
Dr. Juan Graham Casasús con
diagnóstico de infarto agudo
de miocardio con elevación
del segmento ST. Pacientes
y Métodos: se realizó un estudio transversal descriptivo
en pacientes que ingresaron
a la unidad coronaria con
diagnóstico de infarto agudo
de miocardio con elevación
del segmento ST. En todos los
pacientes que no recibieron
terapia de reperfusión se determino el motivo. Los datos
fueron analizados mediante
estadística descriptiva. Resultados: del 15 de noviembre de
2012 al 15 de junio del 2014
se incluyeron 128 pacientes
con infarto de miocardio con
elevación del segmento ST,
los cuales 108 (84.4%) fueron
hombres. La edad promedio de
presentación de infarto fue de
60 ± 11.6 años. El 54.2% de
los pacientes fueron referidos
de otro hospital. La mediana
S136
de tiempo desde el inicio de
los síntomas de infarto hasta el
ingreso hospitalario fue de 12
horas con rangos de 32 minutos
hasta 289 horas. El 50.8% (65
pacientes) acudieron al hospital
dentro de las primeras 12 horas
de inicio de los síntomas. Solo
el 36.7% de los paciente recibieron terapia de reperfusión
(trombolisis o angioplastia). De
los 43 pacientes trombolizados,
el 86% recibió estreptoquinasa,
y 4 pacientes fueron sometidos a angioplastia primaria
(3.1%). Los principales motivo
de retraso en los pacientes que
acudieron después de 12 horas
fue retraso por cuestión médica
prehospitalaria en el 21.1% y
desconocimiento de síntomas
en 18.8%. Conclusiones: el
retraso en la atención médica
prehospitalaria es el principal
factor relacionado con el retraso en la terapia de reperfusión.
Prevalencia de hipertensión
arterial en el paciente sin diagnóstico previo en un hospital de
segundo nivel de Nuevo León
Sandra Galindo Alvarado, Luis F
Pérez García, Dionicio Galarza
Delgado, Miguel A Villarreal
Alarcón, Claudia Lara, Luis A
Morales Garza, María T Sánchez
Medicina Interna, Hospital
General Virginia Ayala, Secretaría de Salud de Nuevo León,
Sabinas Hidalgo, Nuevo León
Introducción: en México la hipertensión arterial es una de las
enfermedades mas prevalentes
afectando aproximadamente
30 millones de mexicanos que
representan un 30% de la población. Se estima que 1 de cada
14 adultos tiene cifras de presión arterial sistólica mayores a
140 mmHg y diastólicas mayores de 90 mmHg y nunca se les
ha realizado el diagnóstico de
hipertensión arterial (HTA) por
su medico o personal de salud.
La mayoría de los pacientes
hipertensos sin diagnostico
son usuarios habituales de los
servicios de salud. Una de las
mayores dificultades que se
enfrenta el médico para hacer
el diagnóstico de HTA es la
variabilidad entre las mediciones ambulatorias y en el medio
hospitalario. El reconocimiento de la hipertensión arterial
en el medio hospitalario y su
adecuado seguimiento es de
vital importancia para nuestro
sistema de salud. Material y métodos: n este estudio se pretende
determinar, de manera retrospectiva, la prevalencia de HTA
en pacientes sin antecedentes
de HTA y estimar la proporción de pacientes en quienes
se consideró el diagnóstico de
HTA durante o al final de su internamiento. Se analizaron 356
expedientes que representan el
total de egresos en el periodo
de mayo-agosto 2014. Del total
de pacientes 248 (69.7%) no
tenían antecedente de HTA. Al
ingreso 28 (11.2%) presentaron
cifras de presión arterial sistólica
(PAS) mayor a 140 mmHg y 24
(9.7%) cifras de presión arterial
diastólica (PAD) mayores a 90
mmHg. Se identificaron 68
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
(19.10%) pacientes con mas
de tres cifras >140/90 mmHg.
A su egreso, solamente a 4
(5.88%) pacientes se les indico
seguimiento de cifras de presión
arterial por primer o segundo
nivel ambulatorio, en contraste,
64 (94.11%) no recibieron adecuada educación y seguimiento
sobre sus cifras de hipertensión arterial. Comentarios y
Conclusiones: este estudio demuestra que un porcentaje alto
de pacientes hospitalizados sin
antecedente de HTA presentan
cifras elevadas de TA durante
su internamiento y que de ellos
un porcentaje muy alto no
son adecuadamente referidos
para seguimiento y diagnóstico temprano de HTA. Estos
pacientes permanecen asintomáticos durante largo tiempo
y se diagnostican tardíamente,
usualmente con complicaciones
crónicas de la enfermedad.
Correlación de hipocalemia
con crisis hipertensiva
Andrés Ledesma Velázquez,
Fidel Cerda Téllez, Leticia Rodríguez López
Medicina Interna, Hospital General Xoco, Secretaría de Salud
del Distrito Federal, México, DF
Medicina Interna, Hospital
General de Ticomán, Secretaría
de Salud del Distrito Federal,
México, DF
Introducción: la hipocalemia
se ha relacionado en estudios
poblaciones con mayor prevalencia de hipertensión arterial.
La depleción de potasio causa
modesto incremento de la tensión arterial en 5 a 10 mmHg
aumenta la actividad del eje
renina-angiotensina-aldosterona, y consecuentemente del
volumen intravascular. También
se ha demostrado una mayor
sensibilidad a los vasoconstrictores endógenos. Se ha
demostrado el efecto antihipertensivo del potasio a través
de la natriuresis, mejorando
las cifras de tensión arterial. La
administración de potasio presenta efecto simpaticolítico. Por
lo que se podría relacionar la
presencia de hipocalemia con
descontrol de la tensión arterial,
llegando a favorecer incluso la
presencia de crisis hipertensiva.
Objetivo: determinar la posible
asociación entre la tensión
arterial en crisis hipertensiva y
la presencia de hipocalemia.
Hipótesis: la hipocalemia se
asocia de manera estadísticamente significativa con crisis
hipertensiva en comparación
con pacientes sin hipocalemia.
Diseño del estudio: Descriptivo,
observacional, transversal y
retrospectivo. Material y métodos: se tomaron datos de los
expedientes de pacientes que
ingresaran a los Hospitales Generales de Ticomán y Xoco con
el diagnostico de crisis hipertensiva, se tomaron al ingreso
niveles de electrolitos séricos,
tensión arterial, química sanguínea y daño a órgano blanco.
Análisis estadístico: se realizó
c2 para determinar la asociación de hipocalemia y crisis
hipertensiva. Para confirmarla
se calculó la razón de momios.
Correlación del nivel sérico de
K con la TAM mediante el coeficiente de Pearson. Resultados:
el estudio incluyo 58 pacientes,
56.9% hombres y 43.1% mujeres. Edad promedio 58.5±16.01
años. Potasio sérico con media
3.6±0.4 mEq/L, valor mínimo
de 2.5 y máximo 4.7. El promedio de TAM fue 115.5±26.4
mmHg. Se evaluó la posible
asociación entre hipocalemia
y crisis hipertensiva, utilizando
X2 con un valor de 19.07 y p
< .001. Se calculó la Razón de
momios resultando OR = 35.30
(95% IC 4.2 , 294.9). Comentarios y Conclusiones: nuestro
estudio indica la relevancia
de k para el control de HAS y
prevención de complicaciones.
Demostrando asociación estadísticamente significativa entre
hipocalemia y crisis hipertensiva. El resultado del OR indica
que la hipocalemia confiere un
riesgo 35 veces mayor de crisis
hipertensiva comparado con los
pacientes sin esta.
Frecuencia de eventos trombóticos recurrentes y su relación
con la baja respuesta a tienopiridinas en pacientes sometidos
a coronariografía
Paola Denise Elizalde Hernández,1 Beatriz Calderón Cruz,2
Diana Jhoseline Medina Leyte,2
Astrid Sobrevilla Zarazua,2 José
Juan Lozano Nuevo, 1 Marco
Antonio Peña Duque,3 Gilberto
Vargas Alarcón,3 José Manuel
Fragoso,3 Marco Antonio Martínez Ríos,3 Aurora
S137
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Servicio de Medicina Interna,
Hospital General Ticomán,
México, DF
2
Departamento de Farmacología, Facultad de Medicina,
UNAM, México, DF
3
Instituto Nacional de Cardiología Ignacio Chávez, México, DF
1
Introducción: las tienopiridinas (clopidogrel y prasugrel),
son profármacos que se unen
irreversiblemente al receptor
P2Y12 del ADP inhibiendo
la agregación plaquetaria. La
baja respuesta a tienopiridinas
es un fenómeno multifactorial
caracterizado por la hiperactividad plaquetaria mediado
por el receptor de ADP. La baja
respuesta a tienopiridinas se ha
relacionado con eventos trombóticos recurrentes. Objetivo:
identificar la relación entre la
baja respuesta a tienopiridinas y los eventos trombóticos
recurrentes en pacientes con enfermedad isquémica coronaria.
Métodos: se incluyeron un total
de 400 pacientes sometidos a
coronariografía. Para establecer
la baja respuesta a tienopiridinas se realizó una prueba de
agregación plaquetaria con ADP
10 µM. Se siguieron durante dos
años para determinar eventos
tromboticos recurrentes considerando como tales: Infarto
de miocardio, infarto cerebral,
trombosis del stent, isquemia
silente (definida por estudio de
medicina nuclear) y muerte por
causa cardiaca. Resultados: 101
pacientes se perdieron durante
el seguimiento. Encontramos
S138
que el 25% mostraron baja
respuesta a tienopiridinas y el
13% desarrollaron un evento
trombótico recurrente. El 20%
de los eventos trombóticos
recurrentes correspondieron a
isquemia silente, misma que se
asoció directamente con la baja
respuesta a clopidogrel (Prueba
exacta de Fisher p=0.031). Se
realizó una regresión de Cox
para determinar el riesgo de
un evento trombótico recurrente, observando que la baja
respuesta a clopidogrel y la
hipertensión tienen un riesgo
de 11 y 35 (p=0.02 y p=0.01)
respectivamente. Conclusión:
la baja respuesta a clopidogrel
esta relacionada con eventos
trombóticos recurrentes especialmente con la isquemia
silente que predispone a nuevos
eventos miocárdicos agudos. La
vigilancia de esa variable podría
mejorar el pronóstico de los
pacientes. Sugerimos el estudio
de medicina nuclear, definida
en este trabajo como isquemia
silente, como una variable a
evaluar en estudios posteriores.
Proyecto apoyado por DGAPA
PAPIIT 221112
Efecto de linagliptina sobre
sensibilidad a la insulina en
prediabetes
DM Hernández Corona, M
González Ortiz, T González
Heredia, E Martínez Abundis
Instituto de Terapéutica Experimental y Clínica, Centro
Universitario de Ciencias de la
Salud, Universidad de Guadalajara, Jalisco
Introducción: intolerancia a
la glucosa es una forma de
prediabetes, donde sensibilidad a la insulina y secreción
de insulina juegan un papel
importante. Metformina es el
medicamento de primera línea
para los pacientes con prediabetes. Linagliptina, inhibidor de
la enzima DPP-4 que disminuye
la glucosa posprandial y podría revertir el progreso de la
enfermedad. Objetivo: evaluar
el efecto de linagliptina vs metformina sobre sensibilidad a la
insulina y secreción de insulina
en pacientes con intolerancia a
la glucosa. Sujetos y métodos:
Ensayo clínico, doble ciego
con asignación al azar y grupos
paralelos. Ocho pacientes recibieron 500 mg de metformina
en desayuno y cena, otros ocho
pacientes recibieron 500 mg de
placebo en desayuno y 5 mg de
linagliptina en cena durante 90
días. La sensibilidad a la insulina se midió con el índice de
Matsuda, la secreción de insulina con el índice insulinogénico,
la primera fase de secreción de
insulina con el índice de Stumvoll. Se realizó una curva de
tolerancia oral a la glucosa, con
una carga de 75 g de dextrosa.
Se tomó una prueba de glucosa
e insulina al minuto 0, 30, 60,
90 y 120. El análisis estadístico
se evaluó con U de MannWhitney y Wilcoxon con una
p significativa 0.05. Resultados:
no existió diferencia significativa en las mediciones basales
entre ambos grupos. En el grupo
de linagliptina se observó una
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
disminución en la glucosa al
minuto 90 (194.6 46.6 vs 142.1
39.3 mg/dL; p 0.05), al minuto
120 (158.0 16.1 vs 116.4 37.1
mg/dL; p<0.05) y en el área bajo
la curva (21039 3782 vs 17169
3724 mg/dL; p 0.05. En el grupo
de metformina se observó una
disminución significativa de
insulina al minuto 0 (15.8 4.3
vs 12.3 4.1 UI/mL; p 0.05). No
se encontró modificación en la
sensibilidad a la insulina ni en la
secreción de insulina en ninguno de los dos grupos. Se reportó
dolor abdominal y diarrea en el
grupo de metformina; edema,
poliuria, cansancio y apetito en
el grupo de linagliptina. Conclusiones: la administración de
linagliptina durante tres meses,
en pacientes con intolerancia a
la glucosa, redujo la glucosa al
minuto 90, 120 y el área bajo la
curva. En el grupo de metformina se observó una disminución
significativa en la insulina al
minuto 0.
Efecto de la metformina en
pacientes no diabéticos, con
disglucemia de ayuno con y sin
resistencia a la insulina
Jaime Carranza Madrigal, Sonia
López Correa, Luz María Castro
Reyes
Clínica Cardiometabólica de
la Universidad Michoacana de
San Nicolás de Hidalgo, Morelia, Michoacán
Introducción: la metformina
es eficaz en prevenir diabetes
en sujetos con intolerancia a la
glucosa, pero no se ha explora-
do sus beneficios en pacientes
solo con disglucemia de ayuno,
con y sin resistencia a la insulina. Objetivo: determinar si la
metformina ofrece beneficios
en pacientes no diabéticos,
con disglucemia, divididos en
resistentes (RI) y no resistentes
(NO RI) a la insulina. Métodos:
estudio experimental, prospectivo, abierto, en 87 pacientes
con disglucemia, 48 hombres
y 57 mujeres, 87 con RI y 18
NO RI, que recibieron 1 g
de metformina diaria por un
año. Se midieron IMC, cintura, glucemia en ayuno (GA) y
postprandial (GPP), insulina,
HOMA, perfil de lípidos, química clínica, microalbuminuria
(MA), índice tobillo/brazo (I
T/B), íntima-media carotídea
y función endotelial mediante
vasodilatación dependiente
de flujo (VDF). Se realizó t de
Student para comparar promedios de variables numéricas
contínuas, c2 para las variables
categóricas y razón de momios
(RM) para calcular probabilidad
de asociación entre RI y NO
RI con las variables medidas,
se consideraron significativos
valores de p < 0.05. Resultados:
los pacientes con RI tuvieron
de entrada valores mayores de
cintura y HOMA y menores
de C-HDL y GA. Al cabo de
un año ambos grupos tuvieron reducciones significativas
en los valores de peso, IMC,
cintura, PAS, colesterol total
(CT), triglicéridos (TG), C-LDL
y ácido úrico; los que tenían
RI mejoraron los promedios de
PAD, HOMA e Insulina, no así
los NO RI. Los descensos en
cintura y HOMA fueron significativamente mayores en los
pacientes con RI respecto a los
NO RI. Conclusiones: la metformina puede ser de utilidad
para tratar a los pacientes con
disglucemia de ayuno tengan
o no RI.
Polimorfismos asociados a diabetes mellitus tipo 2 de inicio
temprano en el noreste del país
Roberto Monreal Robles, Hugo
L Gallardo Blanco, Fernando
Lavalle González, Ricardo Cerda Flores, Pavel Carillo Molina,
Minerva G Martínez Cavazos,
Laura E Martínez Garza, Dionicio Galarza Delgado, Jesús Z
Villarreal Pérez
Servicio de Endocrinología,
Departamento de Medicina
Interna, Hospital Universitario
Dr. José Eleuterio González,
Universidad Autónoma de Nuevo León, Monterrey, NL
Introducción: actualmente
el número de individuos con
diabetes mellitus tipo 2 (DMT2)
está en aumento, esto representa un serio problema de salud
pública debido a la incapacidad
y muerte prematura que esta
ocasiona. La DMT2 es la principal causa de muerte en nuestro
país. Se estima que para el año
2025 habrá 11.7 millones de
mexicanos con esta condición. Se ha establecido que el
riesgo de padecer DMT2 está
determinado por factores no
solo ambientales sino también
S139
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
genéticos. Sin embargo, existen
diferencias importantes en la
prevalencia de la enfermedad
entre distintos grupos étnicos
lo cual parece depender de
factores genéticos. Hasta el momento se han identificado cerca
de 40 polimorfismos (SNP’s)
asociados a DMT2 principalmente en población Europea.
El objetivo de nuestro estudio es
el identificar los polimorfismos
asociados a DMT2 en nuestra
población. Métodos: estudiamos 128 SNP’s en 42 genes, los
cuales en su mayoría han sido
replicados en otras poblaciones. Se llevo a cabo un estudio
de casos y controles en el cual
se incluyeron 186 controles,
211 individuos con DMT2 de
inicio temprano (diagnostico
antes de los 45 años) y 173
individuos con DMT2 de inicio
tardío. Al momento reportamos
los resultados preliminares de
256 individuos. Resultados:
los individuos con DMT2 independientemente de su edad
al diagnostico tienen un índice
de masa corporal mayor que los
controles (27.5 vs 25.7 kg/m2,
P >0.0001). La mediana para
la edad de los individuos con
DMT2 de inicio temprano, inicio tardío y controles fue 46, 61
y 62 años respectivamente. La
edad al diagnóstico en aquellos
con DMT2 de inicio temprano
y tardío fue de 35 y 52 años
respectivamente. Las variante
alélicas de los genes KCNJ11
(rs5219), LEPR (rs11208654),
IGF2BP2 (rs4402960), VLDLR (rs2242103), KCNQ1
S140
(rs2237892), RPTOR
(rs12946115), SLC25A18
(rs1296819) se asociaron significativamente con DMT2 en
este reporte preliminar. Estos
polimorfismos mencionados
intervienen directa o indirectamente sobre la secreción y
sensibilidad periférica de la
insulina. Conclusiones: nuestra
población posee una importante predisposición genética
para DMT2. Los polimorfismos
asociados en nuestra población
apoyan la hipótesis de que los
defectos en la liberación y resistencia periférica a la insulina
son los principales mecanismos
predisponentes a DMT2 en la
población mexicana.
Depresión y diabetes: ¿existe
una asociación?
Jaime Carranza Madrigal, Sonia
López Correa, Jesús Alveano
Hernández
Clínica Cardiometabólica de
la Universidad Michoacana de
San Nicolás de Hidalgo, Morelia, Michoacán
Introducción: se ha encontrado
una elevada frecuencia de depresión en la diabetes mellitus,
explicada como una respuesta
ante la enfermedad o bien por
nexos fisopatogénicos comunes como son la liberación de
citoquinas pro-inflamatorias y
cortisol. Sin embargo no conocemos si en nuestro medio
la frecuencia de la asociación
es mayor en los diabéticos
comparados con otros enfermos
cardiometabólicos. Objetivo:
determinar si los pacientes con
diabetes mellitus tienen una
mayor prevalencia de depresión
y otras alteraciones cardiometabólicas comparados con
otros pacientes no diabéticos.
Métodos: estudio observacional, analítico, retrospectivo, de
198 pacientes que acudieron a
una clínica cardiometabólica
durante un año. Se registraron
edad, peso, IMC, cintura, química clínica, perfil de lípidos,
HOMAr, HOMAb, función
endotelial, íntima-media carotidea y depresión por medio
del inventario de Beck. Se realizaron prueba de t de Student,
c2 y razón de momios con intervalo de confianza del 95%,
se consideraron significativos
los valores de P < 0.05. Resultados: los pacientes con DM
(54) tuvieron valores de edad,
peso, IMC, cintura, glucemia
insulina, HOMAr, y triglicéridos (TG); no hubo diferencias
en el puntaje del inventario de
BECK ni en HOMAb. Los diabéticos tuvieron una frecuencia
mayor de mujeres, obesidad,
disglucemia, resistencia a la
insulina (RI), hipertrigliceridemia, hipoalfalipoproteinemia,
hipertensión y disfunción endotelial. No hubo diferencias en
depresión vs los no diabéticos
(134): 61.1% y 59.4% respectivamente. Los no diabéticos
tuvieron proporciones mayores
de hipercolesterolemia tanto
por colesterol total (CT), C-LDL
y C-NO HDL. La probabilidad
de disglucemia, RI y obesidad
fueron significativamente ma-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
yores en los diabéticos, pero
no la depresión. Conclusiones:
la depresión es muy frecuente
en nuestros diabéticos pero
tambien lo es en otros pacientes
con alteraciones cardiometabólicas previas al desarrollo
de la diabetes mellitus y debe
buscarse intencionadamente en
todos estos enfermos.
Factores de riesgo y prevalencia
de osteoporosis (OP) y masa
ósea baja (MOB) en el Hospital
Ángeles del Pedregal (HAP)
Alfredo Aisa Álvarez, Azucena
Espinoza Sevilla, Miguel Ángel
Torres Pacheco, Enrique Díaz
Greene, Federico Rodríguez
Weber
Departamento de Medicina
Interna, Hospital Ángeles del Pedregal de la Facultad Mexicana
de Medicina de la Universidad
La Salle, México, DF
Antecedentes: la osteoporosis
(OP) es una enfermedad caracterizada por una disminución
de la densidad mineral ósea
y un aumento del riesgo de
fracturas. Pacientes y método:
estudio transversal donde se
evaluaron 432 sujetos a quienes
se les aplico un cuestionario
que incluía información demográfica, historia clínica y
factores de riesgo para OP. A
todos los pacientes se tomó
peso, talla, IMC, perfil de lípidos y glucosa en ayuno. A todos
los sujetos se les realizo densitometría ósea de la muñeca
derecha. Se calculó el riesgo de
fractura mayor y de cadera a 10
años con la herramienta FRAX.
El estudio se realizó en el HAP
durante el mes de Septiembre.
Resultados: se revisaron en total
276 pacientes. El 15.9% presentaron MOB y un paciente OP
(0.4%). La edad promedio de 40
años se asoció a un mayor riesgo de MOB (OR 8.84; IC 95%
3.06-25.49; p ≤ 0.001). El grupo
de pacientes con MOB y OP
se asoció a un mayor consumo
de cigarros al día (2.98±2.58
vs 6.54±7.24; p=0.003). El
antecedente de padres con
fractura de cadera se asoció a
un mayor riesgo de presentar
MOB (OR 2.35 IC 95% 1.214.58; p=0.019). El grupo de
osteopenia presento un mayor
riesgo de fractura osteoporótica mayor como de cadera por
FRAX (1.65±0.92 vs 4.787±2.5;
p <0.001 y 0.126±0.17 vs
0.40±0.42; p <0.001). Conclusiones: la prevalencia de
OP fue de 0.4% y de MOB del
15.9%. Los pacientes con MOB
y OP tuvieron mayor riesgo de
fractura mayor o cadera con la
herramienta FRAX.
Evaluación del perfil de lípidos
antes y después del tratamiento
para hipotiroidismo en el Sistema de Salud de PEMEX
Laura Luz Arana Luna,1 Adriana
Hernández Alarcón,2 Adriana
Rodríguez Galván1
1
Residente de cuarto año de
Medicina Interna
2
Médico Internista
Servicio de Medicina Interna,
Hospital Central Sur de Alta Especialidad, PEMEX, México, DF
Introducción: las hormonas
tiroideas regulan entre otras
funciones, el metabolismo del
colesterol y de las lipoproteínas. Los desordenes tiroideos
incluyendo hipotiroidismo,
hipotiroidismo subclínico,
alteran considerablemente el
perfil lipídico y promueven
las enfermedades cardiovasculares. Objetivos: el objetivo
primario fue determinar en
qué porcentaje de pacientes
con hipotiroidismo existe
mejoría en el perfil de lípidos
(colesterol, triglicéridos o ambos) después del tratamiento
de sustitución hormonal. El
objetivo secundario fue determinar cuales son los factores
que influyen en dicho cambio.
Material y métodos: se trato
de un estudio retrospectivo
de encuesta de expedientes.
Se incluyeron a los pacientes
con hipotiroidismo y dislipidemia mayores de 18 años,
derechohabientes de los servicios médicos de PEMEX
detectados en el expediente
electrónico del año 2007 al
año 2012. El análisis se realizó
con el programa estadístico
SPPS versión 22, se utilizó
estadísticos descriptivos para
determinar las características
de la población, para el objetivo primario se analizaron las
variables continuas con prueba de muestras independientes
y prueba t de Student. Las
variables categóricas se analizaron con tablas cruzadas
y c2. Resultados: A) colesterol: los niveles disminuyeron
S141
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
después del tratamiento para
hipotiroidismo, encontramos
que hubo una reducción estadísticamente significativa (p=
0.047). B) Triglicéridos: los
niveles disminuyeron después
del tratamiento con hormonas
tiroideas. Encontrando una
diferencia estadísticamente
significativa (p=0.01). C) Dislipidemia mixta: Después del
tratamiento con hormonas
tiroideas, se encontró una
diferencia estadísticamente
significativa en la disminución
de triglicéridos (p=0.001), no
siendo así en la disminución
de colesterol (p=0.051). Conclusión: con este estudio se
concluye que en pacientes hipotiroideos, la dislipidemia se
corrige de manera significativa
después del tratamiento con
hormonas tiroideas. Además,
se concluye que el hipotiroidismo es una enfermedad
subdiagnosticada.
Correlación entre esteatosis
hepática ultrasonográfica y
porcentaje de grasa visceral
por bioimpedancia
Juan Carlos Corona Meléndez,1
Edith Jaqueline Bañuelos Contreras,2 Francisco de Asís Pérez
Lamero,3 Joel de Jesús Vázquez
García,3 Juan Roberto Flores
Montes,2 Eloy Medina Ruiz1
1
Departamento de Medicina
Interna
2
Clínica de Diagnóstico
3
Departamento de Radiología
e Imagen
Hospital Ángeles del Carmen,
Guadalajara, Jalisco
S142
Introducción: la adiposidad
visceral abdominal es un factor de riesgo independiente
para el desarrollo de esteatosis hepática. La medición
imagenológica de esteatosis
hepática por ultrasonido tiene
alta sensibilidad y especificidad
comparada con histopatología,
y la bioimpedancia ha mostrado
alta correlación con estudios
de imagen de grasa visceral. El
encontrar una alta correlación
entre estimaciones objetivas
de la esteatosis hepática y la
adiposidad visceral lograría
utilizar una de ellas para inferir
la presencia de la otra si no es
posible medir ambas. Material
y métodos: se realizó un estudio prospectivo, observacional,
comparativo, de correlación,
en hombres y mujeres mayores
de 18 años de edad que aceptaron participar, excluyendo a
embarazadas, en lactancia, con
hepatopatía crónica conocida,
y enfermedad renal crónica terminal, calculando una muestra
de 62 pacientes con confiabilidad de 95% y poder de 95%.
Bajo consentimiento informado
se realizó bioimpedancia con
monitor OMRON HBF-514 y
ultrasonografía con Ultrasonido
Phillips iU22. Se respetaron
los principios éticos de la Declaración de Helsinski y de
la Ley General de Salud. Se
utilizaron estadísticas descriptivas, correlación de Spearman
y análisis de regresión lineal, a
través del paquete estadístico
IBM® SPSS® Statistics Versión
21. Resultados: se recluta-
ron 125 pacientes. El 74.4%
(n=93) fueron hombres, con
edad promedio de 46 años.
El 55.2% (n=69) no tuvieron
esteatosis hepática, el 25.6%
(n=32) tuvieron grado I, el
16% (n=20) tuvieron grado II y
3.2% (n=4) tuvieron grado III.
Se obtuvo un grado de correlación por Rho de Spearman de
0.538 (p<0.01) entre esteatosis
hepática y porcentaje de grasa
visceral. Otras variables que
mostraron correlación significativa con el porcentaje de grasa
visceral fueron porcentaje de
grasa corporal, peso, AST, ALT,
AST y fosfatasa alcalina. En
el análisis de regresión lineal,
solo el grado de esteatosis
hepática por USG, el peso y
la GGT permanecieron con
significancia estadística. De
éstas, solo el peso tuvo IC de
95% con significancia estadística. Conclusiones: existe una
correlación positiva estadísticamente significativa entre el
porcentaje de grasa visceral
medido por bioimpedancia, y
el grado de esteatosis hepática
medido por ultrasonografía (p
= 0.512). Sin embargo, dicha
significancia se diluye en el
análisis de regresión lineal. La
poca representatividad de esteatosis grado III pudiera influir
en dichos resultados.
Prueba diagnóstica de criterios
individuales de síndrome metabólico e índice cintura-altura
Juan Carlos Corona Meléndez,1
Lilian Montserrat Torres Made,1
Edith Jaqueline Bañuelos Con-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
treras, 2 Juan Roberto Flores
Montes,2 Eloy Medina Ruiz1
1
Departamento de Medicina
Interna
2
Clínica de Diagnóstico
Hospital Ángeles del Carmen,
Guadalajara, Jalisco
Introducción: la variabilidad
de circunferencia abdominal
en la definición de síndrome
metabólico y la necesidad
de reunir criterios clínicos y
bioquímicos ha limitado su
aplicabilidad universal. El
índice cintura-altura tiene
mejor correlación con la grasa
intraabdominal. El objetivo fue
someter los criterios del síndrome metabólico a un estudio
de prueba diagnóstica en búsqueda del más representativo,
incluyendo al índice cinturaaltura para compararlo con la
circunferencia abdominal. Metodología: se realizó un estudio
prospectivo, observacional,
comparativo, tipo prueba diagnóstica, en pacientes mayores
de 18 años de edad, de ambos
sexos, y excluyendo a mujeres
embarazadas o lactando, con
ascitis y hernia abdominal. Se
calculó una muestra de 116
pacientes con un nivel de significancia de 0.05 y un poder
de 80%. Se utilizaron los criterios IDF/NHLBI/AHA/WHF/
IAS/IASO 2009 y se obtuvo el
índice cintura-altura, previo
consentimiento informado.
Con cuadros de contingencia
de 2 x 2 se obtuvieron sensibilidad, especificidad, valores
predictivos y razones de ve-
rosimilitud, y correlación de
Pearson, utilizando el paquete
estadístico IBM® SPSS® Statistics Versión 21. Se respetaron
los principios éticos de la
Declaración de Helsinski y
de la Ley General de Salud.
Resultados: se reclutaron 185
pacientes. El 76.2% (n =141)
fueron hombres con edad promedio de 45.79 años. El grado
de correlación fue r=0.896 entre circunferencia abdominal
e índice cintura-altura. De los
criterios establecidos para síndrome metabólico, la obesidad
presentó los mejores valores
para sensibilidad (97%), VPN
(94%) y valor de verosimilitud
negativa (0.11), y la presión
arterial elevada de los mejores
para especificidad (92%), VPP
(76%) y valor de verosimilitud
positiva (5.12), y el de mejor.
El índice cintura-altura obtuvo
mejor sensibilidad (100%)
y valor predictivo negativo
(100%) que la circunferencia
abdominal. Conclusiones: la
medición de la circunferencia
abdominal y la presión arterial
complementa en un alto grado
de probabilidad el establecer la presencia o ausencia
de síndrome metabólico. El
índice cintura-altura tiene un
alto grado de correlación con
la circunferencia abdominal,
y mejor sensibilidad y valor
predictivo negativo para el
diagnóstico de síndrome metabólico, por lo que se podría
sustituir como marcador de
obesidad intraabdominal en el
diagnóstico de dicho síndrome.
Tratamiento urgente de trabajadores diabéticos con descontrol
crónico
Carlos A Narváez Pichardo,
Octavio AJ Rodríguez Uriarte,
David Chávez Castillo, JA Miguel Mendiola Núñez
Servicio de Urgencias, Hospital
Central Norte, Subdirección
de Servicios de Salud, PEMEX,
México, DF
Introducción: la terapia efectiva
para el control de la diabetes
requiere un cambio en los
hábitos de vida, en especial
de la conducta alimentaria, la
actividad física, la automonitorización de niveles de glucosa.
Para realizar estos cambios el
paciente requiere una atención
personalizada, es frecuente que
el paciente diabético trabajador activo con largas jornadas
de trabajo no disponga de las
facilidades para su atención
institucional en horarios diurnos, obligando al paciente
trabajador a visitar urgencias
en el turno nocturno sin recibir
la adecuada atención al descontrol crónico. Objetivos: I)
identificar a los trabajadores
diabéticos con falta de respuesta al tratamiento institucional
habitual. II) Lograr el adecuado
control de los trabajadores diabéticos desde su atención en el
turno nocturno del servicio de
urgencias. Método: se incluyó
a los pacientes diabéticos trabajadores que acudieron por
iniciativa propia o envió médico al servicio de urgencias,
asintomáticos o con síntomas
S143
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
de descontrol metabólico, quienes ya habían recibido atención
médica de su diabetes. A todos
los pacientes se les realizo
evaluación sin límite de tiempo
con examen físico, glucometría,
química sanguínea, examen
general de orina y revisión del
expediente,la intervención en
todos los pacientes incluyo
prescripción de la alimentación
con régimen estandarizado desarrollado por este equipo de
trabajo, reducción de azúcares
y harinas fraccionadas, incremento de vegetales; activación
física por 80 minutos semanales, capacitación en auto
monitorización con glucometria. En pocos casos se modifico
el esquema farmacológico. Los
pacientes se evaluaron a las 4
y 14 semanas. Resultados: se
identificó a 24 trabajadores con
índice de masa corporal (IMC)
promedio de 30.8, glucosa
sérica de 276 mg/dL, hemoglobina glucosilada de 9.1%,
glucosuria. A las 14 semanas
se observó una reducción del
IMC promedio a 27.7, glucosa
sérica a 146 mg/dL, hemoglobina glucosilada de 7.3%, sin
glucosuria. Ningún trabajador
se hospitalizo. Análisis: es evidente una reducción de peso,
glucosa sérica y hemoglobina
glucosilada en los pacientes
atendidos bajo este esquema de
modificaciones personalizadas.
Conclusiones: 1) es posible
brindar la atención adecuada
y eficaz al paciente diabético y
trabajador en el turno nocturno,
siempre y cuando se disponga
S144
de personal experimentado y
no se tenga límite de tiempo
en su atención. 2) Existe una
reducción de la necesidad de
hospitalización del paciente
diabético trabajador.
IDegAsp disminuye la tasa de
hipoglucemia vs insulina bifásica aspártica en adultos con
DT2 que alcanzan el objetivo
glucémico (HbA1C <7.0%): un
metanálisis
R Mehta, A Vaag, JS Christiansen, LK Niskanen, T Johansen,
S Rasmussen, M Mercado, G
Fulcher
INNSZ, multicéntrico
La insulina degludec/insulina
aspártica (IDegAsp) es una
coformulación soluble de 70%
insulina degludec y 30% insulina aspártica. El objetivo de
este meta-análisis post-hoc fue
comparar las tasas de hipoglucemia para IDegAsp vs. insulina
aspártica bifásica 30 (BIAsp 30)
en adultos con diabetes tipo 2
(DT2) que alcanzaron las metas
ADA/EASD de HbA1C <7% al
final del estudio. Este análisis
incluyó dos estudios de 26
semanas comparando IDegAsp
vs. BIAsp 30 dos veces al día.
HbA1C, glucosa plasmática en
ayuno y dosis de insulina se
analizaron utilizando un modelo ANCOVA; los episodios
de hipoglucemia fueron analizados utilizando un modelo
de regresión binomial negativa.
La hipoglucemia confirmada se
definió como PG <56 mg/dL
auto-reportada o severa (requi-
riendo asistencia de un tercero);
hipoglucemia nocturna confirmada entre las 00:01-05:59 am.
En total 49.1% (426/868) de los
sujetos alcanzaron HbA1C al
final del tratamiento <7% (IDegAsp: 49.2% (248/504); BIAsp
30: 48.9% (178/364)) y fueron
incluidos en el meta-análisis.
Los grupos de tratamiento tuvieron niveles similares de
HbA1c al final del estudio
(6.4% vs. 6.4%; diferencia estimada de tratamiento: 0.00%
[-0.07; 0.07], p=0.996), donde
IDegAsp logró una reducción
significativamente mayor desde
la basal en FPG media (-54.8 vs.
-38.0 mg/dL; ETD: -20.2 mg/dL
[-25.1; -15.4]; p<0.0001). La
dosis media diaria de insulina
al EOT fue significativamente
menor para IDegAsp que para
BIAsp 30 (0.9 vs 1.1 U/kg;
relación de dosis estimada:
0.77 [0.72; 0.84]; p<0.0001).
IDegAsp se asoció con una tasa
significativamente menor de
hipoglucemia total confirmada
.IDegAsp/BIAsp 30: 0.70 [0.55;
0.90], p=0.0047) y una tasa
significativamente menor de
hipoglucemia nocturna que con
BIAsp 30 (RR: 0.34 [0.22; 0.51],
p<0.0001). Las tasas de hipoglucemia severa fueron bajas y
similares entre ambos grupos.
La diferencia significativa vs.
BIAsp 30 en hipoglucemia total
y nocturna confirmada en adultos alcanzando el objetivo de
glucemia (HbA1c <7%) apoya
el perfil farmacodinámico plano
y estable del componente degludec basal en IDegAsp.
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Efecto de liraglutida 3.0/1.8mg
en el peso corporal y factores de
riesgo cardiovascular en adultos
con obesidad o sobrepeso con
DM2: SCALE Diabetes, estudio
aleatorizado, doble ciego a 56
semanas
Marcela Rodríguez Flores, Bruce Bode, Ralph DeFronzo,
Richard Bergenstal, Robert Kushner, Andrew Lewin, Trine Vang
Skjøth, Ricardo Arturo Reynoso
Mendoza, Melanie Davies
Clínica de Obesidad y TCA,
INNSZ, México, DF
Atlanta Diabetes Associates,
Atlanta, GA, Estados Unidos
Texas Diabetes Institute, San
Antonio, Texas, Estados Unidos
International Diabetes Center,
Minneapolis, MN, Estados Unidos
Northwestern University, Chicago, IL, Estados Unidos
Antecedentes y Objetivos: la
obesidad incrementa el riesgo
de múltiples comorbilidades,
incluyendo enfermedad cardiovascular (CV). La pérdida de
peso de 5-10% puede reducir
el riesgo, pero es difícil de lograr y mantener solamente con
cambios en el estilo de vida. El
objetivo fue evaluar los efectos
de liraglutida sobre pérdida de
peso y factores de riesgo cardiometabólico (circunferencia
de cintura [CC], glucemia,
tensión arterial [TA], pulso, lípidos, y biomarcadores CV) en
adultos con DM2 y sobrepeso
u obesidad. Metodología: se
realizó estudio por 56 semanas
con una aleatorización 2:1:1
(liraglutida 3.0 mg, 1.8 mg
o placebo); todos los grupos
siguieron una dieta con un déficit de 500 kcal/día y ejercicio.
Resultados: se aleatorizaron
846 individuos (edad 54.9
años, IMC promedio 37.0 kg/
m2. La pérdida de peso media
observada fue de 5.9%, 4.6%
y 2.0% para 3.0 mg, 1.8 mg y
placebo, respectivamente; liraglutida fue superior a placebo
en cualquier dosis (p<0.0001);
3.0 mg fue superior a 1.8 mg
(p=0.0024). Se observaron
reducciones en CC de 6.1, 4.8
y 2.7 cm respectivamente; 3.0
mg y 1.8 mg fueron superiores a
placebo (p≤0.0004); 3.0 mg fue
superior a 1.8 mg (p=0.0224).
Al final HbA1c disminuyó en
1.3%, 1.1% y 0.3% con 3.0 mg,
1.8 mg, y placebo respectivamente (p<0.0001 vs placebo;
p=0.0125 para 3.0 mg vs 1.8
mg). Las reducciones en TA sistólica fueron de 2.8, 3.5 y 0.4
mmHg en cada grupo respectivamente; mayor liraglutida que
con placebo (p<0.05). Hubo un
incremento similar en pulso de
2.0 y 2.1 latidos por minuto con
liraglutida 3.0 y 1.8 mg vs -1.4
latidos por minuto con placebo
(p<0.0001). Liraglutida 3.0 mg
redujo colesterol total, VLDL y
triglicéridos ( 4%, 13%, 14%,
p<0.05) e incrementó C-HDL
(+3%, p<0.05) vs placebo.
Se observaron reducciones
en proteína C reactiva de alta
sensibilidad con liraglutida 3.0
y 1.8 mg (-27% y -25% vs placebo, p≤0.0002). Ocurrieron
disminuciones en PAI-1 (-24%,
p=0.0004) y relación albúmi-
na/creatinina urinarias (-20%,
p=0.0086) con liraglutida 3.0
mg vs placebo. El fibrinógeno
se incrementó en 5% vs placebo únicamente con 3.0 mg
(p=0.046). Conclusión: al final
del estudio, liraglutida 3.0 mg,
agregado a dieta y ejercicio,
provocó una pérdida de peso
significativa que se asoció con
beneficios adicionales para
múltiples factores de riesgo cardiometabólico, en comparación
con liraglutida 1.8 mg y placebo en adultos con sobrepeso u
obesidad y DM2.
Insulina Degludec/Insulin
Aspártica (IDegAsp) provee
control superior de GPA y reduce hipoglucemias vs insulina
Aspart Bifásica 30 (BIAsp 30)
en pacientes vírgenes a insulina
con diabetes tipo 2 en un estudio aleatorizado fase 3
R Arechavaleta, E Franek, M
Haluzik, S Canecki Varzic, M
Sargin, S Macura, J Zacho, M
Mercado, JS Christiansen
Unidad de Patología, Clínica
Guadalajara
Un estudio de tratar a metas,
aleatorizado, abierto, multinacional de 26 semanas comparó
la eficacia y seguridad de IDegAsp (combinación 70% IDeg
y 30% IAsp) y BIAsp 30, administrado dos veces al día
± metformina en adultos con
diabetes tipo 2 sin tratamiento
previo con insulina. Los sujetos
(media: edad 58.9 años, HbA1C
8.4%, FPG 183.8 mg/dL, IMC
31.2 kg/m2) fueron aleatoriza-
S145
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
dos 1:1 a IDegAsp (n = 197) o
BiAsp (n = 197), administrado
antes del desayuno y la comida
principal de la tarde, titulado a
SPMG objetivo pre-desayuno
y pre-comida ≤ 90.0 mg/dL.
IDegAsp fue no inferior a BIAsp
30 en el cambio medio de
HbA1c desde la basal (variable
primaria; diferencia estimada
de tratamiento [ETD, por sus
siglas en inglés] 0.02% [95% IC
-0.12; 0.17]), la HbA1c media
al final del tratamiento fue de
49.0 (6.6) y 48.0 (6.5) (mmol/
mol [%]), respectivamente.
IDegAsp fue superior a BIAsp
30 en disminuir FPG (ETD -18.0
mg/dL [95% IC -1.42; -0.59];
p<0.001). La dosis media de
insulina después de 26 semanas
fue similar entre los dos brazos
de tratamiento (IDegAsp 0.80
U/kg; BIAsp 30 0.82 U/kg). La
tasa de hipoglucemia severa
(requiriendo asistencia) fueron
bajas en ambos brazos. La tasa
de EAs fue similar. Las diferencias significativas vs BIAsp 30
en hipoglucemia confirmada
y nocturna confirmada fueron
consistentes con hallazgos
previos, reflejando el perfil farmacodinámico plano y estable
del componente basal degludec
en IDegAsp.
Características ultrasonograficas del nódulo tiroideo y
su asociación con cáncer de
tiroides
Juan Francisco Castro Ruelas, Manuel Salvador Aguilera
Rosas, José Candelario Bátiz
Beltrán
S146
Servicio de Medicina Interna,
Hospital Regional Dr. Manuel
Cárdenas de la Vega, ISSSTE,
Culiacán, Sinaloa
Introducción: dado el mayor
acceso de la población a estudios diagnósticos como el
ultrasonido, cada vez son detectados con mayor frecuencia
aquellos pacientes con nódulo
tiroideo, diversas referencias
citan que los nódulos tiroideos
están presentes en 4 a 7 %
de la población general y es
reportado hasta en el 50% de
las autopsias. La prevalencia
de malignidad reportada en la
literatura es del 10%. Una vez
detectado la importancia radica en la necesidad de excluir
la presencia de cáncer de tiroides, donde el ultrasonido es
una herramienta fundamental.
Objetivos: determinar cuáles
son los hallazgos ultrasonográficos que se presentan con
mayor frecuencia en pacientes
con cáncer de tiroides. Material y método: se realizó un
estudio observacional, retrospectivo, analítico, transversal,
con casos y controles donde se
incluyeron a todos los pacientes que acudieron a la consulta
de endocrinología con diagnostico de nódulo tiroideo.
Resultados: se estudiaron 92
pacientes, se realizo tiroidectomía en el 36.8% (n=35), BAAF
en el 84.8% (n=78), el 93.5%
(n=86) eran del sexo femenino
y el 6.5% (n=6) masculinos.
La prevalencia de malignidad
fue del 9.8% (n=9). Los datos
ultrasonográficos que se presentaron con mayor frecuencia
fueron: bordes irregulares,
microcalcificaciones y patrón
heterogéneo. Conclusiones:
la presencia de bordes irregulares, microcalcificaciones
y patrón heterogéneo, podría
estar asociado con un mayor
probabilidad de padecer cáncer de tiroides.
Uso de metilprednisolona vs
dexametasona y su asociación
con hiperglucemia en no diabéticos
Lucy Carolina Flores Arceo, Luis
Eduardo Landeros Vera, Antonio
Israel Valdez Payan, Sánchez
Cuen, Jiménez Ricardez, José
C Bátiz Beltrán
Servicio de Medicina Interna,
Hospital Regional Dr. Manuel
Cárdenas de la Vega, ISSSTE,
Culiacán, Sinaloa
Introducción: la hiperglucemia
es uno de los efectos adversos
más conocidos de los glucocorticoides sistémicos. El objetivo
de este estudio fue comparar
la seguridad en el tratamiento
con metilprednisolona vs dexametasona en la producción de
hiperglucemia en pacientes
no diabéticos con diagnostico
de enfermedad pulmonar obstructiva crónica, enfermedades
hematológicas y oncológicas.
Material y métodos: se realizó un estudio experimental,
comparativo, prospectivo,
prolectivo, aleatorizado. Se
dividieron en dos grupos a
pacientes no diabéticos que
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
estuvieran hospitalizados en
el servicio de medicina interna
que requirieran la aplicación
de glucocorticoides intravenosos, en el grupo A (n=43) se
les aplico metilprednisolona, y
al grupo B (n=43) se les aplico
dexametasona, se midió glucemia y hemoglobina glucosilada
durante el internamiento, a los
3 y 6 meses. Resultados: no
hubo diferencias significativas
en las glucemias basales para
ambos grupos, sin embargo
durante la hospitalización, a los
3 meses y 6 meses los pacientes
del grupo de dexametasona presentaron glucemias persistente
más elevadas con valor de p
<0.05. Conclusiones: el uso de
dexametasona se asocia a cifras
de glucemia persistentemente
más elevadas que metilprednisolona, con un menor riesgo
de presentar hiperglucemia en
el grupo de metilprenisolona,
durante hospitalización, a los
3 y 6 meses.
Influencia de la funcionalidad
del tejido adiposo para desarrollar esteatosis hepática
Nashla Hamdan Pérez, Carlos
Amir Carmona González, Nimbe Torres y Torres, Armando R
Tovar Palacio, Guillermo Ordaz
Nava, Sofía Moran Ramos,
Braulio Martínez Benítez, Roberto Medina Santillán, Nahum
Méndez Sánchez, Gonzalo
Torres Villalobos
Departamento de Medicina Interna y Clínica de Enfermedades
Digestivas, Fundación Clínica
Médica Sur, México, DF
Introducción: la esteatosis
hepática es un problema importante en nuestro país y
conlleva a múltiples comorbilidades como la resistencia a la
insulina. Objetivo: desarrollar
modelos de esteatosis hepática
en ratas mediante un mecanismo fisiológico para valorar
nuevas medidas terapéuticas.
Métodos: alimentamos ratas
Wistar macho durante 90 días
con distintas dietas: Chow (C),
alta en grasa-colesterol + 5%
de sacarosa en agua (AG), alta
en grasa-almidones + 5% de
sacarosa en agua (AGA) y dieta
Chow + 20% sacarosa en agua
(AC). Se realizaron pruebas de
tolerancia a la glucosa a los 0
y 70 días. Medimos concentraciones de glucosa y triglicéridos
(TG) a los 0, 30, 60 y 90 días.
Resultados: los grupos con
dieta AG y AGA presentaron incremento de los TG y colesterol
séricos así como aumento en su
concentración en tejido hepático (p=0.013), las diferencias en
niveles séricos se observaron
desde las 4 semanas (p=0.058).
AG presento esteatosis hepática
grado II. Prueba de tolerancia a
la glucosa de 70 días se encontró intolerancia a carbohidratos
en AG y AC, encontrándose un
área bajo la curva para insulina
mayor en el grupo AC. La lipogénesis y oxidación hepática se
encontraban incrementadas en
el grupo de la dieta AC. En el
grupo AG la adipogénesis estuvo incrementada con respecto
al C. El tejido adiposo omental
(V) presentó mayor actividad
lipolítica con mayor expresión
del gen de HSL y perilipina en
los grupos AC y AGA. Las concentraciones de ácidos grasos
libres (AGL) presentaron una
tendencia a ser mayores en la
dieta AC en comparación con
la AG. Conclusiones: El tejido
adiposo en la dieta AC presento
mayor actividad lipogenica así
como a nivel hepático presentando incremento en los TG y
AGL séricos y resistencia a la insulina (RI) periférica. En la dieta
AG se observo disminución de
lipogénesis hepática así como
la lipólisis en el tejido adiposo
y una mayor secreción de leptina, presentando RI y esteatosis
hepática en mayor grado que
las otras dietas.
Trasplante autólogo de tejido
adiposo subcutáneo en ratas
obesas para tratar obesidad
Nashla Hamdan Pérez, Carlos Amir Carmona González,
Nimbe Torres Torres, Armando
Tovar Palacio, Guillermo Ordaz
Nava, Sofía Moran Ramos, Lilia
Noriega, Carlos Bravo Reyna,
Ivan Torre Villalvazo, Marcia Hiriart, Roberto Medina Santillán,
Nahúm Méndez Sánchez
Departamento de Medicina Interna y Clínica de Enfermedades
Digestivas, Fundación Clínica
Médica Sur, México, DF
Introducción: la obesidad es
una enfermedad multifactorial
y compleja que se acompaña
de múltiples comorbilidades
como DM2, dislipidemia e
hipertensión. Se considera un
S147
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
estado de inflamación crónica
en el cual el papel del tejido
adiposo es muy importante.
Objetivo: analizar la utilidad
del trasplante autólogo de tejido adiposo subcutáneo como
medida terapéutica para la
obesidad y sus comorbilidades.
Métodos: Se utilizaron ratas
Wistar con dos dietas diferentes
para inducir obesidad, durante
90 días, una alta en carbohidratos (AC) y otra en grasa (AG) y
un grupo control (GC) con dieta
Chow. Se realizó medición de
glucosa y triglicéridos (TG) cada
30 días y curva de tolerancia a
la glucosa (CTG) en los días 90
y 180. En el día 90 se realizó
cirugía dividiéndose aleatoriamente en tres grupos: 1) Sham
(S), 2) trasplante (T) autólogo
de tejido adiposo subcutáneo
a visceral 3) extracción (E) del
tejido adiposo subcutáneo (TAS)
sin trasplante. Resultados: en
la curva CTG se encontraron
menores concentraciones de
insulina del grupo T de dieta
AG (p=.002) respecto al S, así
como un menor incremento
en el grupo T, E de dieta AC
y GC (p=0.004) respecto a S.
En el sacrificio el grupo que
presento menor incremento de
peso fue el T de ambas dietas.
Las concentraciones de TG
finales fueron menores en el
grupo E, T de la dieta AC y GC
respecto al grupo S. Se realizo
extracción de TG y colesterol
hepáticos encontrándose una
mayor concentración de ambos
en el grupo S y E en comparación con el T de la dieta AG
S148
(p=0.008). Las ratas en las que
se realizo trasplante autólogo
de TAS presentaron una mejor
respuesta durante la CTG así
como un menor incremento
en el peso comparadas con las
ratas del grupo S. Conclusión:
el trasplante autólogo de TAS a
compartimento visceral produjo mejoría en la utilización de
carbohidratos reflejada en una
menor secreción de insulina.
Siendo este una posible medida terapéutica para mejorar el
perfil glucémico.
Correlación entre el grado de
obesidad y la mortalidad de los
pacientes hospitalizados con
hepatitis alcohólica en el Hospital General Dr. Manuel Gea
González durante el periodo
2007-2013
Jorge Luis Pineda Castillejos, J
Rivero Martínez, G Cruz Aragón, I García Juárez, A Fuentes
Venegas, R Zacarías Castillo
Hospital General Dr. Manuel
Gea González, México, DF
Introducción: la hepatitis alcohólica (HA) es un síndrome
clínico de inflamación hepática, lesión del hepatocito y
fibrosis en un escenario de
consumo reciente de alcohol
de más de 30 g de alcohol por
día. Los pacientes con insuficiencia hepática secundaria
al alcoholismo presentan un
mal pronóstico desde el ingreso, con una probabilidad de
supervivencia a 3 años del 30
% posterior a la descompensación, y una reducción en la
sobrevida si presenta sobrepeso
u obesidad. Objetivo: identificar a si el sobrepeso (> 25
IMC) u Obesidad (> 30 IMC)
correlaciona como factores
directos asociados de mortalidad en pacientes con HA
hospitalizados en el Hospital
General Dr. Manuel Gea González. Materiales y métodos:
estudio descriptivo, transversal,
observacional, retrospectivo.
145 expedientes de pacientes
con HA hospitalizados en el
Hospital General Dr. Manuel
Gea González entre enero 2007
y diciembre 2013. Se estimó
la correlación de Pearson y
Spearman Brown para la identificación de tendencia lineal
en las categorías del índice de
masa corporal. Resultados: total
de 143 pacientes hospitalizados
en Medicina Interna con diagnóstico de HA, los pacientes
masculinos con sobrepeso la
proporción fue del 51.7%.
Femeninos con obesidad su
proporción es de 45.5%; Se
observan diferencias entre sexo
e IMC (p<0.05). Edad menor a
49 años y que tenían sobrepeso
(51.4%, p: 0.37). Ictericia al
ingreso con sobrepeso (56.3%,
p: 0.018). La clasificación de
CHILD-PUGH su proporción
pacientes que presentaban sobrepeso y el estadio C (54.3%,
p: 0.013). En lo que respecta a
sobrevida, su mayor proporción
de pacientes presentaban peso
normal (44.6%), en relación
al sobrepeso (40.6%)(p: 0.09).
Conclusión: nuestros resultados
sugieren una relación entre el
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
IMC y la hepatitis alcohólica.
De igual manera se observaron
tendencias lineales en algunas
variables, sin significancia estadística significativa.
Identificación de anormalidades
del piso pélvico por defecografía
en estreñimiento crónico
Alejandro Garza Alpirez, Priscilla Caballero Vázquez, Ana
Fernanda Alvarado Villalobos,
Luis Alonso Morales Garza,
Miguel Ángel Carrillo Martínez,
Ignacio Cano Muñoz, Carolina
Tatiana Elizondo Vázquez. César Antonio Marrufo García,
Miguel Ángel Mar Ruz
Servicio de Medicina Interna y
Gastroenterología, Hospital San
José Tec de Monterrey, Monterrey, Nuevo León
Antecedente s: el estreñimiento es una dificultad en
el paso o paso infrecuente de
las heces, endurecimiento de
éstas o sensación de evacuación incompleta. Se clasifica
en: tránsito normal, lento y
desórdenes de evacuación defecatoria o rectal. Cuando hay
tránsito normal los pacientes
tienen heces duras, distensión
y dolor abdominal. Los desórdenes defecatorios se deben a
disfunción del piso pélvico o
del esfínter anal. La intrususcepción, rectocele y disinergia
del piso pélvico son causas de
desórdenes defecatorios. Estas
disfunciones se pueden identificar mediante la defecografía.
Su prevalencia es del 28%,
siendo mayor en mujeres que
en hombres. Una historia clínica detallada y una exploración
física completa son la clave
para un diagnóstico correcto.
El tratamiento conservador
incluye dieta rica en fibras, los
laxantes y el entrenamiento
defecatorio tipo biofeedback.
Para el tratamiento quirúrgico
se debe considerar el riesgo de
agravamiento del estreñimiento,
dehiscencia y sepsis pélvica.
Objetivo: conocer la frecuencia
de anomalías anatómicas en
pacientes con estreñimiento
sugerente de obstrucción de
salida por defecografía. Material y métodos: se realizó un
estudio observacional, retrospectivo, descriptivo en el que
se analizaron las defecografías
de pacientes del departamento
de radiología del Hospital San
José Tec de Monterrey entre
septiembre de 1996 y agosto
del 2013 bajo un protocolo
estandarizado. Resultados: se
evaluaron 407 pacientes, 86%
del sexo femenino y 14% masculino. La edad promedio de
las mujeres fue 42 años y de los
hombres 36 años. Las alteraciones anatómicas que con mayor
frecuencia se observaron fueron
rectocele anterior en un 86%,
seguido de las invaginaciones
en un 40%, la asociación de
invaginación con rectocele la
encontramos en un 36% y con
menor frecuencia enterocele
en el 10% y prolapso en el
2%. Conclusiones: en estudios
realizados previamente se ha
observado una prevalencia de
invaginación de hasta 40% y
de rectocele anterior de 18%,
lo cual nos indica que en la
población del Hospital San
José es mayor la frecuencia de
rectocele que invaginación.
Interesantemente estas alteraciones pueden estar asociadas
como en nuestro estudio. Por
lo anterior en los pacientes con
estreñimiento crónico recomendamos la defecografía para
descartar la presencia de anormalidades anatómicas y normar
una conducta terapéutica.
Asociación de la supresión
etílica grave por CIWA y la
presencia de sangrado de tubo
digestivo alto
Martín de Jesús Reyna Ramírez,
Alberto Melchor López, José
Juan Lozano Nuevo
Hospital General Xoco, México, DF
Introducción: el alcohol es
la sustancia más consumida
en México. La hemorragia
gastrointestinal es una causa
importante de morbilidad y
mortalidad. La tasa de mortalidad es de aproximadamente
10%. El alcohol es un factor de
riesgo, además, importante para
el desarrollo de gastritis erosiva
hemorrágica aguda después de
la ingestión de etanol es la presencia de cirrosis hepática con
hipertensión portal asociado
y gastropatía hipertensiva. El
alcohol puede interactuar directamente en la mucosa, o puede
actuar a través de un mecanismo más general que afecta la
liberación de hormonas y la regulación de funciones nerviosas
S149
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
implicadas en la secreción ácida. El objetivo fue determinar
si la supresión etílica grave por
CIWA, se asocia como predictor
de sangrado de tubo digestivo
alto. Descripción: se incluyeron
a pacientes con diagnóstico de
síndrome de supresión etílica
y sangrado de tubo digestivo
alto. Se clasifico según el CIWA
la severidad de la abstinencia,
además de clasificar según
los parámetros de mortalidad
como Rockall y Blachford. En
el estudio se incluyeron 84
pacientes con el diagnóstico de
síndrome de supresión etílica,
de los cuales el 94% fueron
del género masculino y sólo
5 (6%) mujeres. Utilizando
la escala CIWA se clasificó a
los pacientes por su severidad
encontrando que el grupo más
frecuente fueron los pacientes
con supresión etílica moderada
(59.5%), seguido por la supresión etílica mayor (32.1%) y
con menor frecuencia el grado
leve (8.3%), los tiempos de
coagulación fueron diferentes
entre ambos grupos de manera
estadísticamente significativa
por lo que pueden funcionar
como variable confusora, motivo por el cual se incluyó en
el análisis estadístico multivariado. Al evaluar con estadística
univariada (X2) la posible asociación entre el grado severo de
supresión etílica y la presencia
de sangrado de tubo digestivo
alto se encontró una valor de
X2 de 1.56 con una valor de p =
.211. Comentario y Conclusiones: no se encontró asociación
S150
estadísticamente significativa
entre la supresión etílica grave
o severa y el sangrado de tubo
digestivo alto. De acuerdo a
nuestros resultados y en el
contexto de un paciente con
síndrome de supresión etílica,
para el desarrollo de STDA es
más importante el estado de
coagulación del paciente que
la propia severidad de la supresión etílica.
Fragilidad en pacientes geriátricos ambulatorios en un hospital
de tercer nivel, determinación
de la prevalencia
Aramara Yasmín Aco Flores,
Alejandro Velásquez Sarria, Ana
Karenina López Retamoza, Antonio Cruz Estrada, Leonor Elia
Zapata Altamirano
Servicio de Geriatría, Hospital
General de México Dr. Eduardo
Liceaga, México, DF
Introducción: la fragilidad es
un síndrome clínico-biológico
caracterizado por una disminución de la resistencia y de
las reservas fisiológicas del
adulto mayor lo que lleva a un
aumento de la vulnerabilidad
ante estresores. Se decidió
utilizar una modificación del
modelo fenotípico propuesto
por Fried, en una población
característica de un Hospital
de referencia nacional. Objetivo: conocer la prevalencia de
fragilidad en los pacientes que
acuden a la consulta externa
del servicio de Geriatría del
Hospital General de México,
Dr. Eduardo Liceaga. Material y
métodos: se escogieron de manera aleatorizada pacientes que
acuden a la consulta externa del
servicio de Geriatría Criterios
para definir fragilidad: Encogimiento: pérdida de peso de más
de 3 kg o un IMC <21. Pobre
energía: se realizó la pregunta
¿Qué tan frecuente ha sentido
que todo lo que realiza requiere
un esfuerzo o que no puede
continuar? tomándose como
positivo las respuestas moderada y la mayoría de las veces.
Enlentecimiento: segundos en
recorrer una distancia de 4m. Se
utilizaron como puntos de corte
los reportados por Runzer en
una población peruana. Debilitamiento: si presenta dificultad
para levantarse de la silla. Baja
actividad física: si no realiza
alguna actividad como caminar diario, jardinería o algún
deporte una vez por semana.
Considerándose como frágil
aquellos con 3 o + criterios,
prefrágiles con 1 o 2 y robustos
con 0 criterios. Análisis: para las
variables cuantitativas se calcularon medidas de tendencia
central y de dispersión. En las
variables cualitativas se utilizaron frecuencias y proporciones.
Para la comparación de 3 grupos, análisis de varianza de un
factor. Con el programa SPSS
21. Resultados: se evaluaron
45 pacientes, 71.1% fueron
mujeres, la media de edad
80 años (DE 5.9), la media de
peso 60.5 kg (DE 11), la media
de talla fue de 1.5 m y de IMC
26.7, de la caminata a 4m 6.7s
(DE 4.7s). El 31.1% fueron ro-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
bustos, 48.9% prefrágiles y 20%
frágiles. Se encontró diferencia
estadística significativa solo
con la velocidad de la marcha
(p=0.001). El 33.3% de los
frágiles refirió pérdida de peso,
100% debilitamiento y 88.9%
nivel de actividad bajo. No se
encontró asociación con las
comorbilidades interrogadas.
Es importante contar con método reproducible y bajo costo
que nos permita reconocer a la
población vulnerable con el fin
de evitar la progresión.
Tromboprofilaxis en pacientes
no quirúrgicos en el Hospital
Ángeles Lomas en el Año 2013
Fernando Perez Zincer, María
del Rosario Herrero Maceda
Medicina Interna, Hematooncología, Hospital Ángeles
Lomas, México, DF
La tromboembolia venosa (TEV)
en su manifestación más grave,
la tromboembolia pulmonar
(TEP), es una urgencia frecuente
en los pacientes hospitalizados. Las guías internacionales
para la prevención de TVP/TEP
aconsejan estadificar el riesgo
de presentarlo en todos los pacientes ingresados al hospital,
sin embargo, tanto en literatura
internacional como nacional y
en la experiencia del Hospital
Ángeles Lomas, esta recomendación no se ha llevado a cabo
adecuadamente. Métodos.
Se revisaron expedientes del
archivo del Hospital Ángeles
Lomas, en los que según su
nota de ingreso se calculó el
riesgo de trombosis en base a la
escala de Caprini. Se incluyeron
pacientes con enfermedad grave ingresados en el servicio de
medicina interna en 2013 > 18
años. Se excluyeron pacientes
menores de 17 años; estancia
hospitalaria de 24 h; pacientes
a los que durante su estancia
se les hubiera realizado alguna
intervención quirúrgica mayor, quienes su diagnóstico de
ingreso estuviera relacionado
con hemorragia activa y/o fuera
relacionado con TVP/TEP. Resultados: riesgo alto 49% (68)
permanecieron sin medidas de
tromboprofilaxis, 15% (21) con
medias compresivas, 1% (1) con
sistema de compresión neumática, 17% (23) anticoagulación
farmacológica, 2% (3) medias
compresivas más sistema de
compresión neumática, 9% (13)
anticoagulación farmacológica
más medias compresivas y 7%
anticoagulación farmacológica más medias compresivas
más sistema de compresión
neumática. Riesgo muy alto de
tromboembolia venosa el 33%
(17) permanecieron sin medidas
de tromboprofilaxis, 19% (10)
con medias compresivas, 2%
(1) con compresión neumáticas
intermitente, 31% (16) anticoagulación farmacológica, 13%
(7) anticoagulación farmacológica más medias compresivas y
2% (1) medias compresivas más
compresión neumática. Lo se
que se traduce en 191 pacientes
con puntaje >4 (riesgo alto de
trombosis) de los cuales 45%
(85) permanecieron sin medidas
de tromboprofilaxis, 16% (31)
con medias compresivas, 1%
(2) sistema de compresión neumática intermitente, 20% (39)
anticoagulación farmacológica,
2% (4) medias compresivas
más sistema de compresión
neumática intermitente, 11%
(20) medias compresivas más
anticoagulación farmacológica,
5% (10) medias compresivas
más sistema de compresión
neumática intermitente más
anticoagulación farmacológica. Conclusión: el 64% de los
pacientes con riesgo alto de
tromboembolia venosa no recibieron un régimen adecuado
de tromboprofilaxis.
Deferasirox en recuperación
hematológica y telomérica en
síndrome mielodisplásico y
anemia aplásica
GE García Saavedra, HA Monroy Salazar, JM Covarrubias
Covarrubias, G Mendoza Calderón, BO Murillo Ortiz, J
Ramírez Emiliano, S Martínez
Garza
Unidad Médica de Alta Especialidad núm. 1, Bajío, IMSS,
León, Guanajuato
Introducción: la hemosiderosis es muy frecuente en el
paciente hematológico, evidenciándose la oxidación de ADN
y lípidos poliinsaturados por
iones metálicos lo que puede
causar que las células progenitoras disminuyan su capacidad
de proliferación limitando la
recuperación hematológica.
Objetivo: conocer si la dismi-
S151
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
nución de ferritina incrementa
la recuperación hematológica
y la longitud telomérica mediante la evaluación de los
requerimientos transfusionales,
los factores estimulantes de
colonias de granulocitos y eritropoyetina. Material: ensayo
clínico prospectivo de una cohorte. Mayores de 18 años con
diagnóstico de síndrome mielodisplásico y anemia aplásica
con niveles de ferritina sérica
1000 ng/mL que aceptaron participar en el estudio. Métodos:
se administró deferasirox 20
mg/kg/día vía oral por 6 meses.
Se determinó ferritina sérica,
citometría hemática y longitud telomérica a los 0, 3 y 6
meses, para conocer si ocurrió
recuperación hematológica.
Análisis estadístico: Se compararon niveles de ferritina basales
contra niveles alcanzados a
los 6 meses de tratamiento, requerimientos transfusionales,
unidades de eritropoyetina y de
factor estimulador de colonias
de granulocitos, mediante prueba t de Student. Resultados: un
total de 17 pacientes fueron incluidos, edad 51.1 ± 22.1 años.
Los niveles de ferritina a 6 meses disminuyeron 41% (9,527 ±
5,626 ng/mL). La recuperación
hematológica fue significativa a
6 meses, hemoglobina (5.9 ±1.8
vs 7.2 ± 2.5, p=0.03), los requerimientos hematológicos sin
cambios significativos (p=0.09),
disminución de la necesidad de
eritropoyetina a los 3 meses de
tratamiento (p<0.05). La longitud del telómero se modificó
S152
significativamente al final de la
quelación (5.35 ± 0.41 vs 6.71
± 1.68, p=0.0028, t =3.24).
En cuanto su estado clínico, 2
pacientes requirieron hospitalización por descompensación
de insuficiencia cardiaca, de
los cuales uno falleció. Los
efectos adversos fueron: Un
paciente con efectos secundarios gastrointestinales, otro
presentó hiperbilirrubinemia,
dos pacientes presentaron elevación de azoados, los cuales
remitieron a la disminución de
la dosis. Conclusiones: la quelación de hierro es necesaria
para inducir la recuperación
hematológica, ya que niveles
elevados de ferritina sérica inducen estrés oxidativo lo que
limita la proliferación de las
células progenitoras. Se pudo
observar una elongación de
la secuencia telomérica a los
6 meses de tratamiento con
quelante de hierro.
Experiencia en el uso de óxido
de hierro coloidal cubierto
de carbohidrato semisintético
para anemia por deficiencia
de hierro en pacientes con intolerancia o falla al tratamiento
con hierro oral
Roberto Ovilla Martínez,
Dannia Calles Payan, Lucía A
Reynolds Ocampo, Gabriela
Ruiz Reyes, Carolina Balderas
Delgado, Andrés Montesinos
Ovilla, Oscar Morales Gutiérrez, Lilian Elizabeth Andrade
Morelos, Álvaro Cabrera García
Hospital Ángeles Lomas,
México, DF
Introducción: la intolerancia al
hierro oral y su bajo porcentaje
de absorción en el intestino
ha provocado que pacientes
con anemia por deficiencia
de hierro fallen al tratamiento
o tengan síntomas de anemia
por mas de 12 semanas hasta la
recuperación de hemoglobina.
El hierro intravenoso es una
alternativa para minimizar el
riesgo de desarrollar los efectos adversos relacionados al
medicamento y maximizar los
beneficios a corto y largo tiempo. El número de pacientes que
tienen acceso al ferumoxitol es
reducido en países en desarrollo. Por lo que la experiencia
en el tratamiento con este tipo
de compuesto de hierro es limitada. Métodos: los pacientes
recibieron ferumoxitol 1020
mg (dos dosis de 510 mg, una
cada semana) y fue evaluada la
respuesta a las 4 semanas de tratamiento mediante el aumento
en los niveles de hemoglobina
y respuesta clínica sin soporte
transfusional. Resultados. De un
total de 30 pacientes el 76.6%
(19) eran mujeres, 7 de ellas
postmenopáusicas. El promedio
de edadfue 45.3 años (21-76
años). Previo al inicio del tratamiento la media de hierro
sérico, ferritina y el índice de
saturación de ferritina fue 35.6
mcg/dL (8-174 mcg/dL), 13.8
ng/mL (1.6-60 ng/mL) y 10.8%
(2-58%) respectivamente. El
promedio inicial de hemoglobina fue 10.5 g/dL (7.1-13.7 g/dL)
logrando una media de 13.03 g/
dL (9.4-16 g/dL) tras 4 semanas,
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
aumentando en promedio 2.52
g/dL (0.3-5.4 g/dL) en 28 días.
El porcentaje de pacientes que
lograron un incremento de
más de 2 g/dL de hemoglobina
fue 70% (21). Los síntomas
iniciales atribuidos a anemia
desaparecieron en 66.6% dentro de las 2 primeras semanas
de tratamiento y el resto en 4 a
5 semanas. Los efectos adversos
mas comunes fueron fatiga en
el 16.6% (5), cefalea 10% (3),
nausea y mareo 10% (3), edema
periférico 6.6% (2) e hipersensibilidad solo en un paciente,
revertida con antihistamínicos.
Conclusión: a pesar del bajo
número de pacientes tratados
debido a la accesibilidad del
medicamento en nuestra población, ferumoxitol ha mostrado
ser una opción atractiva que
rápidamente mejora los síntomas con un perfil de seguridad
satisfactorio.
Correlación entre dosis acum u l a d a d e co li s t i m e t ato
intravenoso y nefrotoxicidad
en pacientes hospitalizados
Dushan Meza Oviedo, Luis
Javier Castro D’Franchis, Emilio
Abraham Reyes Jiménez, José
Óscar Terán González, Miguel
Ángel Labastida Bautista, Leonor Alba Rangel
Servicio de Medicina Interna,
Hospital Central Norte, Petróleos Mexicanos, México, DF
Introducción: el incremento
de infecciones por bacterias
gramnegativas multirresistentes y la ausencia de recursos
terapéuticos ha conducido a
la utilización de colistimetato
de sodio en la practica clínica,
originalmente abandonado debido a su alta nefrotoxicidad.
Los mecanismos de toxicidad
renal no están esclarecidos pero
se considera que son dosis-dependientes. Métodos: cohorte
retrospectiva de 4 años en que
se incluyeron 24 pacientes que
recibieron colistimetato intravenoso por mas de 72 horas en
el Hospital Central Norte para
determinar la correlación entre
dosis acumulada de colistimetato y nefrotoxicidad, la cual
fue definida en base a la clasificación de AKIN. Se realizó
un análisis bivariado, ShapiroWilk, Mann-Whitney, X2 y
Correlacion de Spearman. Resultados: 11 pacientes (45.83%)
desarrollaron nefrotoxicidad.
AKIN Grado I (18.18%) Grado II
(27.27%) y Grado III (54.54%).
La media de dosis acumulada
en los pacientes con nefrotoxicidad fue de 2700 mg vs 2400
mg de los que no desarrollaron
(p=0.18), la dosificación mg/
kg/día (4.53 vs 3.61, p=0.67).
Como predictor independiente
para nefrotoxicidad, 81.81% de
los pacientes con lesión renal
aguda tienen diagnostico de
diabetes mellitus (p=0.047, IC
95%). Conclusiones: la incidencia de nefrotoxicidad (45.83%)
es similar a la reportada. No
hay relación significativa entre
dosis-acumulada o dosis-mg/
kg/día y nefrotoxicidad, sin
sobrepasar 5mg/kg/día reportados en estudios similares. El
hallazgo más relevante fue el
factor de riesgo independiente
para desarrollar nefrotoxicidad
encontrado en pacientes con
diagnostico previo de diabetes
mellitus; por lo cual resulta
adecuado monitorizar estrechamente la función renal en
todos los pacientes que reciben
colistimetato, y evitar su uso
en aquellos con diagnostico
previo de diabetes, lo cual es
consistente con estudios recientemente publicados.
Multirresistencia antimicrobiana de Escherichia coli en
urocultivos
Ofelia María Rosales Del Real,
Luis Javier Castro D’Franchis,
Abraham Emilio Reyes Jiménez,
José Óscar Terán González, Miguel Ángel Labastida Bautista,
Mónica Cavazzani Silva
Medicna Interna, Hospital Central Norte, Petróleos Mexicanos,
México, DF
Introducción: las infecciones
del tracto urinario (ITU) son
las infecciones bacterianas
más frecuentes en pacientes
ambulatorios y hospitalizados.
Es la primer causa de hospitalización, sepsis grave y
choque séptico en el Hospital Central Norte. La bacteria
más prevalente es Escherichia
coli. La multirresistencia se
define cuando una bacteria es
resistente a tres o más antimicrobianos. La multirresistencia
de Escherichia coli es de 7.1%
en los cultivos, favorecida con
los siguientes factores de riesgo:
S153
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
género masculino, edad >65
años y hospitalización. Material
y método: estudio retrospectivo, descriptivo, analítico para
determinar la multirresistencia
antimicrobiana de Escherichia
coli aislada de urocultivos realizados en el Hospital Central
Norte de Petróleos Mexicanos
del 01 de enero al 31 de diciembre de 2013 con análisis
descriptivo con frecuencias y
porcentajes. Se realizó prueba de X2 para determinar las
diferencias entre multirresistencia, género y servicio tratante,
entre otros. Resultados: se obtuvieron 1064 urocultivos con
crecimiento bacteriano, se
excluyeron 72, la prevalencia
de Escherichia coli fue 80.1%.
El rango de edad fue de 18 a
97 años (media 69 años). La
prevalencia de multirrresistencia general fue de 68.9%,
siendo mayor en el género
masculino (87%) que en el femenino (64.5%) (p <0.001). El
servicio con mayor frecuencia
de multirresistencia fue endocrinología (79.3%) y menor
ginecología (50%), siendo esta
diferencia significativa con una
p < 0.001. Los pacientes mayores de 65 años tuvieron mayor
frecuencia de multirresistencia
(p <0.05). El análisis de resistencias arrojó porcentajes altos
de resistencia para ampicilina
(76.5%), quinolonas (73.5%)
y trimetoprim/sulfametoxazol
(59.3%), y resistencia baja para
carbapenémicos (1%), nitrofurantoína (18.3%) y piperacilina/
tazobactam (21.7%). Conclu-
S154
siones: si bien, la prevalencia
y factores de multirresistencia
de Escherichia coli son similares a otros centros de México
y América Latina, derivado de
este estudio se instauran lineamientos de prevención de ITU
y guías de tratamiento local
para consulta externa y hospitalización con el objetivo de
disminuir la multirresistencia
las complicaciones, la estancia
hospitalaria y los costos.
Valor pronóstico de la procalcitonina en la práctica clínica
Javier Guillermo Domínguez
Herrera
Medicina Interna, Hospital Ángeles León
Introducción: la procalcitonina
es un reactante de fase aguda
que ha demostrado utilidad en
el diagnóstico de sepsis y sepsis
severa, pero su valor pronóstico no ha sido concluyente.
Objetivo: identificar el valor
pronóstico de la Procalcitonina
en pacientes con sospecha de
sepsis o sepsis severa. Material
y métodos: pacientes hombres y
mujeres, ingresados al hospital
de marzo a agosto de 2014,
con diagnóstico de sepsis o
sospecha de sepsis, con determinación de procalcitonina
(clasificándolo en: <0.5 negativa, ≥0.5 <2 posible sepsis, ≥2
<10 sepsis y ≥10 sepsis severa),
se evaluó signos vitales, diagnóstico de ingreso, biometría
hemática, días de estancia hospitalaria (DEH) y mortalidad. Se
realizó coeficiente de correla-
ción de Pearson, prueba t para
muestras independientes y c2.
Se Utilizó SPSS v21. Resultados: se evaluaron 48 pacientes,
62% varones, con un promedio
de edad de 60.4 ± 18.9 (24-94),
20% con patología abdominal,
17% urinaria y 63% miscelánea, con un promedio de DEH
de 10.14 ± 7.7 (1-35). El 58.6%
presento procalcitonina positiva
con un promedio de 5.3 ± 4.3
(0.5-10). De los cuales 30.5%
con sospecha de sepsis (0.52 ng/mL), 36.1% con sepsis
(2-10 ng/mL) y 33.4% con
sepsis severa (>10 ng/mL). Se
documentó una mortalidad de
20.7%. La procalcitonina fue
positiva en el 66.7% vs 54.5%
(fallecieron vs no fallecieron)
con p=0.602, las concentraciones de procalcitonina fue
de 4.1 vs 2.6 ng/mL (fallecieron
vs no fallecieron) con p=0.177,
la mortalidad de los pacientes
con Procalcitonina mayor a 10
ng/mL fue de 50% vs 22.3%
(p 0.146). Los DEH fueron de
11.53 vs 8.17 (procalcitonina positiva vs negativa) con
p=0.256. Los DEH en pacientes
con sepsis severa fue de 11.57
vs 9.68 (p=0.583). Las concentraciones de procalcitonina se
correlacionaron con la concentración de neutrófilos r 0.435 (p
0.021), concentración total de
leucocitos r 0.466 (p 0.12) pero
mayor con la concentración
de bandas r 0.583 ( p 0.001)
así como con la frecuencia
cardíaca con una r 0.452 (p
0.016). Conclusión: la concentración de procalcitonina se
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
correlaciona con la frecuencia
cardíaca y concentraciones de
leucocitos (neutrófilos y bandas). La mortalidad y los DEH
pueden estar asociados a la
presencia y concentración de
procalcitonina y más aun en
cuando las concentraciones son
mayor a 10 ng/dL. Comentario:
las diferencias no significativas
pueden ser por la potencia, se
sugiere incrementar muestra.
Síndrome metabólico y tratamiento antirretroviral
Ciro Marco Vinicio Porras
Méndez, Luis Javier Castro
D’Franchis, Abraham Emilio
Reyes Jiménez, José Óscar Terán
González, Ofelia María Rosales
Del Real, María Berenice Rodríguez y Rodríguez, Dushan
Meza Oviedo, Araceli Cruz
Rodríguez
Medicina Interna, Hospital
Central Norte de Petróleos
Mexicanos, México, DF
Introducción: en la actualidad
la infección por el virus de la
inmunodeficiencia humana,
se considera como una enfermedad crónica debido al uso
de la terapia antirretroviral,
misma que ha prolongado la
sobrevida de los pacientes infectados, sin embargo, se asocian
al desarrollo de patologías no
relacionadas a la misma, como
es el síndrome metabólico y
el riesgo elevado de muerte
cardiovascular. Este trabajo
muestra la prevalencia y el grupo antirretroviral mayormente
asociado a síndrome metabó-
lico en los pacientes adscritos
a la clínica de VIH del HCN de
PEMEX. Descripción: se realizó
un estudio descriptivo, observacional, retrospectivo, transversal
donde se revisó en el expediente
electrónico, el perfil metabólico y esquema antirretroviral
de los pacientes con VIH; los
datos obtenidos se analizaron
estadísticamente con la prueba
de c2. Resultados: se encontró
SM en 35 de los pacientes
con tratamiento antirretroviral
(87.5%), 29 (82.9%) hombres y
6 (17.1%) mujeres. La alteración
metabólica más frecuente fue la
hipertrigliceridemia (92.5) y la
menos frecuente el perímetro
abdominal (5%).El grupo de
fármacos que mostró mayor
asociación a síndrome metabólico fueron los Inhibidores
Nucleósidos de transcriptasa
reversa (74.5%), sin embargo
no se encontró una diferencia
significativa con otros grupos
de antirretrovirales (p=0.32).
Conclusiones: la prevalencia
de SM encontrada fue mayor a
la reportada en estudios similares (25-45.4%), lo cual puede
estar en relación con factores
de riesgo propios de la población de esta clínica de VIH,
independientes a la infección y
antirretrovirales, lo que implica
mayor riesgo cardiovascular y
la necesidad de aplicar medidas de prevención primaria y
secundaria más estrictas para
disminuir la morbimortalidad
asociadas, así como los costos
derivados de las complicaciones
de las mismas.
Tenofovir y osteoporosis en
pacientes con VIH
Luis Javier Castro D’Franchis,
Emilio Abraham Reyes Jiménez,
Araceli Cruz Rodríguez
Hospital Central Norte de Petróleos Mexicanos, México, DF
Introducción: la osteoporosis
es común en pacientes con
VIH. El advenimiento de la
terapia HAART en las últimas
dos décadas condujo a una
marcada mejoría en la enfermedad, transformándola en una
enfermedad crónica. La tasa
de prevalencia de osteopenia
en cohortes infectadas por el
VIH ha sido descrito que van
desde 22% a 71% con tasas de
osteoporosis que varían de 3%
a 33%. La OMS clasifica la densidad mineral ósea en mujeres
postmenopáusicas y hombres
mayores de 50 años, un T score
menor o igual a -2.5 en cadera
o columna lumbar se define
como osteoporosis. Osteopenia
es como un T score entre -1 y
-2.49. Para pacientes menores
de 50 años, el Z score es preferido, un valor menor o igual
a -2.0 se considera anormal.
Metodología: estudio observacional, descriptivo, transversal.
Se incluyeron 33 pacientes portadores de VIH en tratamiento
antirretroviral con transcriptasa
inversa análogo de nucleótido
(tenofovir) y se determinó su
relación con densidad mineral
ósea. Como herramienta diagnóstica se utilizó densitometría
ósea. Se utilizaron frecuencias absolutas y relativas, las
S155
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
variables cuantitativas se representaron mediante la media.
Se utilizó c2 para el cálculo de
la contingencia de la variable
tratamiento. Resultados: el
4.3% de la muestra presentó
osteoporosis, osteopenia 56.5%
y resultado normal el 39.1%
de la población contenida en
la muestra. También se calculo
la contingencia entre las variables carga viral y densitometría
ósea donde encontramos que
los pacientes con carga viral
indetectable tienden a presentar
osteopenia hasta en el 85.8%
de los pacientes. El cálculo de
de la contingencia cuadrática
de tratamiento es la única que
responde cuantitativamente a la
comprobación de la hipótesis
encontrando una p < 0.03 representando que los pacientes
que utilizan tenofovir como
parte de su tratamiento presentan osteopenia no importando
de forma considerable ni carga
viral, ni tiempo de evolución
de la enfermedad. Conclusión:
existe mayor número de casos
de disminución de densidad
mineral ósea en relación con el
uso de tenofovir (transcriptasa
inversa análogo de nucleótido).
Por lo tanto el uso de Tenofovir
desarrolla osteopenia en los
pacientes. No se encontró relación con el tiempo de uso de
antiretroviral ni carga viral.
Conocimiento y actitud frente
a la transmisión ocupacional
de tuberculosis
Sandra G Galindo Alvarado,
Luis A Rendón Pérez, Dionicio
S156
A Galarza Delgado, Miryam E
Galindo Alvarado
Hospital Universitario Dr. José
Eleuterio González, Monterrey,
Nuevo León
Introducción: la tuberculosis
es una enfermedad infecciosa
responsable de 8.8 millones
de casos y 1.6 millones de
muertes cada año. Es considerada una de las enfermedades
infectocontagiosas con mayor
impacto para la salud pública
mundial. El conocimiento y la
actitud del personal médico
es importante para el correcto
desarrollo de los programas de
lucha contra la tuberculosis. Se
han realizado algunos estudios
del nivel de conocimiento que
se tiene de la tuberculosis en
el personal médico y otros
enfocados al paciente con
tuberculosis acerca de la información que recibe, y se han
obtenido resultados negativos.
Material y método: se realizó
una encuesta para evaluar el
conocimiento y actitud del
personal de salud con respecto
a la transmisión ocupacional de
tuberculosis, la encuesta consta
de 47 preguntas con un máximo de 95 puntos, las cuales
se validaron por medio de un
panel de expertos, además de
la realización de una prueba
piloto para verificar la validez
de constructo y posterior al
proceso de validación se inició
la aplicación de dicha encuesta
al personal médico en formación de diversas especialidades
tales como Medicina Interna,
Cirugía general, Otorrinolaringología, Medicina familiar,
Anestesiología, así como subespecialidades como Neumología
e Infectología, evaluándose
los resultados. Resultados: se
aplicaron 103 encuestas de las
cuales, 41 fueron contestadas
por Residentes de Medicina
Interna, 13 de anestesiología,
21 de cirugía general, 4 de neumología, 3 de Infectología, 11
de medicina familiar, 10 de otorrinolaringología, obteniendo
los siguientes Resultados: Promedio de respuestas correctas
según especialidad: Anestesiología 67.45%, Medicina Interna
76.6%, Cirugía general 70.77%,
Neumología 83.15%, Infectología 83.85%, Medicina Familiar
70.43%, Otorrinolaringología
71.89%, con un promedio
general 73.63%. Comentarios
y Conclusiones: aun con que
es un porcentaje de conocimientos que pasa del 70% y se
considera que es adecuado, es
necesario reforzar conocimiento básico, ya que es primordial
que el personal de salud tenga
el mayor conocimiento posible
acerca de la patología para
prevenir, diagnosticar y dar
tratamiento oportuno, además
de proteger al mismo personal
ya que se han reportado varios
casos en residentes.
Comportamiento de las variables bioquímicas en los
pacientes hospitalizados por
dengue
Karla Gabriela Peniche Moguel, 1 Dalia Denisse Zúñiga
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Vázquez, 1 Josué Eli Villegas
Domínguez,2 Daniel de Jesús
Salazar Andrade,1 Daniel Alejandro Barrera Amorós,1 Celia
Denisse Cavildo Jerónimo, 1
Antonio Flores Morgano,1 Pablo César Torres Oseguera, 1
Diana Carolina Méndez Tino,1
Omar Vargas Esparza,1 Alonso
Alor Iturralde,1 Belén Medina
Manrique, 1 Verónica Montes
Martínez1
1
Medicina Interna, Hospital de
Alta Especialidad de Veracruz,
Secretaría de Salud, Veracruz,
Veracruz
2
Universidad Veracruzana,
Veracruz, Veracruz
Introducción: el dengue es
una enfermedad infecciosa
de etiología viral; se caracteriza por una variación en
las manifestaciones clínicas
y bioquímicas, con evolución
y resultados inciertos. Objetivo: describir las variables
bioquímicas de los pacientes
hospitalizados con diagnóstico de dengue en el HAEV.
Material y método: estudio
observacional, descriptivo
y transversal. Se incluyeron
pacientes mayores de18 años
que ingresaron al HAEV en
julio y agosto del 2014 con
el diagnóstico de dengue
positivo para NS1. Se recolectaron los niveles séricos
de hemoglobina, hematocrito,
plaquetas, leucocitos, linfocitos, albúmina, transaminasa
glutámico oxalacético (TGO) y
pirúvico (TGP); las mediciones
se hicieron desde el ingreso,
estancia y egreso hospitalario.
Se utilizó estadística descriptiva, frecuencias y porcentajes.
Resultados: se examinaron 60
pacientes con promedio de
edad de 34.1 (DE±12.9) años,
33 (55%) mujeres y 27 (45%)
hombres. Se observó que
acudieron a valoración 5.2
(DE±2.3) días posterior al inicio de los síntomas, cursando
con 4.6 (DE±1.6) días de hospitalización. A su ingreso con
valores séricos de Hto 40.4
(DE±5.9), Hb 13.8 (DE±2.48),
PLT 61.54 (DE±51.77), leucocitos 4.1 (DE±1.68), linfocitos
1.2 (DE±1.11) neutrófilos 2.1
(DE±1.3), Alb 2.1 (DE±1.8),
TGO 91.1 (DE±110.0), TGP
60.0 (DE±75.96); se realizó
la comparación entre valores
de ingreso, estancia y egreso
hospitalario por medio de
prueba de Kruskal-Wallis de
una vía, registrando diferencia
estadísticamente significativa
en TGO (p=<0.001),el resto
de las variable resultaron sin
significancia. Se observó que
el nadir de la trombocitopenia se presenta en el día 2 de
estancia hospitalaria mientras
el cenit de TGP y TGO al día
5. Conclusiones: hay retraso
en la búsqueda de la atención
médica, lo que conlleva a mayor riesgo de deshidratación
y hemoconcentración. La
presencia de transaminasemia
en especial de TGO requiere
mayor estudio de correlación
a daño hepático, miocárdico
o muscular ocasionado por el
dengue virus.
Manifestaciones gastrointestinales, hemorrágicas y
dermatológicas más frecuentes
en pacientes hospitalizados por
dengue
Karla Gabriela Peniche Moguel, 1 Dalia Denisse Zúñiga
Vázquez, 1 Josué Eli Villegas
Domínguez,2 Daniel de Jesús
Salazar Andrade,1 Daniel Alejandro Barrera Amorós,1 Celia
Denisse Cavildo Jerónimo, 1
Antonio Flores Morgano,1 Pablo Cesar Torres Oseguera, 1
Diana Carolina Méndez Tino,1
Omar Vargas Esparza,1 Alonso
Alor Iturralde,1 Belén Medina
Manrique, 1 Verónica Montes
Martínez1
1
Hospital de Alta Especialidad
de Veracruz, Veracruz, Ver.
2
Universidad Veracruzana,
Veracruz, Ver.
Introducción: el dengue es una
enfermedad infecciosa aguda.
Los síntomas sistémicos incluyen nausea, vómito y diarrea
así como hemorragia. Objetivo:
describir los síntomas gastrointestinales, hemorrágicos y
dermatológicos más frecuentes
en pacientes hospitalizados
con diagnóstico de dengue en
el HAEV. Material y métodos:
estudio, observacional, descriptivo y transversal. Se incluyeron
pacientes mayores de 18 años
que ingresaron al HAEV en
julio y agosto del 2014 con el
diagnóstico de dengue positivo
para NS1. Se recolectaron del
expediente clínico los síntomas gastrointestinales de
nausea, vómito, diarrea y dolor
S157
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
abdominal, así como la presencia de hemorragia y lesiones
dermatológicas; se utilizó estadística descriptiva, frecuencias
y porcentajes. Resultados: se
examinaron 60 pacientes con
promedio de edad de 34.1
(DE±12.9) años,33 mujeres
(55%) y 27 hombres (45%). La
presencia de síntomas gastrointestinales se reportó en el 76%
de la población, en donde la
asociación de nausea y vómito
fue en 18 pacientes (30%), náusea, vómito y dolor epigástrico
en 9 pacientes (15%), nausea,
vómito y diarrea en 3 pacientes
(5%), dolor epigástrico en 9 pacientes (15%), dolor epigástrico
con diarrea en 2 pacientes (3%),
diarrea en 4 pacientes (6%),
hepatalgia en 1 paciente (1%).
El 35% de la muestra reportó
hemorragia, con epistaxis en 5
pacientes (8%), gingivorragia en
5 pacientes (8%), gingivorragia
y petequias en 2 pacientes
(3%), gingivorragia y sangrado
transvaginal (STV) en 1 paciente
(1%), petequias en 8 pacientes
(13%), 1 paciente (1%) con STV.
Las lesiones dermatológicas
presentadas fueron 6 pacientes
(10%) con prurito y 54 (90%)
sin lesiones. Conclusiones:
los síntomas gastrointestinal
son frecuentes en pacientes
con dengue, la hemorragia en
mucosas es la principal forma
de sangrado. Las lesiones dermatológicas no son habituales.
Se espera en próximos trabajos
establecer la asociación entre
la cifra de trombocitopenia y la
hemorragia.
S158
Impacto de la tobramicina
inhalada en pacientes con infecciones crónicas bronquiales
Ricardo Daniel García Sepúlveda,1 Juan Manuel Sánchez
Sánchez,2 Cesar Cruz Lozano,2
Ernesto Atenogénesis Cepeda
Vargas, 2 Felicitas Pérez Sánchez2
1
Médico residente de segundo
año
2
Médico internista
Departamento de Medicina Interna, Hospital Regional de Pemex,
Ciudad Madero, Tamaulipas
Introducción: la enfermedad
pulmonar obstructiva crónica
se caracteriza por la presencia
de obstrucción crónica y poco
reversible al flujo aéreo. Los
procesos infecciosos bacterianos o virales son la causa más
frecuente de exacerbaciones.
Dentro las bacterias que causan
las exacerbaciones se encuentra
Pseudomonas aeruginosa la
cual su presencia puede liderar
una sobreexpresión de mediadores pro inflamatorios. En los
cuales los antibióticos convencionales juegan papel limitado.
La utilización de antibióticos
por vía inhalada es una práctica
cada vez más habitual estos han
demostrado diferentes efectos
positivos en el desenlace de los
pacientes. Material y método:
se realizó un estudio prospectivo ,descriptivo , observacional.
Los criterios de inclusión fueron
presencia infecciones crónicas
bronquiales no fibrosis quística,
que no respondan al manejo convencional (5 días con
antimicrobiano sin respuesta
clínica ni radiológica), recibirán
tobramicina inhalada sola o en
combinación, los parámetros
que se evaluaron fueron; disminución de glóbulos blancos,
mejoría clínica y radiológica,
disminución en el número de
reingresos hospitalarios. Resultados: se han estudiado
12 pacientes, con una edad
mediana de 76 años (60-91),
6 femeninos y 6 son hombres.
Al ingreso presentaron una
cuenta leucocitaria media de
14.900 (5.6 -24.00)x10 3/uL.
En 9 presentaban cultivo positivo en expectoración con
Pseudomonas sp, 1 para Klebsiella pneumoniae y 1 E. coli
espectro ampliado, a su egreso
la cuenta leucocitaria disminuyo en todos los casos,media
9.5 (5.9 -15.1) x10 3 /uL. La
creatinina promedio al inicio
de tratamiento fue de 1.23
(0.3-1.53) mg/dL y al final 1.22
(0.32-1.54) mg/dL. En ninguno
se reportó eventos adversos a la
administración de tobramicina.
Al seguimiento solo uno (8%)
reingreso por cuadro de sepsis
pulmonar. Comentarios y Conclusiones: se ha demostrado el
uso de tobramicina inhalada
en pacientes con enfermedad
pulmonar con fibrosis quística
una disminución en reingresos
hospitalarios por Pseudomonas
aeruginosa demostrados por
diversos estudios, sin embargo
no se ha demostrado la importancia del uso de tobramicina
en pacientes con enfermedad
pulmonar crónica no fibrosis
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
quística con infecciones por
Pseudomonas aeruginosa por
lo que nosotros demostramos
en este estudio una importante
mejoría del paciente asi como
disminución en el número de
reingresos hospitalarios y además demostró seguridad de su
uso en todos los pacientes.
StatLock ® versus sutura convencional en la fijación de
catéteres venosos centrales
y hemodiálisis en el paciente
hospitalizado
Dania Lizet Quintanilla Flores,
Mónica Sánchez Cárdenas,
Alexandro Atilano Díaz, María
Teresa Ramírez Elizondo, Laura
Baena Trejo, Dionicio Ángel
Galarza Delgado, Miguel Ángel
Villarreal Alarcón, Juan O Galindo Galindo
Departamento de Medicina Interna, Hospital Universitario Dr.
José Eleuterio González, Universidad Autónoma de Nuevo
León, Monterrey, Nuevo León
Introducción: en pacientes
hospitalizados es habitual el uso
de catéteres venosos centrales
(CVC) así como de hemodiálisis
(HD) en el tratamiento intravenoso de pacientes críticamente
enfermos y en enfermedad renal crónica terminal. Su uso se
asocia a complicaciones que
incluyen flebitis, trombosis,
infección local, desplazamiento
y bacteremias, lo cual resulta en
retiro prematuro del catéter así
como incremento de morbimortalidad hospitalaria. Material y
método: se realizó un ensayo
clínico controlado con el objetivo de evaluar la frecuencia
de complicaciones asociadas a
la fijación de accesos venosos
centrales comparando el uso de
sutura convencional versus el
dispositivo de fijación Statlock®.
Se incluyeron 41 pacientes
mayores de 16 años hospitalizados en la sala de Medicina
Interna. Se evaluaron variables
demográficas, indicaciones de
colocación, tipo de catéter,
proporción de punciones inadvertidas por el personal de salud
durante la fijación del catéter,
tiempo de fijación, complicaciones infecciosas, desplazamiento
del CVC y necesidad de nueva
fijación del catéter. Resultados: se realizó la fijación con
el dispositivo Statlock® en 19
pacientes y sutura en 22 pacientes. La media de edad fue de
50.1±14.1 años, 58.5% hombres. La proporción de pacientes
con CVC y HD fue similar en
ambos grupos. Las principales
indicaciones de instalación
incluyeron administración de
medicamentos, aporte de volumen, vigilancia hemodinámica e
inicio de hemodiálisis. No existieron diferencias en los tiempos
de instalación ni de fijación de
los catéteres. Durante la fijación
se presentaron 3 eventos de
punciones inadvertidas por el
personal de salud del grupo de
sutura. La prevalencia de complicaciones locales fue mayor
en el grupo de sutura (56.6%
vs 26.3%, p=0.028), predominando eritema local, fijación en
malas condiciones y trastornos
de flujo. La tasa de bacteremias
x 1000 días catéter, así como
de nueva fijación fue similar en
ambos grupos. La necesidad de
curaciones x 1000 días catéter
fue menor en el grupo Statlock®
en comparación al grupo con
sutura. Conclusiones: el dispositivo Statlock® para fijación de
CVC y HD se asocia significativamente a menor proporción
de complicaciones locales sin
repercusión en tasa de bacteremias x 1000 días catéter. La
fijación con Statlock requiere
menor necesidad de curaciones debido a fijación en malas
condiciones. Recomendamos
el dispositivo Statlock® en la
fijación de accesos vasculares
centrales en el paciente hospitalizado.
Abscesos hepáticos criptogénicos causados por Klebsiella
pneumoniae hipermucoviscosa, secundarios a la cepa K1
portadora del Gen magA+
Jorge García Méndez,1 A Schcolnik Cabrera, 2 M Moreno
Morales, Rigoberto Hernández
Castro2
1
Departamentos de Posgrado
y Educación Médica Continua,
Instituto Nacional de Cancerología (INCan), Microbiología
y Parasitología, Facultad de
Medicina, UNAM, México, DF
2
Departamento de Ecología de
Agentes Patógenos, Hospital
General Dr. Manuel Gea González, México, DF
Objetivo: desde hace dos
décadas, ha sido notable el
S159
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
incremento de abscesos hepáticos por cepas de Klebsiella
pneumoniae adquiridas en la
comunidad –este de Asia–. En
México recientemente se hizo
la descripción clínica del síndrome, sin embargo éste es el
primer reporte de la tipificación
molecular en casos con características clínicas y fenotípicas
casi idénticas pero sin ninguna
relación epidemiológica entre
sí. Material y método: dos
cepas de Klebsiella pneumoniae fueron aisladas de tejido
hepáticos de dos pacientes
sometidos a segmentectomía
en dos Centros Hospitalarios
de tercer nivel de la Ciudad de
México durante el año 2013.
Posteriormente, las cepas fueron sembradas en agar TSA y
se les realizó PCR multiplex con
los iniciadores mostrados abajo.
El protocolo de PCR utilizado
está descrito con anterioridad. Gen iniciador tamaño
producto rmpA F 5'-ACTGGGCTA C C T C T G C T T CA - 3 ' R
5'-CTTGCATGAGCCATCTTTCA-3'
536 pb Aerobactina F 5'CTGTCGGCATCGGTTTTATT3' R 5'-TGGCGTGTCG AT TAT TA C CA - 3 ' 5 3 1
p b k f u F 5 ' - G A AG T G A CGCTGTTTCTGGC-3'R
5 ' - T T T C G T G T G G C CAG TGACTC-3' 797 pb allS F
5'-CCGAAACATTACGCACCTTT3' R 5'-ATCACGAAGAGCCAGGTCAC-3' 508 pb magA F 5'G G T G C T C T T TACAT CAT TG C - 3 ' R 5 ' - G CA AT G G C CATTTGCGTTAG-3' 1282 pb
k 2 A F 5 ' - CA A C CAT G G -
S160
T G G T C G AT TAG - 3 ' R 5 ' T G G TAG C CATAT C C C T T TGG-3' 900 pb Los productos de
amplificación se visualizaron
en un gel de agarosa (1.5%),
teñidos con SYBR® Green Gel
Stain. Resultados: después
de analizar los productos de
amplificación se encontró que
ambas cepas eran positivas a:
Gen kfu que codifica para un
sistema de quelación del hierro, Gen de aerobactina que
codifica para un sideróforo,
Gen allS que codifica para el
metabolismo de la alantoína
–un intermediario metabólico
mayor–, Gen magA que codifica para el serotipo K1, asociado
al fenotipo hipermucoviscoide.
Las cepas fueron negativas
para el Gen rmpA (k2A) que
codifica para el serotipo K2.
Conclusiones: hay genes específicos de serotipos, para
K1 (magA) y para K2 (K2A).
Los serotipos K1 y K2 son más
resistentes a la fagocitosis que
los no-K1, no-K2. El serotipo
K1 es el factor de virulencia
más importante para abscesos
hepáticos con infección metastásica. Los genes de virulencia
cromosomales, kfu y allS están
significativamente relacionados con la alta agresividad de
los abscesos hepáticos por este
germen.
Relación de anemia e inflamación con resistencia a
eritropoyetina en hemodiálisis
María Berenice Rodríguez y
Rodríguez, Luis Javier Castro
D’Franchis, Abraham Emilio
Reyes Jiménez, César Augusto
Urtiz López
Clínica de Hemodiálisis, Departamento Nefrología, Hospital
Central Norte, PEMEX, México, DF
Introducción: el déficit de
eritropoyetina es el factor dominante de los mecanismos
patogénicos de la anemia de
la enfermedad renal crónica
(ERC). El diagnóstico de anemia
se establece con hemoglobina
≤ 11g/dL en estadios 3, 4 y 5
de la ERC. La efectividad de
la respuesta a la estimulación
eritropoyética se puede evaluar
con el índice de resistencia a
eritropoyetina (IRE –relación
entre la dosis administrada de
agentes estimulantes y las concentraciones de hemoglobina).
Se define resistencia con un
IRE ≥ 10. Causas de resistencia son: deficiencia de hierro,
vitaminas, intoxicación por
aluminio, hiperparatiroidismo
secundario, fibrosis de médula
ósea, procesos inflamatorios
crónicos, infecciones, desnutrición, neoplasias, enfermedades
autoinmunes, deficiencia de
carnitina, deficiencia de piruvatoquinasa, hemoglobinopatías,
etc. La resistencia condiciona
inflamación de bajo grado con
incremento de citocinas inflamatorias, PCR, disminución de
albumina, cuenta linfocitaria,
etc. Material y método: estudio
observacional, prospectivo,
longitudinal, comparativo,
se tomó biometría hemática,
cinética de hierro, hormona
paratiroidea, proteína C reac-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
tiva para medir la resistencia a
la eritropoyetina con pacientes
tratados con 2 tipos diferentes
de eritropoyetina. Se utilizaron
frecuencias absolutas y relativas, las variables cuantitativas
se representaron mediante
la media y se correlacionaron mediante el coeficiente
de Pearson. Resultados: del
total de pacientes (n= 48) se
observó una diferencia significativa entre el IRE y el tipo
de eritropoyetina (p<0.05), la
media de hemoglobina fue 9.5
g/dL en los pacientes tratados
con epoetin beta vs 10.08 g/
dL de los que usaron metoxi
polietilenglicol epoetin beta.
En cuanto a los marcadores inflamatorios solo se observó una
correlación inversa entre PCR
y los niveles de hemoglobina
en los pacientes tratados con
metoxi polietilenglicol epoetin
beta (p<0.05). El resto no presento diferencia significativa.
Conclusiones: este estudio
muestra como el incremento de
PCR y la anemia influyen en la
resistencia a eritropoyetina con
el uso de dos tipos diferentes
de eritropoyetina en pacientes
con ERC en hemodiálisis.
Características clínicas de
pacientes con cáncer y lesión
renal aguda en un centro de
atención de cáncer
Rafael Saavedra Pérez Salas,
Alain Sánchez Rodríguez, Javier
Zúñiga Varga
Servicio de Medicina interna,
Centro Médico ABC, México,
DF
Introducción: existe poca
información sobre las características clínicas de pacientes
con diagnóstico de cáncer
que cursan con lesión renal
aguda (LRA) durante su estancia intrahospitalaria, tipos
de cáncer más frecuentemente asociados y el estadio de
acuerdo a las clasificaciones
de LRA por AKIN y RIFLE.
Objetivos: describir las características clínicas de pacientes
con cáncer y LRA a su ingreso,
identificar los tipos de cáncer
más frecuentemente asociados,
clasificar a los pacientes de
acuerdo a AKIN y RIFLE e identificar las complicaciones más
frecuentes durante su estancia
intrahospitalaria. Material y
método: estudio descriptivo,
trasversal que incluyó pacientes que acudieron al centro
médico ABC observatorio durante el periodo comprendido
entre enero de 2010 y marzo
de 2014 con diagnóstico de
cáncer y falla renal aguda,
obtenidos éstos mediante registros del departamento de
bioestadística. Se colectaron
variables demográficas, clínicas y de laboratorio. Los datos
obtenidos para este estudio se
obtuvieron de forma retrospectiva del expediente clínico.
Resultados: se incluyeron 67
pacientes, 48 (71.6%) hombres
y 19 (28.4%) mujeres, edad de
67 ± 15.6 años. Con tumores
sólidos y hematológicos en
el 73 y 27%, respectivamente. Los tumores sólidos más
frecuentes fueron cáncer de
colon, próstata y urotelial. Los
tumores hematológicos más
frecuentes: mieloma múltiple,
leucemia mieloide aguda y linfoma no Hodgkin. El 8% de los
con diagnóstico de un segundo
primario, con mayor frecuencia, de tiroides; el tiempo de
evolución del tumor primario
2 ± 2.9 años. ECOG al ingreso
10.4% en grado 1, el 16.4% en
grado 2 y 6% en grado 3. Ingreso a unidad de terapia intensiva
en el 23% y 16% fueron sometidos a terapia sustitutiva de la
función renal con hemodiálisis, ninguno recibió diálisis
peritoneal. Cinco pacientes
(6.5%) fallecieron. El 62% se
encontraba en tratamiento
actual con quimioterapia,
17.9% radioterapia y 17.9%
quirúrgico. La clasificación de
AKIN al ingreso, el 43.3% se
encontraba en dentro del estadio 1, el 29.9% en el estadio
2 y el 26.9% en el 3. Dos de
estos pacientes no cumplieron
criterios para la clasificación
RIFLE. Del resto, el 29.9%
se clasificó como clase R,
el 38.8% como I y el 28.4%
como F. Conclusiones: la mayoría de los pacientes tuvieron
tumores sólidos. Enfermedad
grave con ingreso a UTI del
23% y el 16% con terapia de
sustitución renal. La mayoría
de los pacientes se concentró
en AKIN grado I y RIFLE grado
R a su ingreso.
Presencia de albuminuria en
pacientes con diabetes tipo 2
de la Clínica 31 del IMSS, DF
S161
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
José de Jesús Peralta Romero,
Anayeli Martínez Zúñiga, Perla
Aleidy Mundo Nava, Mariana del
Rocío Hernández Velasco, Verónica Leonor Bracamonte Curiel,
Teresa Alvarado Gutiérrez, Leticia
Ramírez Bautista, Car
Unidad de Investigación Médica en Bioquímica, Hospital de
Especialidades, Centro Médico
Nacional Siglo XXI, IMSS, México, DF
Unidad de Medicina Familiar
número 31, IMSS, México, DF
Servicio de Medicina Interna del
HGZ núm. 25, IMSS, México, DF
Introducción: la ENSANUT
2012 reporta 1.4% de los pacientes identificado con DT2
en diálisis. La albuminuria es
el principal marcador para
detectar nefropatía diabética incipiente, por lo tanto la
medición de albuminuria es
importante para el adecuado
abordaje y manejo del paciente
diabético y prevenir el progreso
de la enfermedad renal y cardiovascular. Descripción del
estudio: se realizó un estudio
transversal observacional para
determinar la correlación de
la presencia de albuminuria
con alteraciones antropométricas y bioquímicas en 216
pacientes de 30 a 55 años
de edad con diabetes tipo 2
procedentes de la UMF 31 del
IMSS, previo consentimiento informado. Se excluyeron
pacientes con enfermedad
cardiovascular, autoinmunes,
infecciones y neoplasias presentes. La albuminuria fue
S162
determinada por método de
turbidimetria (BioSystems S.A.)
con anticuerpos anti-albúmina
humana en muestra de orina
matutina. Los participantes
se clasificaron en tres grupos,
con normoalbúmina (<30),
microalbuminuria (30-300)
y macroalbuminuria (≥300).
Resultados: 120 sujetos presentaban albumina normal, 59
microalbuminuria (nefropatía
incipiente) y 37 macroalbuminuria (nefropatía abierta).
Existe tendencia de parámetros
bioquímicos más alterados
en presencia de macroalbuminuria. El análisis bivariado
muestra que a mayor tiempo
de evolución de diabetes, antecedentes de hipertensión,
retinopatía y neuropatía existe
mayor presencia de macroalbuminuria (p=<0.05). Las
complicaciones macrovasculares con antecedentes de
complicación cardiovascular
(n=2) y amputación de pie
diabético (n=4) solo se observó
en el grupo con macroalbuminuria (p=0.01). El análisis
bivariado y multivariado con
regresión logística confirma
que la presencia de micro y
macroalbuminuria tiene correlación positiva con presión
arterial, la Urea, BUN, creatinina, colesterol total, LDL,
HbA1c, y el riesgo cardiovascular elevado (p=<0.05), más
predominante con la macroalbuminuria. Comentarios: la
incidencia de factores de riesgo
en los pacientes de la clínica
31 con diabetes tipo 2 como la
hipertensión, obesidad y dislipidemia están correlacionados
positivamente con la presencia
de macro y micro albuminuria.
Conclusiones: la determinación
de albuminuria tiene como objetivo mejorar las estrategias en
la reducción de la albuminuria
para evitar la progresión de la
enfermedad cardiovascular y
renal.
Mortalidad en pacientes con
enfermedad renal crónica
avanzada (ERCA) en hemodiálisis
Héctor Raúl Ibarra Sifuentes, Víctor Iván Segura Huicochea, Perla
Rocío Colunga Pedraza, José
Guadalupe Martínez Jiménez,
Concepción Sánchez Martínez,
Jesús Cruz Valdez, Dionicio Ángel Galarza Delgado
Medicina Interna, Hospital
Universitario Dr. José Eleuterio
González y Facultad de Medicina, Universidad Autónoma de
Nuevo León, Monterrey, Nuevo
León, México
Introducción: el riesgo de
muerte en pacientes con Enfermedad Renal Crónica Avanzada
(ERCA) es alto, varían entre
pacientes y es dependiente de
comorbilidades. La referencia
temprana al nefrólogo afecta
la sobrevida, así como la presencia de hipoalbuminemia,
hiperfosfatemia, y anemia.
El objetivo de este estudio es
determinar los factores asociados a mortalidad presentes
en los pacientes con ERCA, en
una población de pacientes
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de un Hospital de enseñanza.
Material y método: estudio
descriptivo, observacional,
prospectivo, Unicéntrico, en el
que se estudiaron durante 90
días a pacientes con ERCA que
ingresaron a Urgencias, UANL,
con indicación de Hemodiálisis
Intervencionista (HI), durante
el periodo comprendido de
1 de septiembre y el 31 de
noviembre de 2012. Se dio
seguimiento, mediante llamada
telefónica y/o consulta a los 30,
60 y 90 posteriores a la HI. Se
realizo análisis estadístico con
programa SPSS Statistics versión
18 para Windows, realizándose
estadística descriptiva y sobrevida mediante Kaplan-Meier.
Comentarios Se incluyeron 41
pacientes, con edad 50.59 años
(rango 17 - 76 años), hombres
23 (56.1%). La Valoración por
nefrólogo fue registrada en 9
(22%). Los paraclínicos fueron:
albúmina, 2.88 ± 0.57, Fosfato,
9.48 ± 2.90, Hemoglobina 7.22
± 1.42. Del total de pacientes
15 (36.6%) habían fallecido
a los 90 días; de los cuales 9
(60.9%) fueron hombres; Los
niveles de albumina fue menor
en los fallecidos cuando se
comparo con los vivos (2.79
vs 2.93), los niveles de fosfato
fueron mayores cuando se
comparo con los vivos (9.97 vs
9.20); y el nivel de Hb fue mayor en los fallecidos (7.5 vs 7.0).
La sobrevida a 30, 60 y 90 días
fue de 92.7%, 85.4% y 63.4%
respectivamente. Conclusiones:
la mortalidad encontrada en
este estudio es alta respecto
a la reportada por otros estudios. Analizando la valoración
por nefrólogo, se observo que
fallecieron el mismo número
de pacientes sin importar su
referencia previa. La hipoalbuminemia y la hiperfosfatemia
se correlacionan con la mortalidad. Destaca en nuestra
población que los pacientes
que fallecieron tenían mayor
nivel de hemoglobina cuando
se comparó con los sobrevivientes.
Calidad de vida utilizando
COPD assessment test en la
EPOC
A Psaltidis López, I De La Cruz
Hernández, KI De La Cruz Rodríguez, JC Robledo Pascual, SG
Tandazo Vega
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Villahermosa, Tabasco
Introducción: EPOC es una
patología de carácter sistémico y progresivo que presenta
síntomas que afecta la calidad
de vida (CV) el instrumento
utilizado es CAT (COPD assessment test) que valora la CV
en pacientes con EPOC, instrumento validado y equiparable
al cuestionario St. George.
Objetivos: 1) evaluar CV en
pacientes con EPOC a través
de CAT en consulta externa.
2) Describir cual es el síntoma
predominante en estos pacientes. Material y método: tipo de
estudio (Feinstein): descriptivo, procedimiento, encuesta,
transversal, prolectivo. Periodo agosto 2013-junio 2014.
Criterios de inclusión: diagnóstico EPOC-GOLD. Se aplicó
CAT mediante una entrevista
semi-estructurada previa a la
consulta por un solo evaluador.
Análisis estadístico: estadística
descriptiva, análisis global y
estratificado de acuerdo al puntaje, dominios del CAT, GOLD.
Resultados: N=70; femenino
60%, masculino 40%, edad
media 73+ 8.17(47-89), ( >65
años) 87.2%; Área metropolitana 52%; labores del hogar 63%,
desempleados/jubilados 20%,
campesinos 11%. Exposición a
biomasa en 87%, índice de 300
h/año, tabaquismo 47%, índice
de 9 paq/año, comparten exposición a biomasa-tabaco 35%;
comorbilidades asociadas HAS
69%, DM2 23%, cardiopatía
isquémica 20%; sobrepeso
39%; disnea mMRC grado 3
47%; VEF1 promedio 56.7%
del predicho. CAT puntaje total
x=18.2 + 8.3(0-37); puntuaciones por nivel de impacto en
CVRS 11-20 puntos (moderado) 36%, 21-30 puntos (grave)
35%, <10 puntos (leve) 21.7% ,
31-40 puntos(muy grave) 6.7%.
Los síntomas predominantes
durante el día: disnea 63.4%,
tos 35%, flemas 25% opresión
15%; actividades diarias limitadas en 51.7%, sin embargo
esto no les impide salir de casa
40%, tienen habitualmente problemas con el dormir 16.7%.
Toda su enfermedad según el
CAT ve afectada su vitalidad
en un grado leve a moderado
S163
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
60%. Conclusiones: el síntoma
más importante según CAT
es la disnea de moderadagrave y siguen en frecuencia
tos y expectoración. El nivel
de impacto mostro que el 71%
tiene síntomas y limitación
de actividades en un grado
moderado-grave. El promedio
de CAT para la clasificación de
GOLD basada en paneles ubica
a este grupo de pacientes en
sintomáticos.
Características demográficas
de fenotipos clínicos en EPOC
de un hospital de Tabasco
Anahi Psaltidis López, I De la
Cruz Hernández, KI De La Cruz
Rodríguez, JC Robledo Pascual,
SG Tandazo Vega
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Villahermosa, Tabasco
Introducción: la enfermedad
pulmonar obstructiva crónica
(EPOC) es una enfermedad
compleja, con presentación
clínica heterogénea, los fenotipos clínicos ayudan a precisar
la clínica relevante, síntomas,
exacerbaciones, respuesta al
tratamiento, progresión de la
enfermedad o muerte. Objetivos: 1) conocer la frecuencia
fenotipos-EPOC; 2) conocer
características demográficas de
los fenotipos; 3) conocer diferentes tratamientos y necesidad
de atención urgencias-hospitalización de cada fenotipo.
Material y métodos: estudio
longitudinal. Enero 2014-Julio
S164
2014. Criterios de inclusión:
diagnóstico de EPOC-GOLD.
Estado estable. Se aplicó COPD
Assessment Test (CAT) en primera visita a neumología. El
paciente fue clasificado de
acuerdo a los fenotipos descritos GOLD Se recabaron
variables clínicas y seguimiento. Análisis estadístico: grupo
total y estratificado/fenotipo (4)
y riesgo (bajo-alto) Se comparó
fenotipos (numéricas) ANOVA
una vía p<0.05 Distribución de
Poisson para eventos recurrentes. Resultados: N=61, F 67%,
M 33% tabaquismo (exfumadores) 43.1%, Biomasa 90.2%
(23% continúan la exposición).
Comorbilidades: obesidad 15.7
%, DM2 23.5%, HAS 66.7%,
cardiopatía isquémica 15.7%,
depresión 11.8%, osteoporosis
5.9%Edad 73±8(47-86), IMC
26.9±5.4 (17-43),paquetes/
año mediana 6 (0.7-90), horas/
año mediana 250(108-750).
Puntaje CAT X=18±8.45(0-37),
el 78.4% mostraron valores de
CAT >10 puntos. Los fenotipos
GOLD: A 17.6%, B 31.4%, C
3.9%, D 47.1%, grupo bajo riesgo exacerbación 49% y el 51%
riesgo alto. Atención-urgencias
62.7%, hospitalización 27.5%.
Exacerbaciones por año (2)
27%, (3) 17.3%. CAT-fenotipos
A 6.8±3.5, B 17.6±5, C .5±4.9,
D 23.4±6.3 (p<0.05). Conclusiones: 1) los grupos de bajo
riesgo y alto riesgo son muy
similares, fenotipo B 31.4% y
el D 47.1%. 2) CAT fenotipo
D=21 y B=17.6, refleja que son
pacientes muy sintomáticos,
acuden a urgencias y llegan a
requerir de hospitalización 50 y
41% respectivamente. Fenotipo
D utiliza esteroides-LABA 29%,
metilxantinas 12.5%, oxígeno
12.5%, LAMA 41.7%; fenotipo
C LAMA 100%, esteroide-LABA 100%. Fenotipo B 43.8%
LAMA, metilxantinas 6.3%,
esteroides 12.5%, combinación-broncodilatador 43.8%,
esteroides-LABA 31.3%.
Factores pronósticos asociados
con mortalidad en pacientes
con tuberculosis multifarmacorresistente (TB MFR)
Julio Pascual, M Salomón Montero, S Tandazo Vega, JA Gómez
Garibay, OI Flores Barrientos,
A Rodríguez Hernández, R
Méndez Morales, Miguel Ángel
Salazar Lezama, Martín Castellanos Joya, Raquel Romero
Pérez
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Jurisdicción Sanitaria
del Centro Secretaría de Salud,
Villahermosa, Tabasco
Instituto Nacional de Enfermedades Respiratorias Ismael
Cosío Villegas, México, DF
Objetivos: 1) describir datos
demográficos y curso clínico,
2) factores pronósticos en pacientes con TB-MFR y que han
recibido tratamiento. Material
y métodos: estudio de cohorte.
Periodo 2009-2012. Criterios
de inclusión: diagnóstico de
farmacorresistencia muestra
respiratoria enviada al InDRE
NOM 006 SSA2-2013. El pro-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
grama nacional de prevención
y control de TB MFR autorizó el
abasto de fármacos previo dictamen de COEFAR. Seguimiento
por primer nivel de atención
hasta completar tratamiento
o desenlace. RESULTADOS.
22/45 casos TBMFR/casos con
farmacorresistencia (48.8%)
que se completó la gestión de
fármacos, Iniciaron Tx 21y 1
por iniciarlo. M 79%, F 21%
(M:F 4:1), edad 45 ± 10 (25-68)
años, diabetes 64%, privados de
la libertad 14%, VIH 0. Fracaso
categoría II OMS 71.1%, BAAR
++ 35.7%, BAAR +++ 42.8%.
Daño pulmonar extenso 35%,
resistencia HR 20%, HRZ 20%.
Tiempos y movimientos del
proceso: sospecha fundada al
Dx confirmado InDRE 0.24%,
Dictamen COEFAR 46%, gestión de fármacos y auditoría
10%, tiempo de inicio tratamiento hasta última consulta
37%, confirmación diagnóstica
86 ± 24 días (54-138), tiempo
de seguimiento desde dx última
consulta X= 393±388 39-1374)
d. Tratamiento estandarizado
(E, Z, Lfx, Am, Pto) 29%. D.
conversión bacteriológica X= 6
meses. RAFA grave 15% todos
presentaron al menos un par
de RAFA’s, abandonos 13%,
éxito 62%, mortalidad 21%.
Probabilidad de supervivencia
0.61 a 548 (394-853) días.No
se encontró asociación con
mortalidad (X) género, diabetes,
edad (p > 0.05), la única variable asociada es la repecusión
funcional del daño pulmonar
p= 0.01 (intrahospitalaria) OR
12.5. Conclusiones: en esta
población predominantemente
diabética, con carga bacilar
importante y daño pulmonar
que condiciona dificultad respiratoria tiene una mortalidad de
25% siendo la dificultad respiratoria la más importantemente
asociada OR 12.5
Utilidad del índice de CROP
como marcador pronóstico
para extubación exitosa
Eduardo Adolfo Montaño Alonso, Germán Vargas Ayala, Nayeli
Gabriela Jiménez Saab
Servicio de Medicina Interna,
Hospital General Ticomán,
Secretaría de Salud del Distrito
Federal, México, DF
La ventilación mecánica (VM)
es la base del tratamiento de
apoyo de la insuficiencia respiratoria aguda. Sin embargo,
la perpetuación del soporte
ventilatorio más allá de lo necesario puede significar mayor
morbilidad y mortalidad, El
índice de CROP Integra diversas
variables que tratan de predecir
de una manera integral el éxito
del retiro de la ventilación mecánica, con un valor mayor a 13
mL/respiración/minuto para tal
desenlace, en nuestro país no
contamos con ningún estudio
previo para tal índice. Objetivo:
valorar la eficacia del índice
de CROP como indicador pronóstico para el retiro del apoyo
mecánico ventilatorio comparándolas contra índice de Tobin
y PiMAX. Hipótesis: el Índice de
CROP es útil como predictor de
extubación exitosa en nuestro
medio. Diseño del estudio: estudio de cohorte observacional,
comparativo, prolectivo y longitudinal. Material y métodos:
se determinó una muestra de 62
pacientes (hombres y mujeres)
bajo apoyo mecánico ventilatorio, en protocolo de retiro
de la ventilación. Se tomaron
mediciones iniciales para calcular índice de CROP, Índice de
Tobin y PiMAX, con una medición posterior a las 48 h, para
determinar el éxito o no del
proceso de extubación. Análisis
estadístico. Se utilizó estadística
univariada para determinar la
asociación del índice de CROP
mayor o igual a 13 y la extubación exitosa como variables
cualitativas dicotómicas, por
medio de la prueba de X2. Esta
asociación también fue evaluada por medio del valor del
Riesgo relativo (Hazard Ratio).
Resultados: de los pacientes se
incluyeron 65 que se encontraban en protocolo de retiro de la
ventilación mecánica invasiva,
de los cuales el 55.3% fueron
mujeres y 44.6% hombres. Se
determinó la asociación del
índice de CROP > 13 y la extubación exitosa encontrando
una X2 = 23.4, con una valor
de p < .001. Esta asociación
también fue evaluada por medio del valor del Riesgo relativo
encontrando que el índice de
CROP > 13 tiene un RR = 3.01
para extubación exitosa, con un
intervalo de confianza al 95%
de 1.59 a 5.67. Conclusiones:
se concluye que el índice de
S165
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
CROP por arriba de 13 (como
lo recomienda el protocolo de
Weaning) se asoció de manera
estadísticamente significativa a
una extubación exitosa, demostrando ser superior inclusive a
otros predictores de extubación
exitosa.
Hallazgos tomográficos y biomarcadores de gravedad en
neumonitis aguda por adyuvantes
H Mateos Toledo, C Guadarrama Pérez, I Buendía Roldán,
J Rodríguez Chagolla, J Rojas
Serrano, M García Alcalá, J
Gutiérrez Bernal, M Mejía Ávila
Instituto Nacional de Enfermedades Respiratorias (INER),
Clínica de Enfermedades Intersticiales del Pulmón, México, DF
Introducción: la aplicación de
sustancias líquidas subcutáneas
principalmente silicón con fines
cosméticos por personal no calificado es una práctica habitual
que puede producir neumonitis
aguda por adyuvantes (NAA)
con una elevada morbilidad
y mortalidad. Objetivos: 1)
describir las características
clínico-tomográficas de la NAA.
2) Conocer la correlación de los
niveles séricos de lactato deshidrogenasa (LDH) y Dímero D
(DD) con los índices de oxigenación. Material y método: se
registró en forma retrospectiva
del 2005 al 2013 a los pacientes
con diagnóstico confirmado de
NAA. Se registraron variables
basales epidemiológicas, tipo y
cantidad de adyuvante aplica-
S166
do, características tomográficas,
marcadores de gravedad; deshidrogenasa láctica (DHL) y
dímero D (DD) que se correlacionaron con los índices de
oxigenación paO2, G(A-a)O2
y paO2/FiO2. Resultados: se
identificó a 26 pacientes transexuales, masculino 25, edad
media 26 años (23-30), uso
previo de adyuvantes 19(73%),
neumonitis previa 3(12%),
silicona líquida fue el adyuvante más frecuente 19(73%),
la región de aplicación más
frecuente glúteos 18 (69%),
cantidad aplicada 612 mL
(250-900 mL). Inicio de síntomas <24 h 100%, alteraciones
neurológicas 4 (15%), disnea
25 (96%), fiebre 10 (39%),
hemoptisis 5 (19%), LDH 256
(216-420) U/L, DD en suero
1228±559 ng/mL, insuficiencia
respiratoria 100%. Tomografía;
afección difusa 100%, distribución subpleural 90%, vidrio
despulido 95%, consolidación
58%. Ventilación mecánica 8
(31%), defunciones 2 (8%), tratamiento con corticoesteroides
sistémicos 100%. Correlación
LDH con paO2 -.42(p .048), con
G(A-a) 0.40(p .09), con paO2/
FiO2 -.45 (p .052). Correlación
de DD con paO2 -.43 (p .10),
con G(A-a) 0.70 (p .011), con
paO2/FiO2 -.64 (p .025). Conclusiones: en el INER la NAA es
más frecuente por biopolímero
líquido, el 100% presentó insuficiencia respiratoria, de estos
31% requirió VMI, la mortalidad fue del 8%, la característica
tomográfica predominante
fue grados variables de vidrio
despulido y consolidación
multisegmentaria de distribución periférica-subpleural. El
aumento de los niveles séricos
de LDH resulto en una correlación regular con los índices de
oxigenación. El aumento de los
niveles séricos de DD resulto
en una correlación buena con
la gravedad de los índices de
oxigenación. La aplicación de
biopolímero líquido con fines
esteticos debe ser evitada. Esta
es la serie mas grande comparada con la literatura.
Epidemiología del cáncer pulmonar en Tabasco
JA Gómez Garibay, C Osorio
Amézquita, Sheyla García Pinzón, MA González Romo, MC
Vélez Martínez, SG Tandazo
Vega, JC Robledo Pascual, DR
Cortés Niño
Servicios de Medicina Interna,
Anatomía Patológica, Imagenología, Neumología, Hospital
Regional de Alta Especialidad
Dr. Juan Graham Casasús, Villahermosa, Tabasco
Objetivo: conocer los datos
clínicos y demográficos de los
pacientes con cáncer pulmonar que ingresan al servicio de
hospitalización de medicina
interna para estudio. Material y
métodos: cohorte. 2007-2014.
Criterios de inclusión: pacientes
independientemente de género
y edad que ingresan al servicio
medicina interna. Resultados: pacientes 96 ingresaron
para protocolo de estudio.
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Femenino 53.6%, masculino
46.4%, edad 59±15 (18-87)
años, el 53% de la población
es adulto mayor. Escolaridad:
analfabeta 12.4%, primaria
incompleta 20.6%, primaria
completa 14.4%. Tabaquismo
22/51 (43.1%), Humo de leña
20/51 (39.2%), otro tipo de
biomasa 5/51 (5.9%), asbesto
2/51 (3.9%). Comorbilidades:
sin comorbilidades (62%), HAS
12%, DM 4%, DM y HAS
10%, EPOC 4%, Tb 2%. Peso
en Kg 58.9±10.9 (38-81 kg)
Talla 1.56 ± 0.08 m (1.4-1.72),
IMC= 24.23±4.07 kg/m2. Clínicamente los pacientes se
presentan con: disnea progresiva 43.3%, pérdida de peso
38.1%, dolor torácico 25.8%,
Sx febril 21.6%, tos con expectoración 19.6% (adherente
7.2%, muco-purulenta 3.1% y
hemoptoica 9.3%), hemoptisis
12.4%, síndromes clínicos:
atelectasia 3.1%, condensación
16.6%, derrame 18.6%, Sx
mediastinal 5.2%, más de un
síndrome clínico 4.1%. Síndrome radiológico: masa 16.5%,
derrame 5.2%, condensación
2.1%, masa mediastinal 4.1%,
nódulo pulmonar 2.1%, más de
un síndrome 19.6%. ECOG 1
21.6%, ECOG 2 19.6%, ECOG
3 7.3%. Tipo de muestra tomada para diagnóstico: Biopsia
tru-cut guiada TAC 90.7%,
broncoscopía 7.2%. Primario
de pulmón 74/96 (76.3%) [células pequeñas 4.1%, células no
pequeñas 58.8% y otros tipos
de neoplasias malignas 14.4%],
metástasis 22/96 (22.7%). Re-
cibieron quimioterapia 23%,
radioterapia 8.2%. Conclusiones: el cáncer pulmonar
representa una causa frecuente
de mortalidad en donde el tabaco no es el único factor de
riesgo, se presenta en adulto
mayor y el adenocarcinoma
es el tipo histológico más frecuente. La disnea es el síntoma
más frecuente y se presentación
tomo tumor central 19.7%,
sospecha tumor periférico en
18.6%. La masa pulmonar y
generalmente más de un sx. radiológico se presenta. Tienen El
64% tienen un IMC normal. El
diagnóstico se realiza mediante
biopsia de cilindro guiada por
TAC; menos de la cuarta parte
reciben quimioterapia El 41.2%
son físicamente aptos para
realizar actividades en su vida
cotidiana.
Lesión renal aguda en pacientes con cáncer: factores
asociados con mal pronóstico
y deterioro de la función renal
Alain Sánchez Rodríguez, Rafael Saavedra Pérez Salas, Javier
Zúñiga Varga
Servicio de Medicina interna,
Centro Médico ABC, Distrito
Federal, México, DF
Introducción: la información
sobre lesión renal aguda (LRA)
en pacientes con cáncer es escasa, además no hay suficiente
información sobre los factores
asociados a mal pronóstico,
definido éste como estadios
más graves de AKIN al ingreso,
progresión de la falla renal,
ingreso a unidad de cuidados
intensivos (UCI) y mortalidad.
Objetivos: estadificar pacientes
con cáncer y LRA por criterios
de AKIN, describir la evolución
de la función renal, identificar
factores asociados a deterioro
de la función renal, estancia
en UCI y mortalidad en pacientes con neoplasias sólidas
y hematológicas. Material y
método: estudio observacional, retrospectivo que incluyó
pacientes que acudieron al
centro médico ABC entre enero
de 2010 y marzo de 2014 con
diagnóstico de cáncer y falla
renal aguda. Se colectaron variables demográficas, clínicas
y de laboratorio, se estimó la
frecuencia de desenlaces primarios y factores asociados.
Resultados: se incluyeron 67
pacientes, 48 (71.6%) hombres
y 19 (28.4%) mujeres, edad de
67 ± 15.6 años. Con tumores
sólidos y hematológicos en el
73 y 27%, respectivamente. El
23% de los pacientes requirió
estancia en UCI, la mortalidad
total fue del 6.5%, la frecuencia de LRA AKIN III de 26.9%,
La tasa de filtrado glomerular
inicial con mediana de 84 (RIQ
57-99) mL/min/1.73 m2 vs una
final de 57 (RIQ 38.21-75.7)
mL/min/1.73 m2, p<0.01; Se
observó progresión de falla
renal pre existente en 6/16
pacientes (37%). Los factores
asociados a peores desenlaces
fueron para mortalidad: edad
mayor a 80 años OR = 18.5
(IC95% 1.8-182.4, p=0.001);
para LRA AKIN III: mieloma
S167
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
múltiple (MM) OR=11.7 (IC
95% =2.101-65.70, p = 0.004);
para progresión de la falla renal:
edad, 77.0 ± 12.2, vs 64.3 ±
8.2, p=0.049, no se identificaron factores de riesgo para
estancia en UCI. Los pacientes
con MM tuvieron una peor
evolución en la función renal
con mediana de creatinina
máxima 3.5 (RIQ1.9-6.6) vs 2.1
(RIQ 1.6-2.7), mg/dL, p = 0.05
y mediana de TFG mínima de
33.8 (RIQ 24.3-48.2) vs 19.22
(RIQ 9.3-38.8), p = 0.055, sin
embargo no se encontraron
diferencias en mortalidad, estancia en UCI o progresión de
la falla renal. Conclusiones:
los factores asociados a peores
desenlaces fueron mayor edad y
presencia de mieloma múltiple,
no se identificaron factores para
estancia en UCI. Los pacientes
con MM tuvieron peor evolución de la función renal.
Perfil inmunohistoquímico y
pronóstico de histologías infrecuentes de cáncer de mama
en México
Sandra Ileana Pérez Álvarez,
Eucario León Rodríguez, Yemil
Atisha Fregoso
Instituto Nacional de Ciencias
Médicas y Nutrición Salvador
Zubirán
Introducción: las variantes histológicas infrecuentes (VHI) son
10-25% del cáncer de mama
(CM). Se desconocen las características clinico-patológicas,
recaída y supervivencia en
México. Objetivo: determinar
S168
supervivencia de VHI según
tipo histológico y perfil de inmunohistoquímica. Métodos:
estudio analítico, observacional, retrospectivo de pacientes
con VHI de CM. Resultados:
entre 1990-2013 se identificaron 1,285 pacientes con CM; 96
con VHI (7.47%). Las características relevantes, por no haber
sido previamente descritas: 1)
la edad al diagnóstico en el Ca
medular (49 años) y apocrino
(51 años) fue mas temprano que
en el metaplásico (70 años) y
de células pequeñas (70 años).
2) Se reportó grado histológico
bajo en Ca tubular y papilar
(p=0.008), y un grado alto en
Ca metaplásico, medular y sarcoma (p<0.001). 3) La invasión
linfovascular se observó con
más frecuencia en metaplásico
y apocrino (p=0.022). Se reportaron receptores hormonales
positivos (RH+) en Ca mucinoso, tubular y papilar, y Her2/
Neu positivo en el apocrino. El
Ca mucinoso, tubular y papilar
se asoció con RH+ y Her2/
Neu- (p=0.002); el Ca apocrino,
metaplásico, medular, acinar y
sarcoma se asoció con RH- y
Her2/Neu- (p<0.0001). Las VHI
correspondieron al grupo de
buen pronóstico (>80%). No
hubo diferencia significativa al
agrupar a los pacientes según
el subtipo histológico, perfil de
inmunohistoquímica y grupo
pronóstico, y compararlos con
recaída, mediana de supervivencia libre de enfermedad
(SLE) y SLE a 5 años. El estudio
confirmó más supervivientes
con Ca tubular, mucinoso y
metaplásico, y menos con
sarcoma, tumor neuroendocrino y Ca medular (p=0.038).
Al agruparlas según el grupo
pronóstico se observaron más
supervivientes (p=0.002), menor mortalidad (p=0.002) y
mayor supervivencia global
(SG) a 5 y 10 años (p=0.001),
en histologías de buen pronóstico. Conclusiones: es la
primera descripción de las VHI
de CM en población mexicana.
La prevalencia fue similar a la
descrita en la literatura. Las
VHI de CM son un grupo heterogéneo con diferente edad
al diagnóstico, grado histológico, invasión linfovascular y
estado de Her2/Neu y RH. En
pacientes con VHI de buen
pronóstico se reportó mejor SG.
Aunque son raras, se requiere
una evaluación clínica, revisión histopatológica adecuada
y completa para identificar los
subtipos y características que
cambian el pronóstico, recurrencia y SG.
Neoadyuvancia en cáncer de
mama y pronóstico de acuerdo
con subtipo biológico
Mirza Jacqueline Alcalde Castro,¹ Yemil Atisha Fregoso,¹
Eucario León Rodríguez,² Alejandra Armengol Alonso²
1
Departamento de Medicina
Interna
² Departamento de Oncología
Médica
Instituto Nacional de Ciencias
Médicas y Nutrición Salvador
Zubirán, México, DF
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Introducción: antes de iniciar
la quimioterapia neoadyuvante (QTNA) es vital establecer
el diagnóstico histológico y
evaluar los marcadores biológicos del cáncer de mama
por su implicación pronóstica
y terapéutica. La clasificación
más exacta está hecha por
análisis de ADN. Por costo
no se puede realizar a nivel
clínico. La clasificación de St.
Gallen es útil para disecar los
subtipos biológicos. En población latina no existen reportes
de esta clasificación. Métodos:
se realizó un estudio retrospectivo en el INCMNSZ, que
incluyó mujeres con cáncer de
mama que recibieron QTNA
del 2004 al 2013. Se clasificó
a las pacientes de acuerdo a
los criterios de St. Gallen. Se
reportaron las características
clínico-patológicas y la respuesta a QTNA (clínico-patológica
y radiológica). Se asoció la
respuesta patológica completa
(RPc) con la supervivencia global (SG) y supervivencia libre
de enfermedad (SLE) a distancia
de acuerdo al subtipo biológico. Resultados: se incluyeron
107 pacientes con una mediana de seguimiento de 7 años.
29 pacientes (27.1%) fueron
diagnosticadas con cáncer de
mama antes de los 44 años. La
RPc fue distinta por subtipo de
St. Gallen (p=0.039). Tuvieron
RPc 17 pacientes (18%). Alcanzaron RPc en CMTN 8 (34.8
%); en luminal B2, 5 (25%);
en HER2 positivo, 2 (18.2%);
en luminal B1, 2 (5.4%): y en
luminal A, ninguna (p=0.008).
Aunque no hubo diferencia en
la SLE por subtipo biológico
(log rank=0.26), si en la SG
(log rank=0.020) y en la SLE a
distancia (log rank=0.021). El
tener RPc en el subgrupo de
CMTN se asoció a un mejor
pronostico y observamos diferencias significativas en la SLE
(log rank=0.005) y en la SG (log
rank=0.036) comparado con el
grupo sin RPc. Conclusiones:
el cáncer de mama en México se diagnostica a una edad
más temprana con respecto a
países desarrollados. La SLE
a distancia y SG en pacientes
tratadas con QTNA difiere de
acuerdo al subtipo biológico de
St. Gallen. Dicha clasificación
es útil debido a que se basa
sólo en datos obtenidos por
IHQ (que permiten disecar a los
subgrupos de cáncer de mama.
No sólo tiene implicaciones
terapéuticas sino también de
pronóstico. Los pacientes con
CMTN con RPc tienen mayor
SLE y SG. Este subgrupo tiene
mayor beneficio de la QTNA,
pues permite conocer el pronóstico. Los pacientes luminal
A y B1 tuvieron un buen pronóstico independientemente
de la RPc, por lo que tal vez no
requieran QTNA.
Utilidad de la tomografía computarizada en el protocolo de
estudio de pacientes con pérdida de peso inexplicable
Leslie Moranchel García, Luis
Francisco Pineda Galindo, Moisés Casarrubias Ramírez
UMAE-Especialidades Dr. Antonio Fraga Mouret, Centro
Médico Nacional La Raza,
IMSS, México, DF
Introducción: en el protocolo
de pérdida de peso inexplicable
los principales ensayos clínicos
se orientan a establecer la etiología del padecimiento. No se
cuenta con una normativa o guía
que defina cuál es la utilidad
de realizar pruebas diagnósticas, por esta razón, nuestro
estudio valora la utilidad de la
tomografía computarizada (TC).
Objetivo: determinar el rendimiento diagnóstico de la TC
para establecer un diagnóstico
definitivo de la pérdida de peso.
Material y método: estudio de
cohorte, ambispectivo en el
departamento de Medicina Interna de pacientes con pérdida
de peso inexplicable registrados
en la base de datos de 2005
a 2014. Análisis estadístico:
Se realizó análisis descriptivo
con distribución de frecuencias de variables y se calculó
sensibilidad, especificidad, valores predictivos y c2 para la
evaluación y comparación del
rendimiento diagnóstico de
la TC. Normograma de Fagan
para el análisis de probabilidad post-prueba. Resultados
y Conclusiones: La pérdida
de peso incluye un espectro
de enfermedades orgánicas en
donde las neoplasias ocupan
un papel predominante pero
no exclusivo por lo que es necesario validar las herramientas
diagnósticas con las que se
S169
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
cuenta considerando tanto los
beneficios como los limitantes.
La TC es el estudio de imagen
que mayor información aporta
en el protocolo de estudio de
este tipo pacientes al alcanzar
una sensibilidad y especificidad
superiores al 80%, incrementando la posibilidad de un
diagnóstico de certeza hasta
5 veces; principalmente si se
realiza en una población que
muestra datos orientadores en
las primeras evaluaciones.
Efecto de atorvastatina sobre
los niveles de adipocitocinas
en pacientes diabéticos normotensos
AF Rubio Guerra,1 H Vargas Robles,2 G Vargas Ayala,1 JJ Lozano
Nuevo,1 MB Durán Salgado,1 BE
Escalante Acosta3
1
Hospital General de Ticomán
2
CINVESTAV México, DF
3
CINVESTAV Monterrey
Las adipocitocinas son péptidos producidos por el tejido
adiposo que tienen relación
con mecanismos que promueven o inhiben la inflamación,
la resistencia a la insulina, la
disfunción endotelial y la aterogénesis. Se ha demostrado que
valores séricos aumentados de
resistina y niveles disminuidos
de adiponectina favorecen
la aparición de diabetes mellitus tipo 2 y la enfermedad
cardiovascular. Los efectos de
las estatinas sobre las adipocitocinas varían dependiendo
del tipo de estatina, se sabe
que simvastatina disminuye
S170
los niveles de adiponectina
mientras que pravastatina los
incrementa, sin modificar ambas los niveles de resistina, los
estudios que evalúan el impacto
de atorvastatina sobre los niveles de adiponectina han dado
resultados contradictorios. Objetivo: evaluar el efecto de
atorvastatina sobre los niveles
séricos de adiponectina y resistina en pacientes diabéticos
normotensos. Material y método: se evaluaron 20 pacientes
diabéticos normotensos sin tratamiento previo con estatinas ni
inhibidores del sistema renina
angiotensina. A todos ellos se
les midió los niveles séricos de
adiponectina y resistina por ELISA (RyDSystems Minneapolis),
al inicio y final del estudio. Los
pacientes recibieron manejo
con atorvastatina 10 mg c/24
horas, el seguimiento fue por
3 meses. El método estadístico usado fue prueba U de
Mann-Whitney. Resultados:
la atorvastatina aumentó los
niveles séricos de adiponectina
de 6.85 a 8.43 ¦Ìg/mL, aunque
no alcanzó significancia estadística (p = 0.0602). La estatina
redujo significativamente (p <
0.02) los niveles de resistina
de 15.65 a 10.09 pg/mL. Conclusión: el manejo del paciente
diabético con atorvastatina reduce los niveles de resistina
y aumenta discretamente los
de atorvastatina, mejorando el
índice adiponectina/resistina, lo
cual, dado el papel importante
que las adipocitocinas juegan
en el gasto energético, inflama-
ción, resistencia a la insulina y
función endotelial, es un efecto
pleiotrópico deseado. Ambas
acciones contribuyen a explicar
los efectos de este fármaco sobre el pronóstico cardiovascular
de los pacientes diabéticos.
Correlación entre los niveles de
ácido úrico y disfunción vascular en adultos jóvenes
AF Rubio Guerra, H Morales
López, AK Garro Almendaro,
MI Portillo Muñoz, MB Durán
Salgado, JJ Lozano Nuevo
Hospital General de Ticomán,
SS, México, DF. Mexican Group
for Basic And Clinical Research
in Internal Medicine
El exceso de ácido úrico genera disfunción endotelial y
daño vascular por varios mecanismos, predominando la
reducción en la biodisponibilidad de óxido nítrico y la
activación del sistema renina
angiotensina. El índice brazotobillo (IBT) es una herramienta
diagnóstica para enfermedad
vascular periférica, sin embargo, un IBT anormal predice en
forma independiente y significativa disfunción endotelial,
mortalidad cardiovascular y
cerebrovascular. Objetivo:
evaluar la correlación entre los
niveles de ácido úrico y el IBT
en adultos jóvenes. Material y
método: Se evaluaron 103 pacientes < 40 años, normotensos
no diabéticos sin antecedentes
de enfermedad cardiovascular,
en todos ellos se determino IBT
usando doppler de 5 mega-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
hertz, se consideró normal un
IBT entre 0.9 y 1.3, así mismo,
en todos ellos se realizó una
química sanguínea en ayunas,
incluida la determinación de
ácido úrico (método enzimático). Los métodos estadísticos
usados fueron el coeficiente
de correlación de Pearson y la
prueba exacta de Fisher. Resultados: cuando evaluamos a los
103 sujetos, no encontramos
correlación entre índice brazo
tobillo y los niveles de ácido
úrico, así como tampoco en los
pacientes que presentaron IBT
normal o bajo (menor a 0.9), sin
embargo, se encontró una correlación significativa (R= 0.75,
p = 0.019, EF 0.022, IC 0.56
– 0.98), en los 9 sujetos con
IBT mayor a I.3. Conclusión:
nuestros resultados muestran
una correlación entre los niveles séricos de ácido úrico e
índice brazo-tobillo aumentado, lo que muestra un papel del
ácido úrico sobre la disfunción
vascular, si bien el número de
sujetos es bajo, significancia
estadística es alta, por lo que
se requerirán más estudios para
definir este punto.
Cambios metabólicos ocasionados por las combinaciones
de losartán con hidroclorotiazida o con amlodipina en
pacientes hipertensos
MB Durán Salgado, AK Garro
Almendaro, AF Rubio Guerra
Hospital General de Ticomán,
SS, México, DF. Mexican Group
for Basic And Clinical Research
in Internal Medicine
Los pacientes hipertensos cursan con riesgo aumentado para
desarrollar diabetes mellitus
tipo 2 (DM2), los fármacos
antihipertensivos han mostrado
tener efectos sobre los distintos
parámetros de riesgo metabólico, ya sea favoreciendo o
previniendo el desarrollo de
DM2, sin embargo, hay pocos
estudios que evalúen el efecto
de las combinaciones de antihipertensivos sobre tales criterios
metabólicos. Objetivo: evaluar
el efecto de dos combinaciones
de losartán, con amlodipina o
con hidroclorotiazida, sobre la
glucemia y el perfil de lípidos
en pacientes hipertensos. Métodos: se evaluaron 56 pacientes
hipertensos con hipertensión
arterial descontrolada, quienes
se aleatorizaron en 2 grupos de
28 pacientes c/u. Uno de ellos
(LA) recibió la combinación
losartán/amlodipina (100/5
mg), el segundo grupo (LH)
recibió losartán/hidroclorotiazida (100/12.5 mg), en ambos
casos por 3 meses. En todos
los pacientes se determinó
glucemia, perfil de lípidos y
creatinina sérica antes y después del tratamiento. El método
estadístico usado fue ANOVA.
Resultados: en ambos grupos
se logró una reducción significativa de la presión arterial,
sin diferencias entre ellos (LH
de 157/89 a 123/77 mmHg,
LA 154/95 a 124/79). El grupo
LA mostro una mayor reducción de la glucemia después
del tratamiento que el grupo
LH, (LA 114 a 86 mg/dL vs LH
123 a 127 mg/dL, p = 0.002),
y en los triglicéridos (203 a
175 mg/dL vs 208 a 209 mg/
dL, p=0.02). No encontramos
diferencia en las variaciones de
las lipoproteínas de alta o baja
densidad. Conclusiones: embos
manejos antihipertensivos son
igualmente eficaces para reducir las cifras de presión arterial,
sin embargo, la combinación
de losartán con el calcioantagonista resultó en acciones
metabólicas favorables que
reducen el riesgo metabólico
de los pacientes hipertensos,
y explican, al menos en parte,
las ventajas reportadas de las
combinaciones de inhibidores
del eje renina angiotensina con
calcioantagonistas, sobre las
combinaciones con hidroclorotiazida.
Factores predictores de amputación en pie diabético en un
hospital académico
KI De la Cruz Rodríguez, I De
la Cruz Hernández, A Psaltidis
López, JA López Pérez, JC Robledo Pascual
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Villahermosa, Tabasco
Introducción: en la encuesta
nacional de salud de México
y nutrición del 2006 la prevalencia de diabetes 9.5%. La
prevalencia del pie diabético
en el servicio de medicina del
hospital es 13 casos/mes. La
prevalencia y la incidencia de
ulceras y amputación por pie
S171
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
diabético es variable en todo
el mundo hay factores que
contribuyen en las variaciones
observadas en la incidencia de
amputación en los pacientes
diabéticos. Objetivos: 1) conocer la prevalencia puntual de
amputación. 2) Clasificar la gravedad de la lesión de acuerdo a
las escalas de Wagner, PEDIS y
U. Texas. 3) Encontrar factores
predictores independientes asociados amputación. Métodos:
cohorte. 1° de enero-31 de
diciembre 2013. Pacientes con
pie diabético que ingresaron
a hospitalización de medicina
interna. Un observador clasificó
la lesión y el grupo multidisciplinario decidió el tratamiento
para cada caso. Seguimiento
hasta el egreso. Estadística.
Cálculo de prevalencia puntual mensual de amputación.
Regresión logística binaria
OR IC95%. Resultados. 156
pacientes, M: F 1.6:1, edad X=
57.7 años, glucosa al ingreso
X=244 ± 141.3 mg/dL, 79%
presentaba descontrol metabólico, HAS 41% y IRC 17.3%,
escala de Wagner grado IV
48.1%, III 34.6%; prevalencia
de amputación (97) 62.2%,
amputaciones mayores 54%,
menores 44.3%. El porcentaje
de amputación: en relación al
Wagner III (48%) y IV (80%).
PEDIS 3 69.5%, PEDIS 4 70.8%
Texas 3B 59.3%, 3D 81.8%. el
pie izquierdo fue el mas afectado 50.6%, Pie neuropático
20%. Ausencia de pulso 92%.
Tiempo estancia intrahospitalaria X=9.5+7.0, mortalidad
S172
5.8%. En el análisis univariado
y multivariado los predictores independientes asociados
amputación fueron Wagner
p <0.0001, PEDIS p < 0.001,
Texas p < 0.003 y se construyeron dos modelos siendo Wagner
OR 1.71 IC95%(1.07-2.74),
Texas OR 1.04 (1.002-1.08).
Conclusiones: la prevalencia
puntual de amputación fue 8
casos/mes, Las lesiones más
frecuentes Wagner III y IV. El
tratamiento del PD en nuestro
hospital es predominantemente
cirugía radical y las escalas de
Wagner y Texas son los predictores independientes para la
toma de decisiones.
Perfil clínico de los pacientes
con meningitis aguda según
su etiología en un hospital
universitario
Guillermo Delgado García,
Carlos Cámara Lemarroy, Juan
Gilberto de la Cruz González,
Hazael Flores Cantú, Héctor
Calderón Hernández, Fernando Góngora Rivera, Héctor J
Villarreal Velázquez, Dionicio
Galarza Delgado
Servicio de Neurología, Departamento de Medicina Interna,
Hospital Universitario Dr. José E
González, Universidad Autónoma de Nuevo León, Monterrey,
Nuevo León
Antecedentes y Objetivos:
la meningitis aguda es una
de las principales causas de
internamiento en un servicio
de neurologia. Describimos
las características clínicas y
paraclínicas de los pacientes
internados con este diagnóstico
en el año del 2013 en nuestro
servicio, y posteriormente analizamos las diferencias según la
etiología. Metodología: revisión
retrospectiva de expedientes a
partir de una búsqueda electrónica por diagnóstico de
egreso. Se utilizó estadística
descriptiva para analizar los
datos, y prueba t de Student y
c2 para comparar subgrupos.
Resultados: se incluyeron a 31
pacientes (18 del sexo masculino), con una edad promedio
de 41.7 años. En cuanto a
etiología, 13 (41.9%) pacientes se categorizaron como
meningitis aséptica, 8 (25.8%)
como meningitis bacteriana, 7
(22.6%) como tuberculosa y
3 (9.6%) como criptococócica. No hubo diferencia entre
meningitis tuberculosa y bacteriana en cuanto a edad,
sexo o citoquímica del líquido
cefalorraquídeo (incluyendo
predominio celular). Sin embargo, los pacientes con meningitis
bacteriana presentaron mas
frecuentemente respuesta inflamatoria sistémica al ingreso
(75% vs 28.5%, p<0.05), e
igualmente presentaron mayor
número de leucocitos y menor
de plaquetas al ingreso (13.2
± 6.8 vs 6.6 ± 2.9; 159 ± 56
vs 283 ± 88, respectivamente,
p<0.05). El conteo celular y el
nivel de proteínas fue menor y
la relación de glucosa sérica/
LCR fue mayor en casos de
meningitis aséptica en comparación con otras etiologías. Tres
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
pacientes fallecieron, 1 en cada
grupo de meningitis tuberculosa, bacteriana y aséptica. 57%
de los pacientes con meningitis
tuberculosa se egresaron con
una puntuación de la Escala
Modificada de Rankin >3, en
comparación con 25% de los
pacientes con meningitis bacteriana, y 1 paciente en el grupo
de meningitis aséptica. Conclusión: en la meningitis aguda, las
características clínicas y paraclínicas varían dependiendo de
la etiología.
Utilidad de pruebas clínicasradiológicas para predecir
amputación en pie diabético
I De la Cruz Hernández, KI De
la Cruz Rodríguez KI, A Psaltidis López, JA López Pérez, JC
Robledo Pascual
Servicio de Medicina Interna,
Hospital Regional de Alta Especialidad Dr. Juan Graham
Casasús, Villahermosa, Tabasco
Antecedentes: el índice tobillobrazo (ITB) es un estudio de
tamizaje de enfermedad oclusiva arterial periférica pero
la confiabilidad depende de
muchos factores entre ellos
neuropatía y calcificación vascular. Objetivo: evaluar la
utilidad de la palpación de pulsos, prueba de monofilamento
(MF), ITB y hallazgos radiológicos para la decisión de llevar a
cabo amputación en pacientes
con pie diabético que ingresan
a un servicio de medicina interna. Material y métodos: diseño:
Utilidad de una prueba diag-
nóstica. Periodo 1 Enero-31 de
Marzo 2014. Se Llevó a cabo la
palpación de pulsos en ambos
pies, prueba de MF, Prueba de
ITB utilizando equipo dopplerSonotrax en las 4 extremidades,
radiografía oblicua y lateral del
pie afectado. El estándar de
oro fue un comité de expertos
médico-quirúrgico evaluó y
decidió el nivel de amputación.
Análisis estadístico: sensibilidad, especificidad, VPP, VPN.
Indicadores avanzados de una
prueba diagnóstica (razones
de verosimilitud, momios pre
y post-prueba). Resultados: 24
pacientes, femenino 54.2%,
edad 57.6 ± 13.5 años, DM2
96%. T.evol 18 ± 8años, glucosa 310 ± 197 mg/dL. Pie izq.
54.2%. Wagner III 37.5% y
IV-V 62.5%. PEDIS 3 (79.2%).
Pulsos ausentes 58.3%, detectamos 75% de neuropatía
a través de la prueba de MF,
ITB anormal (<0.9) 37.5%,
radiografía anormal 66.7%,
los hallazgos Rx: osteopenia
45%, Mökenberg 37.5%, fractura 17%, osteomielitis 8%. Se
realizó amputación 79.2%. Las
pruebas más sensibles datos
Rx, prueba de MF positivo,
ausencia de pulsos, ITB 75,
73, 52,42% respectivamente.
Los datos más específicos son
los radiológicos. Después de
calcular la razones de verosimilitud la rentabilidad de las
pruebas clínico-radiológicas
ofrecen una mayor rentabilidad
para poder tomar una decisión
que apoye la amputación y es
pobre la ganancia en su pro-
babilidad, la única que ofrece
ayuda al clínico es la osteopenia con una ganancia de 0.14.
Las escalas siguen siendo las
más útiles en la toma de decisiones que los datos aislados.
Conclusión: la radiografía,
prueba de monofilamento para
evaluar neuropatía, pulsos e
ITB mostraron en ese orden
una sensibilidad para amputación sin embargo, al calcular
probabilidades a posteriori la
osteopenia de la Rx es la única
que ofrece una mejor probabilidad postprueba. Los hallazgos
radiológicos son específicos. En
esta población con alta frecuencia de neuropatía el ITB muestra
muchos falsos negativos.
Fiebre de origen oscuro, comparación de dos series con 25
años de diferencia
M Casarrubias Ramírez, SA
Mendoza Álvarez, J De Santiago Leaños, JA Alfaro Mejía, LF
Pineda Galindo, OI Vera Lastra
Departamento de Medicina
Interna, Hospital de Especialidades Centro Médico La Raza,
IMSS, México, DF
Introducción: la fiebre de
origen oscuro (FOO) es un
síndrome de abordaje difícil y
espectro cambiante. Las causas se ven influenciadas por
aspectos geográficos, epidemiológicos y temporales, así
como por los recursos disponibles para su estudio. Objetivo:
comparar dos series de FOO
estudiadas en el departamento
de Medicina Interna del Hospi-
S173
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
tal de Especialidades del Centro
Médico La Raza. Métodos:
estudio comparativo de datos
secundarios: los datos de la serie 1979-87, fueron publicados
por Frati y colaboradores y los
de la serie 2004-14, registrados
en la base de datos de FOO
del departamento. Se compararon datos demográficos,
diagnósticos finales y pruebas
diagnósticas utilizadas. Se describen mediana y amplitud
para las variables numéricas
y distribución de frecuencias
para las variables nominales. El
análisis bivariado se hizo con c2
o prueba de Fisher con los programas SPSS v 17.0 para MAC
y open epi V 37.0, disponible
en línea: http://www.openepi.
com/V37/Menu. Resultados:
se incluyeron 127 pacientes
en la serie 1979-87 y 118 en la
2004-14. La serie más reciente
tuvo menos casos ocasionados
por infecciones (p=0.024); y
más enfermedades inflamatorias no infecciosas (p=0.0004).
Se mantuvieron constantes las
enfermedades neoplásicas y los
casos con diagnóstico desconocido. Variaron poco las pruebas
de laboratorio realizadas y su
utilidad diagnóstica, en cambio
los estudios de imagen fueron
menos útiles en la serie 200414 (p=0.00003). Las biopsias y
la laparotomía fueron frecuentemente realizadas y útiles en
ambas series. Conclusiones:
hubo más enfermedades inflamatorias no infecciosas a
expensas de un menor número
de infecciones. Los estudios
S174
invasivos siguen siendo necesarios en una proporción
significativa de los casos.
Enfermedad de Fabry en México: análisis de 26 casos
Leslie Moranchel García, Luis
Francisco Pineda Galindo
Expertos en Enfermedades Lisosomales (GEEL), Clínica de
Enfermedades Lisosomales,
Servicio de Medicina Interna,
UMAE-Especialidades Dr. Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: la enfermedad
de Fabry (EF) se origina por
una actividad disminuida de
la enzima alfa-galactosidasa
A, provocando acumulación
de glucoesfingolípidos neutros
no metabolizados en diversos
órganos. Objetivo: presentar un
panorama de las características
de los pacientes mexicanos
con EF evaluados en el centro
de referencia de enfermedades
lisosomales. Pacientes y método: análisis de 26 pacientes,
incluidos hasta agosto 2014,
con EF. Todos los pacientes,
además de las características
clínicas, tienen un diagnóstico
de certeza de la enfermedad,
con la constatación de una
actividad reducida de GLA y
un diagnóstico molecular. Los
datos se recogen de las historias
clínicas y comprenden aspectos
demográficos, historia familiar,
síntomas y su evolución temporal, exploración física, estudios
y tratamiento. Resultados: registro de 26 pacientes, 11 hombres
(42%) y 15 mujeres (58%). La
mediana de edad al momento
de su inclusión fue de 35 años,
con un mínimo de 4 y máximo
de 60 años. En cuanto a la edad
de inicio de síntomas la mediana es de 8 años, siendo las
acroparestesias el síntoma inicial predominante. La edad de
diagnóstico de la enfermedad
tiene una media de 32 años. Los
lugares de la república mexicana de donde son originario
estos pacientes son: DF (42%),
Sinaloa (12%), Jalisco (8%), Nayarit, Chihuahua, Guanajuato,
Michoacán, Sonora, Coahuila,
Tamaulipas y Edo. de México.
Los pacientes provienen de 20
familias diferentes, una de ellas
con 7 miembros afectados. Del
total de pacientes, 17 (65%)
contaban con el antecedente de
algún familiar con diagnóstico
de EF y 5 de ellos tienen hijos
con la enfermedad. La principal
mutación detectada es GLA
(c.1156C>TpQ386X). De la
TRE, 6 (33%) de ellos reciben
actualmente alfa galactosidasa
y 10 (55%) beta galactosidasa.
La biopsia renal se realizó en 9
casos, con reporte principal de
glomeruesclerosis. En la actualidad 3 pacientes cuentan con
trasplante renal. En cuanto a
las escalas e índices utilizados
en EF. EVA va de 0-10 con una
mediana de 6; y un MSSI con
un mínimo de 4, máximo de 44
y mediana de 19. Conclusión:
presentamos el análisis de nuestros pacientes con EF, la única
elaborada hasta el momento.
Debido al amplio espectro de
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
manifestaciones clínicas de
esta entidad, su conocimiento
permite un diagnóstico temprano, así como la posibilidad de
iniciar el tratamiento específico
disponible.
Hiperleptinemia en evento
cerebrovascular isquémico
en pacientes con hipertensión
arterial sistémica
Jorge Luis García Sánchez,
Nayeli Gabriela Jiménez Saab,
Jesús Guerrero González, César
Iván Elizalde Barrera
Medicina Interna, Hospital
General Ticomán, Secretaría
de Salud del Distrito Federal,
México, DF
Introducción: el evento cerebro
vascular (EVC) de tipo isquémico, se encuentra dentro de
las primeras causas de muerte
a nivel mundial, asociándose
dicha patología a diversos factores de riesgo cardiovascular
como la obesidad, la diabetes mellitus, la hipertensión
arterial sistémica (HAS) y la
dislipidemia. La obesidad ha
sido objeto de estudio desde
hace muchos años. En el año
1994, se logró clonar el gen OB
el cual sintetizaba una proteína,
leptina, del griego leptos (Delgado). Esta hormona tiene su
acción principal en el sistema
nervioso central (Hipotálamo),
actuando a nivel de la regulación del balance energético. Sin
embargo actualmente se han
encontrado múltiples sitios de
acción en tejidos periféricos,
así como su relación en el de-
sarrollo de múltiples patologías
cardiovasculares por su acción
a nivel endotelial. Objetivo:
determinar la asociación, que
existe entre los niveles de leptina en suero y EVC isquémica
en pacientes con HAS. Material
y métodos: el estudio se llevó
a cabo en el Hospital General
de Ticomán. En pacientes con
EVC y HAS tomando como
grupo control pacientes con
antecedente de diagnóstico
de HAS sin EVC isquémico. A
los dos grupos se les calculó
el índice de masa corporal,
se les tomó perfil de lípidos, y
determinación de leptina sérica.
Se calculó una N= 30 sujetos
en cada grupo. Resultados: se
estudió una población de 60
sujetos, divididos en dos grupos
de 30 sujetos. Encontrándose
para la leptina una diferencia
de medias de 3.93 ng/mL, y una
t=2.8, (p= 0.007). Así mismo
se calculó una c2 con un grado
de libertad, obteniendo c 2=
10.82 (p=0.001). Con base a
los sujetos con hiperleptinemia
en presencia y ausencia de
EVC isquémico, se obtuvo una
OR=3.05 (p=0.05, IC95% 0.99.6). Se encontró una OR en los
sujetos con hipertrigliceridemia
asociada a hiperleptinemia
de 3.4, (p=0.09, IC95% 0.814.4). Para el colesterol LDL
en relación a los niveles de
leptina resultó una OR=0.22
(p=0.18, IC95% 0.02-2.04).
Comentarios y Conclusiones:
se encontró diferencia estadísticamente significativa en
los niveles de leptina entre
los casos y controles, lo cual
indica que la hiperleptinemia
se presenta más en los pacientes con EVC isquémico que
en los pacientes hipertensos
sin EVC isquémico. Por otro
lado no hubo significancia
estadística entre los valores de
los diferentes lípidos séricos y
las concentraciones séricas de
leptina.
Proteinuria en pacientes con
nefropatía diabética y su
asociación con síndrome de
fragilidad
Javier Loaiza Félix, Nadia Monserrat Muñoz Campos, Adriana
González Andujo
Hospital General de Ticomán,
México, DF
Hospital General de Xoco,
México, DF
Introducción: se puede definir
el envejecimiento como un deterior funcional del individuo lo
anterior debido a una disminución de las reservas fisiológicas
y a la incapacidad de mantener
su interacción adecuada con
el medio. Actualmente para
el diagnóstico de fragilidad se
cuenta con la escala de Fried
la cual evalúa una serie de 5
parámetros lo cuales son fuerza,
pérdida de peso, disminución
de la actividad física, cansancio
y disminución del desempeño
físico. Si bien se han buscado
una serie de marcadores como
proteína C reactiva, interferón,
interleucinas y leptina aun no
se han desarrollado estudios
que validen dichos marcadores
S175
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
como pronósticos de fragilidad.
Objetivo: determinar si existe
un grado de asociación entre
la proteinuria en pacientes con
nefropatía diabética y el síndrome de fragilidad. Hipótesis:
existe una asociación entre la
proteinuria en los pacientes
con nefropatía diabética y el
síndrome de fragilidad. Diseño del estudio: descriptivo,
observacional, transversal y
analítico. Material y métodos:
se determinó una muestra total
de 70 pacientes de los cuales 35
presentaban DM2 mientras que
el resto no presentaban ninguna
patología agregada. Posteriormente se procedió a realizar
una recolección de proteína
en orina de 24 horas así como
la aplicación del cuestionario
de Freid para determinar el
grado de fragilidad Análisis
estadístico. el análisis de proteinuria en el grupo control
encontramos 12 pacientes sin
proteinuria significativa (34%)
y 23 pacientes con proteinuria
en rango significativo (66%)
mientras que en el grupo de
casos 13 pacientes (37%) sin
proteinuria significativa y 22
(63%) presentaban proteinuria
en rango significativo. Con una
p de 0.80 para asociación entre
proteinuria y fragilidad con
prueba de c2. Resultados: para
el análisis de riesgo relativo respecto a proteinuria y síndrome
de fragilidad encontramos un
OR de 0.88 con IC de 0.29 a
2.62 con p de 0.70 lo cual no
muestra que la presencia de
proteinuria no se asocia con
S176
la presencia de síndrome de
fragilidad en pacientes con
nefropatía diabética. Conclusiones: no existe un asociación
estadísticamente significativa
entre el grado de proteinuria
y fragilidad en pacientes no
nefropatía diabética.
Impacto de un programa sobre
el uso racional del laboratorio
clínico
Flores Caballero Miguel Ángel,
Miguel Ángel Cruz Moreno,
Karla Elizabeth Paz Guizar, José
Luis Herrera Garza, Dionicio
Ángel Galarza Delgado
Hospital Universitario Dr. José
Eleuterio González, Universidad Autónoma de Nuevo León,
Monterrey, Nuevo León
Introducción: el laboratorio
clínico es una herramienta
indispensable en la atención integral del paciente. Impacta en
el diagnóstico, pronóstico, control de la evolución, resultados
del tratamiento y prevención
de enfermedades. Sin embargo
durante las últimas décadas su
uso no racional ha creado un
desbalance entre la aplicación
clínica y el verdadero impacto
en el tratamiento de los pacientes. Métodos: se trató de
un estudio observacional longitudinal. Fue diseñado como
parte del programa de atención
al paciente hospitalizado en
el Departamento de Medicina
Interna y realizado en las salas
de internamiento del mismo,
en el periodo de noviembre
de 2013 a agosto de 2014. Se
analizaron todos los estudios
de laboratorio clínico, que se
solicitaron por los médicos residentes encargados de pacientes
en las salas de internamiento,
se recabó el total de estudios
solicitados mediante el sistema electrónico de expediente
clínico, obteniendo estadística
descriptiva de los mismos. Además de analizar 40 expedientes
clínicos por mes, de pacientes
con internamiento mayor a 5
días y obteniendo información
sobre la indicación correcta
de los estudios solicitados,
cotejado con las guías clínicas.
Posteriormente se introdujeron
medidas preventivas e informativas sobre el uso correcto
de los estudios de laboratorio
(Informar a los médicos sobre
el costo, indicaciones correctas
de los mismos basados en guías
clínicas de las 9 enfermedades
más comunes en el departamento) y se evaluó su impacto
en la cantidad de laboratorios
solicitados. El resultado primario fue medir la cantidad de
estudios solicitados posterior
a la introducción de la herramienta preventiva y su impacto.
Resultados secundarios fueron
la identificación del tipo de
error más común en la solicitud.
Resultados: se solicitaron 19,
984 estudios de laboratorio,
con un promedio de 9.2 exámenes por paciente egresado de
nuestro departamento, siendo
un costo total de $ 3, 521, 795
pesos. De los 300 expedientes
clínicos analizados, el tipo de
error más frecuente en un 85%
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de las veces, fue el referente a
la cantidad excesiva para cierta
patología. Se obtuvo una reducción en la solicitud de estudios
de laboratorio de 1.4 estudios
por paciente, posterior a la
introducción y reforzamiento
de las medidas preventivas.
Conclusiones: a través de un
programa de vigilancia activo
es posible reducir el número de
exámenes de laboratorio.
Evaluación de un sistema electrónico para la aplicación de
tromboprofilaxis en pacientes
hospitalizados
Claudia Analy Vélez Viveros,
Dania Lizet Quintanilla Flores,
Dionicio Ángel Galarza Delgado, Homero Nañez Terreros
Medicina Interna, Hospital Universitario Dr. José Eleuterio González,
Monterrey, Nuevo León
Introducción: la enfermedad
tromboembólica venosa es
una entidad común en pacientes hospitalizados con una
prevalencia de 10 a 40%. El
uso de esquemas profilácticos
demuestra una disminución del
50% en la incidencia de estos
eventos sin aumento significativo de eventos de sangrado.
Existe poca adherencia a la recomendación del uso rutinario
de tromboprofilaxis siendo de
40%-60%. La implementación
de programas que recuerdan de
manera constante qué pacientes
presentan riesgo han demostrado un aumento en el apego
al uso de la misma. Material y
método: se evaluó prospectiva-
mente la utilidad de un sistema
de recordatorio electrónico de
aplicación de heparina profiláctica, basado en la escala
de riesgo de Caprini, en 623
sujetos hospitalizados en el área
de medicina interna, en comparación a un grupo control
de 1241 pacientes evaluados
retrospectivamente a través de
revisión de expediente médico.
Se analizaron variables demográficas, factores de riesgo de
sangrado y trombosis, así como
contraindicaciones absolutas de
aplicación de heparina profiláctica. Se comparó la proporción
de eventos de sangrado durante
el internamiento asociados a
heparina profiláctica (seguridad) así como la proporción
de eventos tromboembólicos
(eficacia). Resultados: la media
de edad fue 50.9 ± 19 años,
predominando sexo masculino, 1052 pacientes (56.4%).
Ambos grupos tuvieron riesgo similar para trombosis así
como para sangrado. Se aplicó
heparina profiláctica en 731
sujetos, 208 (33.4%) del grupo
de estudio y 523 (42.1%) de
grupo control (P<0.001). Se
presentó en mayor proporción
eventos de sangrado en grupo
control (4.1%) contra grupo de
estudio (2.4%) (P= 0.002). 12
sujetos (1%) del grupo control
presentaron trombosis venosa
profunda en comparación a 1
(0.2%) del grupo de estudio (P=
0.048). No se encontró diferencia en proporción de eventos
de tromboembolismo pulmonar y defunciones asociadas
a eventos tromboembólicos.
Conclusión: el sistema de recordatorio electrónico demostró
mayor eficacia y seguridad en la
prevención de eventos de trombosis venosa profunda así como
de eventos de sangrado en comparación con grupo control, a
pesar de una menor proporción
de pacientes con heparina profiláctica en el primer grupo. Es
probable que el uso de un sistema de recordatorio permita una
mejor evaluación inicial acerca
de la indicación y contraindicación de tromboprofilaxis
en el paciente hospitalizado;
permitiendo una menor tasa de
eventos de sangrado así como
eventos de trombosis.
Relación del índice de actividad de la psoriasis y el control
glucémico en pacientes con
diabetes mellitus y psoriasis
Roberto Gasca Arriaga, Adriana
López Tello, Heidegger Notberto Mateos Toledo, Luisa Dayana
Bucio Ortega
Centro Médico Toluca, ISSEMYM, Toluca, Estado de México
Introducción: la psoriasis (PS)
es una enfermedad inflamatoria crónica (EIC) de la piel
altamente prevalente, con una
prevalencia global del 2-3%. Es
una EIC que tiene importantes
implicaciones metabólicas
siendo relacionada principalmente con diabetes mellitus
(DM), la inflamación sistémica
ocasionada por el propio proceso autoinmune, así como
por las características de los pa-
S177
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
cientes (sobrepeso y cierto tipo
de tratamiento), contribuyen al
descontrol glucémico mediante
un aumento a la resistencia a
la insulina y/o alteraciones en
su producción, por otra parte, los múltiples tratamientos
empleados para tratar la PS,
tienen efecto anti inflamatorio
mediante los diferentes mecanismos de acción, todo esto,
se pudiera ver reflejado en las
determinaciones de glucosa en
ayuno (GA), la hemoglobina
glucosilada (HbA1c) así como
en mayor actividad psoriásica,
determinada mediante el índice de actividad de la psoriasis
(PASI). Metodología: una vez
aprobado el protocolo por el
Comité de Ética e Investigación
del Centro Médico ISSEMYM
Toluca (CMI), se reclutaron
38 pacientes que acuden al
servicio de dermatología de la
consulta externa en el CMI, que
cumplieron con los criterios de
inclusión y exclusión. Se realizó
determinación de GA, HbA1c,
PASI, índice de masa corporal
(IMC), proteína C reactiva (PCR)
y velocidad de sedimentación
globular (VSG). Resultados: 1)
los niveles de séricos de HbA1c
no correlacionan con el índice
de actividad del PASI. 2) Los
niveles séricos de glucosa correlacionaron positivamente
(débil-moderado) con el PASI.
3) Los niveles de PCR y VSG, no
mostraron relación directa con
el nivel de actividad psoriásica.
Conclusiones: la glucosa sérica en ayuno puede funcionar
como marcador bioquímico de
S178
la actividad de la PS, con una
asociación débil-moderada,
no así la HbA1c, esto debido
probablemente a que los cambios del PASI se dan en días,
tal y como ocurre con la GA,
lo cual es contrario a la HbA1c
que requiere un periodo de
tiempo aproximado de 3 meses.
En cuanto a la nula relación de
los reactantes de fase aguda,
esto puede deberse al empleo
de medicamentos empleados
encargados de disminuir la
respuesta inflamatoria, más que
a un adecuado control.
Asociación entre hiperuricemia
y síndrome metabólico
AF Rubio Guerra, H Morales
López, AK Garro Almendaro,
MI Portillo Muñoz, MB Durán
Salgado, S Huerta Ramírez, JJ
Lozano Nuevo
Hospital General de Ticomán,
SSDF, México, DF. Mexican
Group for Basic And Clinical
Research in Internal Medicine
La hiperuricemia produce resistencia a la insulina, y de esa
forma favorece la aparición
de síndrome metabólico, sin
embargo, una asociación directa entre los niveles de ácido
úrico y el síndrome metabólico
es un punto que permanece
controversial aún. Objetivo:
evaluar si existe asociación
entre la hiperuricemia y el
síndrome metabólico. Material y método: se evaluaron
103 pacientes < 40 años, sin
antecedentes de enfermedad
cardiovascular, en quienes se
evaluó la presencia de síndrome metabólico (SM) con los
criterios de la Federación Internacional de Diabetes, en todos
ellos se realizó una química
sanguínea en ayunas, incluida la determinación de ácido
úrico (método enzimático), se
consideró como hiperuricemia
valores de ácido úrico > 6.5
mg/dL en el hombre y > 5.1
mg/dL en la mujer. Los métodos estadísticos usados fueron
razón de momios y la prueba
exacta de Fisher. Resultados:
encontramos síndrome metabólico en 72 (69.9%) de los
sujetos estudiados, la razón de
momios para que en los sujetos
con hiperuricemia coexistiera
el SM fue de 2.68 (p<0.05 I.C
0.99-7.2). Cuando analizamos
por sexo, la asociación entre
niveles elevados de ácido úrico
y SM en la mujer fue baja (razón
de momios 1.86, p=0.48), sin
embargo en el varón hay una
asociación significativa (razón
de momios 6, p= 0.044, IC
1.25-7.28) entre ambas condiciones. Conclusión: nuestros
resultados muestran una asociación significativa entre la
presencia de hiperuricemia con
la de síndrome metabólico en
población mexicana, la cual
es más importante en el varón.
Caracterización de la arquitectura del sueño en pacientes con
espondilitis anquilosante y su
relación variables clínicas de
la enfermedad
Alain Sánchez Rodríguez,1 José
Padua García,1 Reyes Haro Va-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
lencia,2 Lourdes Galicia Polo,2
Rubén Burgos Vargas3
1
Servicio de Medicina Interna,
Centro Médico ABC, México, DF
2
Unidad de Medicina Experimental, Departamento de
Fisiología del Sueño
3
Servicio de Reumatología
Hospital General de México,
México, DF
Objetivos: describir la arquitectura del sueño en EA, estimar
la correlación entre escalas
de clinimetría BASDAI, BASFI,
BASMI, BAS-G, escala de somnolencia diurna de Epworth
y los parámetros de la polisomnografía (PSG). Métodos:
se incluyeron pacientes diagnóstico EA de acuerdo con
criterios de Nueva York 1984;
se realizó una PSG nocturna
completa y se evaluaron variables sociodemográficas y
clínicas: tiempo de evolución
edad al inicio de los síntomas
y al diagnóstico, características
del dolor dorsolumbar (Criterios
ASAS), actividad de la enfermedad (BASDAI), funcionalidad
(BASFI), metrología (BASMI),
evaluación de estado global
de salud (BAS-G), escala de
somnolencia diurna (Epworth). Resultados: se incluyeron
28 pacientes (25 hombres y 3
mujeres) edad de 38 ±11 años,
tiempo de evolución de 17 ±
10.05 años; VSG 20.35 ± 11.4,
El HLA-B27 (n=7/10) positivo
en el 85%, circunferencia de
cuello 38.7 ± 4.7. El puntaje
de BASDAI fue de 5.5 ± 2.4,
BASFI de 4.5 ± 2.8, BASMI
de 4.7 ± 1.8, BAS-G de 5.55
± 3.09, la escala de Epworth
7.80 ± 4.9. Los parámetros de
la PSG: tiempo total de registro
(TTR) de 480.9 ± 20.1 min,
fase de movimientos oculares
rápidos (MOR) de 60.4 ± 27.5
min y 14.6% del TTR. Las fases 1, 2 y 3 con 37.0 ± 20.6,
10.4 ± 8.1, 241.5 ± 63.1 min,
respectivamente, el tiempo de
vigilia de 81.1 ± 75.4 min, la
latencia a sueño y a MOR de
20.9 ± 17.8 y 147.3 ± 97.2
min, respectivamente, el Índice
Apnea/hiponpea de 26.5 ± 29.5
por hora y la saturación de oxígeno promedio de 92 ± 3.7%.
Se encontró apnea obstructiva
del sueño (SAOS) en 67.7% y
grave en 19% y movimientos
periódicos de las extremidades
(MPE) en 20%. Encontramos
correlación entre BASDAI con
tiempo total de sueño (r=-0.48,
p<0.01), eficacia de sueño (r=0.441, p<0.05), tiempo de fase
MOR (r=0.46, p<0.05), tiempo
de vigilia (r=0.43, p<0.05);
BASFI con apneas obstructivas máxima (r=0.38, p<0.05);
BAS-Gcon apneas obstructivas
máxima (p=-0.42 p<0.05).
Conclusión: se describen los
parámetros de la arquitectura
del sueño en pacientes con
espondilitis anquilosante, se
encontró una alta frecuencia
de SAOS y MPE, existió correlación entre la actividad de la
enfermedad y menos tiempo total de sueño, eficacia de sueño
y sueño REM, mayor tiempo de
vigilia, se encontró correlación
entre la rigidez de columna y
dolor lumbar con el número de
apneas obstructivas máximas.
Caracterización de la anatomía
radiográfica mandibular en
pacientes con esclerodermia
E Silva Gallardo, DF Tatis Giraldo, OL Vera Lastra, MP Cruz
Domínguez, EJ Vallejo Bravo
Departamento de Medicina
Interna, Hospital De Especialidades Dr. Antonio Fraga Mouret,
Centro Médico Nacional La
Raza, IMSS, México, DF
Introducción: la esclerodermia
es una enfermad autoinmune
caracterizada por el excesivo
de colágeno en piel y algunos
órganos internos, alteraciones
vasculares e inmunológicas.
La inestabilidad del sistema
estomatognatico genera signos
y síntomas que se caracterizan
por la presencia de dolor y limitación funciona y no existen
datos sobre la caracterización
de la anatomía radiográfica
mandibular en pacientes con
esclerodermia. Hipótesis: Los
pacientes con esclerodermia presentan modificación
patológica de la anatomía mandibular. Objetivo: caracterizar
la modificación de la anatomía
radiográfica mandibular y estructuras asociadas en pacientes
con esclerodermia. Materiales y
métodos: se realizó un estudio
analítico transversal comparativo. En una muestra de 21
pacientes con esclerodermia
con edad promedio de 51±7.7
años, versus 21 pacientes sin
esclerodermia con edad prome-
S179
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
dio 54±12.9 años. Se midieron
2 radiografías panorámicas
y una radiografía lateral de
cráneo y se realizó el análisis
cuantitativo de la anatomía
radiográfica mandibular con el
análisis cefalométrico de Tatis
para la radiografía panorámica™ y el análisis cefalométrico
de Tatis para la radiografía
lateral™, en el software Orthokinetor Plus 2™. Resultados:
se estudiaron 21 pacientes,
con imágenes radiológicas. Las
pacientes con esclerodermia,
presentaron menor longitud
en rama mandibular derecha
la media 69.01 vs 74.37 mm,
menor longitud en rama mandibular izquierda la media 67.32
vs 74.35 mm, menor longitud
en cóndilo mandibular izquierdo de 17.34 vs 20.35 mm,
la profundidad de la cavidad
glenoidea derecha disminuida
a 5.33 vs 6.67 mm, la profundidad de la cavidad glenoidea
izquierda de 5.33 vs 6.86 mm,
además el ángulo de la deflexión condilar fue de 110.35
grados vs pacientes controles
107.65 grados, debido a la
reabsorción ósea en el contorno
gonial, la media de los valores
de los ángulos goniacos en los
pacientes con esclerodermia
fué de 127.45 grados vs 118.47
grados en los controles. Presentan hiperdivergencia de planos
maxilo-mandibulares con aumento de la longitud facial en
el tercio inferior de la cara. Para
el análisis estadístico se empleó
la prueba t de Student, la U de
Mann Whitney, la c2. La signifi-
S180
cancia estadística se realizó con
P<0.05. Conclusión: la caracterización anatómica radiográfica
mandibular se modifica con la
esclerodermia lo que se asoció
a una limitación importante de
la apertura bucal.
Riesgo cardiovascular en lupus
y uso de esteroides
K Guerra Cabrera, LF Pineda
Galindo, F Briceño Moya
Servicio de Medicina Interna,
UMAE-Especialidades Dr. Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: padecimientos autoinmunes como lupus
eritematoso sistémico están
asociados con inflamación
vascular siendo actualmente
la principal causa de incremento de morbi-mortalidad
cadiovascular. Este riesgo es
casi 50 veces más en mujeres
que padecen Lupus. El índice
de Framingham (IF) identifica
pacientes con riesgo cardiovascular aumentado y determina
la necesidad de intervenciones
preventivas. Objetivo: establecer la asociación del riesgo
cardiovascular con el IF en pacientes con LES con tratamiento
esteroide en base a tiempo y
dosis administrada y tiempo de
evolución de la enfermedad.
Métodos: estudio de cohorte,
observacional, retrospectivo,
longitudinal. Se incluyeron
101 pacientes con Lupus y uso
de corticoesteroide desde su
diagnóstico a la realización
del estudio, calculándose el
puntaje inicial de IF y posterior
a la terapia. Resultados: de 101
casos, con seguimiento de 7.8
años en promedio, se evaluó cifras de tensión arterial sistólica,
diastólica, colesterol total, colesterol HDL, tabaquismo, tiempo
de administración de esteroides
y dosis. El IF mostró una media
de -7 puntos, con DS de 6.87
(IC 95%) y P 0.000 significativa.
Hubo 2 grupos; el primero de
pacientes con 4 años o menos
de diagnóstico y dosis promedio
de corticoesteroides mensual
mayor a 400 mg, el segundo con
5 años o más y dosis promedio
menor de 300 mg. El primer
grupo mostró una correlación
positiva entre el índice y la dosis
administrada, sin observarse esta
en el segundo. Conclusiones:
existe una correlación positiva
entre dosis de esteroide y tiempo de evolución del LES con
un aumento significativo en el
puntaje de riesgo cardiovascular
comparado con el obtenido al
inicio del diagnóstico y previo a
la administración de esteroides.
Recomendamos el uso por corto
tiempo de esteroides a dosis altas para reducir complicaciones
cardiovasculares asociadas.
Efecto de un complemento nutricio sobre el perfil metabólico
en pacientes con síndrome de
anticuerpos antifosfolipídico
(SAAF) con síndrome metabólico
Gabriela Medina García, Dulce
Martínez Lugo, Mayté Pérez
Ayala, María del Pilar Cruz Domínguez, Luis J Jara
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
U n i d a d d e I nve s t i g a c i ó n
en Epidemiología Clínica,
Coordinación del curso de
Nutricionista Dietista, Departamento de Reumatología,
División de Investigación en
Salud, Dirección de Educación
e Investigación en Salud. Hospital de Especialidades
Introducción: el SAAF se
caracteriza por trombosis recurrente, aterosclerosis acelerada
y riesgo de enfermedad cardiovascular (ECV). El síndrome
metabólico (SM) predispone
a diabetes mellitus y ECV.
Pacientes con SAAF y SM
tienen alto riesgo cardiovascular, la terapia nutricional es
parte del tratamiento integral.
Objetivo: evaluar el efecto de
un complemento nutricional
sobre el perfil metabólico de
pacientes con SAAF primario
y SM. Material y método:
estudio cuasi experimental,
prospectivo, longitudinal. Se
incluyeron adultos de ambos
sexos, con diagnóstico establecido de SAAF primario y
SM (criterios del ATP III). Se
tomaron parámetros antropométricos, glucosa, y perfil de
lípidos completo al inicio y
final del estudio. Se les indicó
un complemento nutricional
diseñado por primera vez y
que no interfiriera en el tratamiento médico, a base de
guayaba, avena, aceite de
oliva, linaza por las mañanas
durante 2 meses. Se empleó
estadística descriptiva y prueba
de Wilcoxon para muestras
relacionadas. Resultados: se
estudiaron 25 pacientes con
SAAF y SM, 21 mujeres y 4
hombres, edad 49.7± 13.3
años, tiempo de evolución
del SAAF 8.7 ± 7.5 años. El
40% de pacientes reunieron 4
criterios de SM y el 28 % cumplieron con 5 criterios. Hubo
cambios favorables en el IMC
basal: 30.32 ± 4.81; final: 30
± 4.8, peso 77.3 ± 13.8; 75.4
± 13.5 (p=0.01). Los niveles de
glucosa basal y al final fueron
de 109.5 ± 50.66 vs 92.4 ±
8.6 mg/dL, triglicéridos 170.7
± 75.3 vs 145.6 ± 74.8 mg/
dL, colesterol total 212.9 ±
47.8 vs 190.5 ± 32.3 mg/dL,
colesterol HDL 36.5 ± 10.3 vs
42.5 ± 9.6, colesterol LDL 137
± 47.6 vs 111.9 ± 27.9 (todos
con p<0.05).El complemento
nutricio fue bien tolerado.
Conclusiones: el complemento nutricional mejoró el perfil
metabólico en pacientes con
SAAF. Se sugiere que el complemento nutricional sea parte
del tratamiento integral de estos pacientes.
Revisión sistemática y metanálisis de la eficacia con el
tratamiento de leflunomida vs
metotrexato como monoterapia en pacientes con artritis
reumatoide
Roberto Alfaro Lara, Héctor
Fabricio Espinosa Ortega, César
Alejandro Arce Salinas
Servicio de Medicina Interna,
Hospital Central Sur de Alta
Especialidad Petróleos Mexicanos, México, DF
Introducción: existen recomendaciones establecidas por el
ACR, en el caso de AR temprana; definida como una duración
de la enfermedad menor a seis
meses, el uso de FARMES como
monoterapia (Metotrexato o
leflunomida) esta indicado, así
como también en actividad moderada a severa con la ausencia
de un pobre pronostico para el
paciente. Objetivo: conocer la
eficacia del uso de monoterapia
con metotrexate vs leflunomida, para evaluar el desenlace
deseado de los pacientes, así
como evaluar el beneficio de
las intervenciones. No existen
metanálisis, no se han evaluado de manera sistémica los
efectos adversos. Material y
métodos: criterios de inclusión:
Pacientes mayores de 18 años,
diagnóstico de AR seropositiva,
seronegativa y AR no especificada basada en criterios del
ACR 1987 o 2010. Pacientes
que tienen MTX solo o leflunomida solo. Se encontraron
1691 artículos en pubmed, 231
en EMBASE y 49 en MEDLINE.
Se seleccionaron 74 artículos.
Se analizaron a detalle 32, solo
se incluyeron 8 para metanálisis. Resultados: se analizaron
1990 pacientes, leflunomida
fue mejor en cuanto a mejoría
de ACR20 significativa a 52
semanas de seguimiento en
comparación con metotrexato
(OR 1.21; IC 95% [1.01-1.45])
con un I2 = 2%, con un efecto
global de la prueba aceptable (z
= 2.12; p = 0.03). Se analizaron
1152 pacientes, que fueron los
S181
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
que reportaron efectos adversos
de infecciones no fatales. En
efectos adversos infecciosos
no graves (OR 1.00; IC 95%
[0.74-1.35]) con un I2 = 42%
y una prueba de efecto global
no significativa (z = 0.01; p
= 0.99). se analizaron 1152
pacientes, que fueron los que
reportaron correctamente efectos adversos gastrointestinales
(GI) no fatales. Se encontró con
MTX, mayor numero de efectos
adversos GI (OR 1.14; IC 95%
[0.82-1.58]) con un índice de
heterogeneidad de I2 = 54%
y una prueba de efecto global
no significativa (z = 0.80; p
= 0.42). En leflunomida, presentaban mayor elevación de
transaminasas (OR 0.58; IC
95% [0.35-0.97]) con un I2 =
82% y una prueba de efecto
global significativa (z = 2.09;
p = 0.04). Conclusión: es el
primer metanálisis que compara
de manera sistemática el efecto
de leflunomida y metotrexato
como monoterapia en pacientes
con AR temprana. Se muestra
la eficacia superior de leflunomida en mejoría clínica a 52
semanas de seguimiento, dentro
de los efectos adversos mas
importantes y con mayor significancia estadística (infecciones
no graves y gastrointestinales)
existe solamente diferencia en
síntomas GI a favor de leflunomida.
Patología autoinmune y diarrea
crónica. Características colonoscópicas e histopatológicas
en biopsias de colon.
S182
Rosa Angélica Carranza Muleiro, Ricardo García Sobarzo,
Miguel Ángel Pichado Farfán, J
Jesús Torres Peralta, Miguel Ángel Saavedra Salinas, Gabriela
Medina García, María del Pilar
Cruz Domínguez
Hospital de Especialidades,
Centro Médico Nacional La
Raza, México, DF
Objetivos: identificar cuáles
son las manifestaciones colónicas, hallazgos colonoscópicos e
histopatológicos que se presentan en pacientes con patología
autoinmune. Material y método: serie de casos, de Enero
del 2012 a Enero del 2014. Se
identificó cuál es la enfermedad
colónica en patología autoinmune con manifestaciones
colónicas crónicas, mediante
la realización de colonoscopia y biopsia a pacientes del
servicio de medicina interna y
reumatología del Hospital de
especialidades del Centro Médico Nacional La Raza. Análisis
estadístico: estadística descriptiva. Resultados: incluimos 18
pacientes 17 mujeres y un hombre. La edad fue 56 años (rango
34-77) y tenían 60 meses (rango
4-144) con síntomas colónicos.
Seis pacientes tuvieron lupus
eritematoso sistémico, 7 esclerodermia y 5 artritis reumatoide.
El síntoma más frecuente fue
diarrea acuosa 55.5% crónica,
menos frecuente diarrea más
distensión abdominal (3/18) y
diarrea sanguinolenta (2/18).
La colonoscopia fue normal en
55%. Histopatológicamente
17/18 (94%) pacientes tuvieron
anormalidades, la más frecuente (50%) fue colitis crónica
inespecífica. Dos pacientes
con Lupus tuvieron colitis ulcerativa crónica inespecífica
y una vasculitis obliterante. En
Esclerodermia dos presentaron
colitis eosinofílica y dos linfocítica. Conclusión: los pacientes
con enfermedad autoinmune
y manifestaciones colónicas
crónicas requieren estudio de
biopsia a pesar de observación
colonoscópica normal, ya que
en la gran mayoría hay patología demostrable en colon.
Eficacia y seguridad de la
aplicación de plasma rico en
plaquetas en el tratamiento
de úlceras en pacientes con
esclerodermia. Estudio piloto
María del Pilar Cruz Domínguez, Jorge García Dávila,
Ángel Guerra Márquez, María
Elizabeth Enríquez Vega, Rosa
Angélica Carranza Muleiro,
Gabriela Medina García, Olga
Lidia Vera Lastra
Hospital de Especialidades,
Centro Médico Nacional La
Raza, México, DF
Objetivos: evaluar si la administración de Plasma rico en
Plaquetas es eficaz y seguro
en el tratamiento de úlceras en
pacientes con esclerodermia.
Material y método: estudio
cuasiexperimental. Incluimos
pacientes de la clínica de esclerodermia (HECMNR), atendidas
consecutivamente de mayodiciembre 2013 con úlceras
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
crónicas en cualquier región
corporal, cualquier género, de
18 años o más. El tamaño de la
muestra fue 14 úlceras. El día
de la aplicación, extrajimos 50
ml de sangre, inmediatamente
fue doblemente centrifugada
a 700 rpm. El sobrenadante
rico en plaquetas fue aplicado
inmediatamente alrededor de
cada úlcera. Las úlceras fueron
fotografiadas y medidas antes
y después de 7 semanas de la
aplicación, comparando las
úlceras en los momentos pre y
post aplicación. El análisis de
la información se estableció
aplicando estadística descriptiva. Resultados: se incluyeron
3 pacientes con esclerodermia,
del género femenino, que presentaban un total de 14 úlceras
crónicas. Se logró la cicatrización de las 14 úlceras tratadas.
No se presentaron efectos adversos durante y posterior a la
aplicación del tratamiento en
las pacientes. Concluimos una
eficacia y seguridad del 100%.
Conclusiones: el tratamiento de
úlceras crónicas en pacientes
con esclerodermia mediante la
aplicación de plasma rico en
plaquetas mejora la integridad
y viabilidad tisular, promueve
la cicatrización y reduce la
formación de nuevas úlceras.
Es un procedimiento sencillo
de realizar, replicable, eficaz,
inocuo, seguro y costeable, con
eficacia y seguridad del 100%.
Induce la remisión de úlceras
asociadas y no asociadas a
calcinosis en pacientes con
esclerodermia.
Manejo perioperatorio del
síndrome antifosfolipídico en
un hospital de referencia de
México
Eric Espejo Poox, 1 Antonio
Cabral Castañeda,2 Yemil Atisha Fregoso,1 Eduardo Carrillo
Maravilla,1 Eduardo Meneses
Sierra3
1
Departamento de Medicina
Interna
2
Departamento de Reumatología
3
Departamento de Medicina
Crítica
Instituto Nacional de Ciencias
Médicas y Nutrición Salvador
Zubirán, México, DF
Existe poca evidencia sobre el
manejo perioperatorio de la
anticoagulación en pacientes
con síndrome antifosfolipídico
(SAF). El objetivo fue conocer
el manejo y complicaciones en
pacientes con SAF sometidos a
procedimientos quirúrgicos en
un hospital de tercer nivel. Métodos: realizamos un análisis
retrolectivo de los expedientes
de pacientes con SAF que
cumplieran con los criterios de
Sidney sometidos a un procedimiento quirúrgico electivo de
2006 a 2012 en el INCMNSZ.
Se obtuvieron datos demográficos, acerca del tipo de cirugía,
manejo de la anticoagulación y
las complicaciones. Resultados:
43 pacientes (80% mujeres),
edad promedio 37.9 +- 8.8
años, 49 eventos quirúrgicos:
24 cirugías abdominales (49%),
9 vasculares (18%) y 14 misceláneas (29%); 45 (92%) de alto
riesgo. Todos tenían antecedente de trombosis: 25 (51%)
TVP, 16 (33%) TEP y 15 (31%)
EVC.19 (39%) fueron B2IgM
positivos, 21 (43%) B2IgG positivos, 43 (88%) cardiolipina
IgM, 27 (55%) cardiolipina IgG
y 23 (47%) anticoagulante lúpico; 13 (26%) triple marcador
y 26 (53%) SAF secundario. En
30 (61%) de los procedimientos la anticoagulación oral se
suspendió con por lo menos
tres días de anticipación y se
realizó un puenteo con heparina (manejo óptimo). En 35
(71%) de los eventos el INR era
<1.5. La mediana de horas sin
anticoagulación fue de 32 hrs
(IQR 24-78). La mediana de suspensión previa a la cirugía fue
12 h (IQR 12-24). La mediana
de reinicio fue 12 hrs (IQR 1224). El promedio de plaquetas
fue de 208 ± 100 mil. Ningún
paciente requirió de transfusión
de plaquetas previo al procedimiento. El tiempo quirúrgico
fue de 2.5 ± 1.3 h. La mediana
de sangrado postquirúrgico
fue de 100 ml (IQR 30-300). El
sangrado grave (necesidad de
transfusión o con inestabilidad
hemodinámica) se presentó
en 2/35 (6%) y en 4/14 (29%)
de los pacientes con INR <1.5
e INR >1.5 respectivamente
(p=0.048). 3 pacientes tuvieron
complicaciones trombóticas,
dos TEP y 1 TVP, el tiempo sin
anticoagulación fue de 20,84
y 96 horas respectivamente.
Dos de 30 pacientes (7%) con
manejo anti-trombótico óptimo
presentaron complicaciones
S183
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
trombóticas o hemorrágicas
y aquellos en los consideró
inadecuada 6 de 19 (32%)
(p=0.04). Conclusiones: el
sangrado se presentó de manera
más frecuente que la trombosis
y se asoció a una falta de manejo óptimo perioperatorio de la
anticoagulación y con un INR
> 1.5 durante la cirugía.
El volumen plaquetario medio
está disminuido en pacientes
lúpicos adultos con enfermedad activa
Guillermo Delgado García, 1
Dionicio Galarza Delgado, 1,2
Omar Borjas Almaguer, 1 Ilse
Mandujano Cruz, 1 Daniel
Benavides Salgado,1 Rolando
Martínez Granados1
1
Departamento de Medicina
Interna
2
Centro de Especialistas en
Artritis y Reumatismo
Hospital Universitario Dr. José
Eleuterio González, Universidad Autónoma de Nuevo León,
Monterrey, Nuevo León
Introducción: el lupus eritematoso generalizado (LEG) es
una enfermedad autoinmune
cuyo abordaje diagnóstico y
terapéutico es complicado. La
evaluación de la actividad de
la enfermedad es un tópico
especialmente complejo, dado
que actualmente carecemos
de un biomarcador confiable
y específico que responda a
los cambios en la actividad
de la enfermedad. El volumen
plaquetario medio (VPM) es un
marcador de activación pla-
S184
quetaria, el cual se ha asociado
previamente con inflamación, y
se ha estudiado como un indicador de actividad de enfermedad
en varias patologías inflamatorias, entre ellas, la artritis
reumatoide. Metodología: en
este estudio retrospectivo se incluyeron 40 pacientes con LEG
activo y 40 con LEG inactivo.
Los pacientes con LEG activo
estuvieron hospitalizados en
nuestra sala de internamiento,
y la actividad de su enfermedad
se evaluó con el Mex-SLEDAI. En tanto que los inactivos
eran pacientes ambulatorios
provenientes de la consulta.
Las diferencias entre grupos
fueron determinadas usando
una prueba T o una prueba U
de Mann-Whitney, según el
caso. La correlación entre las
variables se evaluó utilizando
el coeficiente de correlación
de Pearson y/o de Spearman.
Resultados: el estudio consistió
en 40 pacientes con LEG activo (6 varones) con una edad
promedio de 30.7±9.5 años,
y 40 pacientes con LEG inactivo (2 varones) con una edad
promedio de 41.8±13.1 años.
La distribución por genero fue
similar entre grupos, mas no la
etaria (p=0.001). Los pacientes
con LEG activo tuvieron una
puntuación del Mex-SLEDAI
de 9.4±4.2. El VPM (7.6±1.8 vs
8.5±1.2), así como la hemoglobina y los linfocitos, estaban
significativamente disminuidos
en los pacientes con LEG activo
al compararse con los inactivos
(p=0.001, p=0.001, y p=0.040,
respectivamente). La cuenta
total de leucocitos, por el contrario, fue significativamente
mayor en los pacientes activos
(6.8±3.6 vs 4.5±4.1, p=0.001).
No hubo diferencia significativa
entre grupos en la velocidad
de sedimentación globular.
Igualmente, en los pacientes
activos, no hubo correlación
entre el VPM y el Mex-SLEDAI.
Conclusión: en adultos con
LEG, existe una diferencia en
el VPM según la actividad de
la enfermedad. Sin embargo,
el VPM no correlaciona con la
puntuación del Mex-SLEDAI.
Ya que el VPM es un examen
paraclínico accesible y rentable, vale la pena continuar
investigando su utilidad en el
LEG, por ejemplo, correlacionándolo con otras variables,
como proteína C reactiva o anticuerpos anti-ADN bicatenario.
Ensayo clínico de no inferioridad de ácido zoledrónico en
infusión anual contra alendronato semanal en mujeres
postmenopáusicas. Evaluación
a cinco años
Mariana Moreno Ramírez, Héctor Fabricio Espinosa Ortega
Servicio Medicina InternaReumatología, Hospital Central
Sur de Alta Especialidad de Petróleos Mexicanos, México, DF
Introducción: ningún estudio
mexicano ha comparado la
eficacia de dos estrategias con
bifosfonatos y formas distintas
de administración. El objetivo
es comparar la eficacia (no
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
inferioridad) del ácido zoledrónico 5mg en infusión anual
contra alendronato oral 70
mg semanal determinada por
el aumento en la desviación
estándar del T score de masa
ósea en columna lumbar y
cadera a 5 años de tratamiento. Descripción: es un estudio
de no inferioridad, abierto,
longitudinal y prospectivo. Se
inició una cohorte en nuestra
institución en el año 2008, un
total de 119 pacientes, la mitad
de ellas recibieron 5 mg de zoledrónico en infusión anual y el
resto 70 mg de alendronato VO
de forma semanal. Se revisaron
los expedientes para verificar la
administración del tratamiento
(notas en expediente, recetas
médicas) así como la existencia
de la densitometría ósea anual
(densitometrías del 2008, 2011
2014). Se analizaron únicamente las pacientes que tenían
densitometrías completas (columna lumbar y cadera) de los
años 2008, 2011 y 2013-2014
y que completaron 5 años de
tratamiento con zoledrónico o
alendronato, siendo un total de
55 pacientes. El T-score basal
de columna lumbar en grupo
de alendronato fue de -2.14
(± 0.63), a los tres años fue
de -1.97 (± 0.58), a los cinco
años se reportó un T-score de
-2.03 (± 0.63). Para el grupo de
zoledrónico, el T-score basal
de columna lumbar tuvo una
media de -2.74 (± 0.68) con
resultado a los tres años de Tscore -2.38 (±- 0.82), hacia el
final del seguimiento las pacien-
tes tenían una media de T-score
de -2.31 (± 0.70). Se obtuvo
un resultado estadísticamente
significativo al inicio y a los tres
años de tratamiento para ambos grupos, p=0.004 al inicio
(tanto para alendronato como
para zoledrónico) y p=0.071 a
los tres años para alendronato
y p=0.065 para zoledrónico,
no así al completar los cinco
años en donde se obtuvo una
p=0.17 (alendronato) y p=0.176
(zoledronico). Los resultados
fueron similares en cadera así
como para ganancia de hueso
expresada en porcentaje y en
g/cm 2. Efectos adversos sin
significancia estadística, causa
más frecuente de abandono
fue desconocida, ninguna por
efecto adverso.
Aumento de los niveles séricos
de PR3-ANCA y recaída de
granulomatosis con poliangeítis
O Vera Lastra, RA Flores Hernández, P Cruz
Departamento de Medicina
Interna, UMAE, Hospital de Especialidades Dr. Antonio Fraga
Mouret, CMN La Raza, IMSS,
México, DF
Los PR3-ANCA (antes cANCA)
están dirigidos contra proteinsa-3 y son un marcador
de las vasculitis asociadas a
anticuerpos anticitoplasma del
neutrófilo (ANCA) entre ellas la
granulomatosis con poliangeítis
(GPA) antes granulomntosis
de Wegener y participan en
su patogenia. Los ANCA tiene
una alta sensibilidad y espe-
cificidad para el diagnóstico;
sin embargo, su papel para
predecir recaídas sigue siendo
controversial. Objetivos: determinar si el incremento de los
PR3-ANCA son útiles para predecir recaídas en paciente con
granulomatosis con poliangeítis
(GPA) antes granulomatosis
de Wegener). Pacientes y métodos: de una población de
50 pacientes atendidos en un
servicio de Medicina Interna
de un hospital de tercer nivel
se estudiaron a 30 con GPA que
cumplieron criterios de clasificación del Colegio Americano
de Reumatología y que tenían
al menos 1 años de inactividad
de la enfermedad. Se les determinó PR3-ANCA mediante
inmunofluorescencia indirecta
al menos en 3 ocasiones. A
todos los paciente se les aplicó
el instrumento de Birmingham
Vaculitis Activity Score for
Granulomatosis de Wegener
(BVAS/GW) para determinar
la recaída de la vasculitis. Se
determinó sensibilidad, especificidad, valor predictivo
positivo (VPP) y valor predictivo
negativo (VPN). Resultados:
fueron 30 pacientes, 12 mujeres (56±1) y 18 hombres (44±5
años), con evolución promedio
de 8.9±10.7 años. Las recaídas
se observaron en 21/30 (70%)
pacientes versus 9/30 (30%) sin
recaídas. De los pacientes con
recaída 6 tenían enfermedad
limitada y 15 afección grave.
En los pacientes con afección limitada la recaída se asoció con
un incremento de PR3-ANCA
S185
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
en 2/6 casos (33%) versus 4/6
(66.6%) sin recaídas. En los
pacientes con formas graves en
8/15 pacientes (53.3%) hubo recaída grave versus 7/15(46.6%).
El análisis de PR3-aNCA como
predictor de recaída de GPA
tuvo una sensibilidad de 40.9%
y especificidad de 7.5%; valor
predictivo positivo 64.2% y
valor predictivo negativo 1.7%.
En los pacientes con recaída
grave ésta se asoció con afección renal seguida del sistema
nervioso central y periférico.
Conclusiones: en este estudio
el incremento de PR3-ANCA no
se relacionó con recaída de la
granulomatosis con poliangeítis
y tuvo una baja sensibilidad y
especificidad así como VPP y
VPP bajos; estos resultados son
similares a los informados en la
literatura mundial, por lo que
los PR3-ANCA no son útiles
para predecir recaídas.
Causas de mortalidad en una
cohorte de pacientes mexicanas con esclerosis sistémica
Rubén Morales Aguilar, MP
Cruz Domínguez, OL Vera
Lastra
Medicina Interna, Hospital de
Especialidades Dr. Antonio Fraga Mouret, CMN La Raza, IMSS
Antecedentes: la mortalidad en
esclerosis sistémica (ES) varían
según cohorte con razones
de mortalidad estandarizada
(RME) de 1.5 a 7.2. Metanálisis
han reportado RME entre 3.51
(95% CI 2.74-4.50) y 3.53
(95% CI 3.03-4.11). Entre las
S186
principales causas de muerte se
han reportado: afectación pulmonar (fibrosis e hipertensión
arterial pulmonar), cardíaca,
infecciones y neoplasias. El
comportamiento clínico de las
pacientes mexicanas difiere al
reportado en otras poblaciones.
Objetivo: cuantificar tasa de
mortalidad y RME e identificar
causas de muerte en pacientes
mexicanas con esclerodermia
del Hospital de Especialidades
CMN La Raza IMSS. Material
y métodos: casos y controles
anidados en una cohorte. Criterios de selección para los
casos: Inclusión: Mayores de
16 años con ES según criterios
ACR 2013. Historia clínica
completa. Ingreso a la cohorte
entre 2000-2013. Fallecido en
el seguimiento. No inclusión:
Otra enfermedad del tejido
conectivo o síndrome de sobreposición. Eliminación: perdido
del seguimiento. Se registró:
características sociodemográficas, tiempo de evolución,
seguimiento y variedad de ES;
causa de muerte. Se calculó
tasa de mortalidad bruta y RME.
Análisis estadístico: estadística
descriptiva, c2. Tasa cruda de
mortalidad, RME. Resultados:
se incluyeron 28 defunciones
y 192 sobrevivientes; tiempo
de seguimiento 1074 personasaño. Sobrevivientes: mujeres
91.7%, edad 51.8±13.8años.
Variedad: limitada 44.3%, difusa 55.7%. Tiempo de evolución
6±4.3años. Defunciones: mujeres 82%, edad 49.4±17.8años.
Variedad: limitada 32%, Difusa
68%. Tiempo de evolución
9.4±6.5años. Tasa cruda de
mortalidad: 12.72%. Tasa específica de mortalidad por ES:
2.61%. RME 5.9x1000personas-año. Causa de muerte
(relacionada a ES): definitivamente 37.5%, probablemente
50%, no relacionada 12.5%.
De las muertes relacionadas a
ES 77.8% por daño pulmonar;
probablemente relacionad:
58.3% por infecciones y 25%
por neoplasias. Conclusiones:
la tasa de mortalidad cruda y la
RME en pacientes mexicanas es
mayor a la reportada en series
norteamericanas y europeas. El
daño pulmonar por ES constituye la principal causa de muerte
relacionada a la enfermedad;
entre las causas probablemente
relacionadas, las infecciones
son la primera causa de muerte.
Comorbilidades y complicaciones en pacientes con síndrome
antifosfolipídico primario
Gabriela Medina García, María
del Pilar Cruz Domínguez, Olga
Vera Lastra, Luis J Jara
Departamento de Reumatología, División de Investigación,
Departamento de Medicina
Interna, Dirección de Educación e Investigación en Salud,
Unidad de Investigación en Epidemiología Clínica, Hospital de
Especialidades, Centro Médico
La Raza, IMSS, México, DF
Introducción: la evolución,
prevalencia de comorbilidades
y complicaciones relacionadas
al síndrome antifosfolipídico
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
primario y al tratamiento pueden variar de acuerdo al tipo de
población. Objetivo: describir
la evolución clínica, comorbilidades y complicaciones
del SAAFP. Pacientes y métodos: cohorte retrospectiva
de pacientes con diagnóstico
establecido de SAAFP (criterios
de Sidney), mayores de 16 años
de edad y con al menos un año
de evolución. Los datos demográficos y clínicos se obtuvieron
de los expedientes clínicos,
incluyendo la evolución de la
enfermedad, recurrencia de
trombosis (más de 2 eventos
trombóticos) complicaciones,
presencia de comorbilidades
calificada con el índice de
comorbilidades de Charlson
modificado el cual califica la
ausencia de comorbilidad: 0-1
puntos, comorbilidad baja: 2
puntos y alta 3 o más puntos y el
corregido por factor edad, que
incrementa un punto por cada
década existente a partir de los
50 años. Se empleó estadística
descriptiva y prueba de chi
cuadrada. Resultados: Incluimos 70 pacientes, 55 mujeres
y 15 hombres, con edad de
44 ± 12.7 años, evolución de
la enfermedad de 10.5 ± 5.9
años. La manifestación más frecuente fue la trombosis venosa
profunda (25), tromboembolia
pulmonar (16), evento vascular
cerebral (16). Tratamiento con
anticoagulante oral: 64 pacientes (media de INR 2.2) y 6 con
aspirina. Las comorbilidades se
encontraron en 50 pacientes
(70%). El índice de comorbili-
dades de Charlson fue de 2.6
± 1 y el corregido por el factor
edad de 3.1 ± 1.4, por lo que
al hacer la corrección por edad
se considera una comorbilidad
alta (≥ 3).La comorbilidad más
frecuentemente observada fue
la dislipidemia (25), sobrepeso
(22), obesidad (21), hipertensión arterial (14) y diabetes
mellitus (7) pacientes. La única
comorbilidad asociada con
trombosis recurrente y secuela
posflebítica fue la dislipidemia
(p=0.015 and p= 0.002) respectivamente. Respecto a las
complicaciones secundarias al
SAF, se presentaron en 12 pacientes: secuela posflebítica; 6:
secuelas de EVC; 2:amputación
de extremidades, 3: secuela de
neuritis óptica. Complicaciones
relacionadas al tratamiento anticoagulante: solo 3 pacientes
requirieron de hospitalización
por sangrado. Conclusiones: las
comorbilidades son frecuentes
en SAAF durante la evolución
y pueden contribuir a las complicaciones. La dislipidemia se
asocia a trombosis recurrente
y a secuelas posflebíticas. Es
importante el control de las
comorbilidades.
Principales causas de atención
médica en el Servicio de Admisión Continua del Hospital de
Especialidades Centro Médico
Nacional La Raza durante el
año 2013
Adalid Arellano D, AL Carrillo
González, S Alvarado Romero
Departamento de Admisión
Continua, UMAE Hospital de
Especialidades Dr. Antonio Fraga
Mouret, Centro Médico Nacional La Raza, IMSS, México, DF
Introducción: en 2013 se dio
atención médica integral a más
de 20 especialidades médicas
lo que permitió identificar las
oportunidades que existen en
los sistemas para mejorar la
calidad de los servicios minimizando costos y maximizando
los recursos hacia servicios
médicos de alto rendimiento.
Justificación: es importante
establecer las causas más frecuentes de atención médica en
nuestro medio para optimizar
los recursos materiales y humanos para la atención médica
continúa oportuna y de calidad.
Objetivo: determinar las 10
principales causas de atención
médica en el departamento de
admisión continúa del Hospital
de Especialidades CMN La Raza
durante el año 2013. Material
y métodos: estudio retrospectivo, observacional, abierto y
descriptivo. Resultados: en el
2013 se registraron un total
11505 ingresos en admisión
continua de los cuales 5983
(52%) eran mujeres y 5522
(48%) hombres, la edad más
frecuente que requirió atención
médica fue de 51 a 70 años, seguida de 31 a 50 años. Del total
de estudiados 6054 ingreso al
hospital, 1759 se envió a HGZ
a continuar manejo y vigilancia;
3634 fueron egresados a domicilio y hubo 58 defunciones
en el servicio. De los 11505
casos los padecimientos que
S187
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
con mayor frecuencia se presentaron fueron: cardiopatía
isquémica (infarto del miocardio y angina inestable) con
2301 casos (20%), trastornos
del ritmo y conducción (disfunción marcapaso) con 1702
casos (14.8%), enfermedad
vascular cerebral(isquémico,
hemorrágico y hemorragia
subaracnoidea) con 977 casos
(8.5%), seguido de padecimientos hemato-oncológicos en 770
casos (6.7%), enfermedad renal
crónica con 494 casos (4.3%),
retención aguda de orina (494
casos–4.3%) a igual lo fue la
insuficiencia arterial aguda (494
casos–4.3%), lupus eritematoso
sistémico con 345 casos (3%),
absceso odontogénico 345
casos (3%) y tumor de sistema
nervioso central con 241 casos
(2.1%) como entre los primeros
10 motivos de atención en Admisión Continua. Conclusiones:
en este centro hospitalario de
tercer nivel nuevamente encontramos que la cardiopatía
isquémica es la principal causa
de atención médica de acuerdo
a lo reportado a las estadísticas
nacionales e internacionales.
Por lo cual, se espera que al
tener identificado y cuantificado el problema de salud
se orienten los recursos a las
necesidades y prioridades del
derechohabiente.
Utilidad del ultrasonido de doble frecuencia en comparación
a técnica convencional en la
instalación de accesos venosos
centrales
S188
Dania Lizet Quintanilla Flores,
Mónica Sánchez Cárdenas,
Alexandro Atilano Díaz, María
Teresa Ramírez Elizondo, Laura
Baena Trejo, Dionicio Ángel
Galarza Delgado, Miguel Ángel
Villarreal Alarcón, Rodolfo Márquez Martin, Juan O Galindo
Galindo
Departamento de Medicina Interna, Hospital Universitario Dr.
José Eleuterio González, Universidad Autónoma de Nuevo
León, Monterrey, Nuevo León
Introducción: la instalación de
accesos vasculares centrales
mediante técnica convencional se ha asociado a una tasa
de complicaciones de hasta
35%. Se ha demostrado que el
ultrasonido representa una técnica segura, con menor tasa de
complicaciones, así como con
una reducción en el número
de punciones necesarias para
su instalación. Realizamos un
estudio retrospectivo con el objetivo de analizar diferencias en
la instalación de accesos vasculares centrales mediante técnica
convencional en comparación
a ultrasonido. Material y métodos: se evaluó la instalación
de 607 catéteres con apoyo del
ultrasonido de doble frecuencia
en comparación a 412 catéteres
instalados mediante técnica
convencional, realizados en
su mayoría por residentes de
las áreas de medicina interna y
cirugía general. Se analizaron
variables demográficas, indicaciones de instalación, tipo
de procedimiento además de
la presencia de acceso venoso
central previo al procedimiento, ventilación mecánica, sitio
anatómico, estado de alerta y
experiencia del personal que
instala el catéter. Comparamos
la tasa de complicaciones mecánicas menores y mayores,
necesidad de recolocación de
catéter, número de punciones y
cantidad de catéteres utilizados.
Resultados: se identificaron
algunas diferencias basales
en el grupo de pacientes en
los que se utilizó la técnica
convencional en comparación
al uso del ultrasonido las cuales incluyeron: pacientes más
jóvenes, con predominio de
catéter venoso central sobre
hemodiálisis, mayor proporción
de procedimientos de urgencia, con ventilación mecánica
y con acceso venoso central
previo al procedimiento. No
encontramos diferencias en la
proporción de complicaciones
mayores, sin embargo el grupo de técnica convencional
presentó mayor tasa de punciones arteriales (8.3% vs 3.3%,
p=0.001) así como necesidad
de más de un catéter para lograr
la correcta instalación del catéter (8.3% vs 4.5%, p=0.026).
No encontramos diferencias
en cantidad de punciones realizadas ni en necesidad de
recolocación del catéter. Conclusiones: el uso del ultrasonido
se asoció a una menor tasa de
punciones arteriales así como
menor proporción de catéteres
durante la instalación de accesos venosos centrales, sin tener
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
repercusión en complicaciones
mayores, total de punciones ni
en necesidad de recolocación
del catéter. Recomendamos
el uso del ultrasonido en la
instalación de accesos venosos centrales debido a que es
una técnica segura, fácil de
implementar y con menores
complicaciones.
Valores de adipocitocinas en
pacientes normotensos y prehipertensos
AF Rubio Guerra AF,1 H Vargas
Robles,2 JJ Lozano Nuevo,1 G
Vargas Ayala,1 MB Duran Salgado,1 BE Escalante Acosta3
1
Hospital General de Ticomán,
México, DF
2
CINVESTAV, México, DF
3
CINVESTAV, Monterrey,
Nuevo León
Las adipocitocinas son péptidos
producidos por el tejido adiposo que participan en varias
vías fisiopatológicas y tienen
relación con mecanismos que
promueven o inhiben la inflamación, la resistencia a la
insulina, la disfunción endotelial y la aterogénesis. La
evidencia muestra que niveles
séricos disminuidos de adiponectina y/o cifras aumentados
de resistina son factores que
influyen en el desarrollo de hipertensión arterial y participan
en el incremento de la mortalidad cardiovascular. Nuestro
grupo encontró que los pacientes con hipertensión cursan
con valores significativamente
mayores de resistina, que los
normotensos. Objetivo: valorar
los niveles circulantes de las
adipocitocinas adiponectina y
resistina en pacientes prehipertensos. Material y método: Los
niveles séricos de adiponectina
y resistina fueron determinados
por ELISA (RyDSystems Minneapolis), en 20 pacientes con
prehipertensión, (de acuerdo
a los criterios del JNC VII), así
como en 20 sujetos normotensos no diabéticos. El método
estadístico empleado fue la
prueba U de Mann-Whitney.
Resultados: encontramos que
aunque el grupo control tuvo
valores menores de resistina
que el grupo de pacientes
prehipertensos, no alcanzó
significancia estadística (12.25
vs 14.38 pg/mL, p > 0.05). A
su vez, el grupo control tuvo
valores significativamente mayores de adiponectina que los
pacientes prehipertensos (11.3
vs 7.51 _g/mL, p = 0.028).
Conclusiones: los pacientes
prehipertensos muestran niveles menores de adiponectina
y mayores de resistina que los
normotensos, aunque en el caso
de resistina, esto no es significativo. Esto contribuye a explicar
el mayor grado de inflamación
y disfunción endotelial observado en los prehipertensos.
Evaluación flujométrica con
doppler pulsado: modelo experimental de embolismo
pulmonar
Mario Alberto Benavides González, José Luis Ramos Martínez,
Adán Pacheco Cantú, Nancy
Olivia Herrera Elizondo, Juan
Manuel Reyna Fernández
Servicio de Cardiología, Departamento de Medicina Interna,
Hospital Universitario, UANL,
Monterrey, Nuevo León
Introducción: la embolia pulmonar (EP) es la tercera causa
de muerte cardiaca, siendo
un diagnóstico difícil con una
presentación clínica inespecífica. El diagnóstico precoz
es fundamental, ya que el
tratamiento inmediato es muy
eficaz. La ecocardiografía no se
recomienda como herramienta
diagnóstica en pacientes hemodinámicamente estables.
Objetivo: evaluar la dinámica
flujométrica aórtica y pulmonar durante la presencia de
embolismo pulmonar producido de manera experimental en
perros, en velocidad máxima
(Vm). Material y métodos: es
un estudio transversal, comparativo, prospectivo, no ciego,
experimental, usando 10 perros mestizos, previamente
acondicionados de 5 a 7 días.
El cálculo de la muestra sujeto
a conveniencia. Se inicia con
sedación de los especímenes
con fenobarbital, su intubación
y ventilación mecánica; se
realizan electrocardiogramas
y ecocardiograma transtorácico basal. Se canaliza la
vena femoral por técnica de
Seldinger modificada y coloca
introductor 7FR, recolectando
5 cc de sangre permitiendo
la formación del coagulo. Se
realiza corte de coagulo y
S189
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
embolización. Posteriormente se realizan las mediciones
flujométricas post-evento,
finalizando con sacrificio del
espécimen y envió a estudio
anatomopatológico. Resultados: se demostró distribución
normal de los datos con prueba
de Shapiro Will y uso prueba T
student para muestra relacionadas para valorar diferencias
entre los grupos considerando
p<0.05 como significativo. Los
datos se analizaron usando
SPSS para Windows (versión
18). Se realizaron en total 10
actividades que provocaron un
TEP experimental. Basalmente,
la Vmax aortica media fue de
0.82±0.11 m/s y la pulmonar
de 0.75±0.12 m/s. Posterior
al embolismo se midieron
nuevamente encontrando la
Vmax aórtica media fue de
0.89±0.03 m/s y la pulmonar
de 0.71±0.16 m/s. La diferencia media entre las mediciones
para el flujo aórtico fue de
0.07 m/s (IC95%=-.1-0.25 m/s)
(p=0.07). En el flujo pulmonar
la diferencia media fue de
0.03 m/s (IC95%=-.03-0.12
m/s) (p=0.34). En la histología
se demostró TEP en cada espécimen con microtrombos y
congestión vascular. Aunque
los resultados obtenidos no
mostraron cambios significativos en la Vm, se demostró una
tendencia en el flujo aórtico
hacia el aumento de la velocidad, así como una diferencia
no significativa en el flujo pulmonar hacia la disminución.
S190
Etiología y resistencia antimicrobiana: Pacientes con infección
de vías urinarias en el Nuevo
Sanatorio Durango, México, DF
Frida Páramo Rivas, Alejandro
Tovar Serrano, Mario Enrique
Rendón Macías
División de Posgrado, Facultad
Mexicana de Medicina Universidad La Salle. Departamento
de Medicina Interna del Nuevo
Sanatorio Durango, México, DF
Antecedentes: la infección
de vías urinarias (IVU) es la
tercera causa de morbilidad
por infecciones, su diagnóstico y tratamiento apropiado
involucra la determinación
del patógeno y la sensibilidad
o resistencia antimicrobiana.
El tratamiento empírico a pacientes con IVU por bacterias
productoras de beta-lactamasas
de espectro extendido (BLEE)
no estudiada, conlleva a la
progresión de la enfermedad
por un tratamiento inefectivo.
Materiales y método: se realizó
un estudio unicéntrico transversal prospectivo, observacional
y descriptivo. Se seleccionaron
a pacientes hospitalizados con
IVU en el servicio de medicina
interna del Nuevo Sanatorio
Durango (NSD). Se aislaron
microorganismos en la orina de
los pacientes mediante cultivo,
se tipificaron las cepas mediante pruebas bioquímicas y se
realizaron pruebas de sensibilidad y resistencia. Resultados:
a los pacientes con síntomas
urinarios (78) se les realizó
urocultivo y en 46 se obtuvie-
ron aislados bacterianos. Se
identificó Escherichia coli en el
91.5% y dentro de este grupo
el 38.3% mostró características
BLEE positivas. La mayor resistencia fue contra ampicilina/
sulbactam y ciprofloxacino,
seguida por ceftriaxona y TMP/
SMZ. Conclusiones: en este
estudio demostramos la alta
incidencia de microorganismos
productores de beta lactamasas
en pacientes con IVU hospitalizados en el servicio de
medicina interna del NSD en
México. Este estudio permitirá
mejorar las guías de tratamiento
clínico empírico en pacientes
con IVU.
Evalu ación d e la terapia
antibiótica empírica para neumonía asociada con ventilación
mecánica en la Unidad de Cuidados Intensivos de un hospital
privado del noreste del país
Juan Manuel de Jesús Cortés de
la Torre, María Teresa Sánchez
Ávila, Fernando Castilleja Leal,
Luis Mario Villela Martínez, Víctor Alán Martínez Ovalle
Unidad de Cuidados Intensivos, Departamento de
Bacteriología, Unidad de Vigilancia Epidemiológica, Centro
Médico Hospital San José
Introducción: el objetivo primario de esta investigación,
está encaminado a responder
la siguiente pregunta: ¿Es apropiado el tratamiento antibiótico
empírico para la Neumonía
Asociada a Ventilación Mecánica en la Unidad de Terapia
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Intensiva de Adultos del Centro
Médico Hospital San José? Para
responder dicha pregunta, se
comparó el tratamiento empírico inicial con los cultivos
y antibiogramas de aspirado
endotraqueal, lavado bronquio
alveolar y cepillado endoscópico protegido, de los pacientes
diagnosticados con NAVM de
los archivos de bacteriología
del Centro Médico Hospital San
José. Resultados: quedando 41
pacientes capturados, por lo
que los siguientes análisis se
harán de acuerdo a una n=41.
En cuanto a los diagnósticos por
los que ingresaron fueron 14/41
por traumatismo cráneo-encefálico, 8/41 por enfermedad
vascular-cerebral, 5/41 por infarto agudo de miocardio, 5/41
pacientes postquirúrgicos, 3/41
por sangrado de tubo digestivo,
2/41 por distrofia simpática refleja, 1/41 por miastenia gravis,
1/41 por neumonía adquirida
en la comunidad, 1/41 por
estado epiléptico y 1/41 por
poliangeítis microscópica. En
cuanto al tratamiento inicial de
la terapia antibiótica, se detectó
que en un 60.9% de los casos,
existía uso previo de antibióticos. Los antibióticos iniciales
más utilizados fueron los carbapenémicos en un 48% de los
casos, seguido de quinolonas
en un 41% y cefalosporinas en
un 26%. Conclusiones: dentro
de los resultados de nuestra
investigación, destaca el predominio de pacientes de género
masculino (78.04%), sin embargo como se demostró, no hay
diferencia estadística en cuanto
a la mortalidad al comparar
ambos géneros. Así mismo, los
diagnósticos de ingreso no justifican el alto porcentaje de uso
de antibióticos previo al diagnóstico de la NAVM. Ésta es
una situación detectada y que
pudiera representar un área de
oportunidad sobre el tema del
mal uso y abuso de prescripción
de antibióticos, ya que como
se demostró en los resultados,
el uso previo de antibióticos es
un factor de riesgo significativo,
para desarrollar infecciones
mixtas en vías respiratorias
inferiores.
Calidad de vida relacionada
a la salud en pacientes con
diabetes mellitus tipo 2 e implicaciones clínicas
Alain Sánchez Rodríguez,1 Valentín Trujillo Gutiérrez,1 Reyna
Maribel González Ramos2
1
Centro Médico ABC, México, DF
2
Centro Médico ISSEMYN, Ecatepec, Estado de México
Objetivo: medir la calidad de
vida relacionada a la salud
(CVRS) y parámetros clínicos en
pacientes con DM2, identificar
asociaciones entre características clínicas y deterioro de
la CVRS. Material y métodos:
estudio observacional, prospectivo transversal que incluyen
pacientes con diagnóstico de
DM2 por criterios de la ADA
durante el periodo entre septiembre a noviembre del 2013,
se excluyeron pacientes con
enfermedad renal crónica con
tratamiento sustitutivo y otras
comorbilidades graves. Se recabaron datos demográficos
y exámenes de laboratorio
incluyendo determinación de
hemoglobina glucosilada
(HbA1c). Se evaluó la CVRS
mediante el cuestionario EuroQuol 5D (EQ-5D) que incluye
un puntaje compuesto por 5
ítems: 1) movilidad, 2) cuidado personal, 3) actividades
cotidianas, 4) dolor o malestar,
5) ansiedad/depresión y adicionalmente una escala visual
análoga (EVA) de estado de
salud. Resultados: se incluyeron 79 pacientes se septiembre
a noviembre del 2013, 26
hombres (32.9%) y 53 mujeres
(67.1%) con edad 52.75 ± 8.86
años, mediana de tiempo de
evolución de DM2 medido en
meses de 120 (RIQ 60-156),
índice de masa corporal de
31.11 ± 5.48 kg/m 2, HbA1c
8.45% ± 1.82%, complicaciones crónicas en 38 (48.1%).
Tratados con antidiabéticos orales e insulina en 93.7 y 70.9%,
respectivamente. El puntaje
del EQ-5D y la escala visual
análoga tuvieron puntajes de
0.73 (RIQ 0.66-0.85) y 80 (RIQ
60-80), respectivamente. La
frecuencia de afeción por cada
ítem fue en movilidad, 44.3%,
cuidado personal 12.7%, actividades cotidianas 25.3%,
dolor o malestar 72.2% y ansiedad-depresión en 55.7%.
Los puntajes combinados no
tuvieron correlación con las
variables clínicas; sin embargo, hubo correlación entre el
S191
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
puntaje del EQ5D y la EVA con
los niveles séricos de colesterol
total r=-0.22 (p=0.047) y -0.24
(p=0.033), respectivamente.
El puntaje global del EQ-5D,
fue menor en aquellos en tratamiento con insulina 0.66 vs
0.77 (p=0.02). Conclusiones:
existe deterioro de la calidad
de vida en pacientes con DM,
el puntaje de EQ-5D no tiene
correlación con las variables
clínicas pero si con el tratamiento utilizado.
¿Se justifica medir el QT antes
de recetar macrólidos?
Héctor Manuel Gómez Vázquez
Médica Boulevard, San Juan del
Río, Querétaro
Introducción: Se reportó la utilidad del empleo de azitromicina
en la profilaxis de exacerbaciones de EPOC (Albert RK, 2011)
y una mejor respuesta al tratar
neumonía en ancianos (Asadi
L, 2012). Sin embargo, existen
riesgos al usarlo en los pacientes que frecuentemente atiende
el internista (Mortensen, 2014)
(Moshholder A, 2013) (Ray WA,
2012). Se recomienda evitar el
uso si hay frecuencia cardiaca
>100 o QTc>450 para prevenir
arritmias ventriculares. Objetivo medir qué porcentaje de
pacientes de consulta externa
cotidiana, y que requirieron
electrocardiograma por el juicio clínico del médico, tiene
un QT>450, para fundamentar
la recomendación del trazo
en todo paciente candidato a
S192
recibir macrólidos. Material y
métodos. electrocardiograma
y cálculo de fórmula de de
QTc de Bazett en pacientes
consecutivos de consulta de
medicina interna mayores de
40 años, compilación en Excel
y cálculos por Excel e IBM SPSS
Statistics. Se analizaron curvas
de dispersión totales y por sexo
y edad con líneas de tendencias, coeficiente de Pearson
edad/QTc, promedios, mediana, frecuencia por histograma y
percentilas. Resultados: en 140
pacientes (59% varones), con
edad media de 68 años (rango
40 a 92), encontré un QTc
promedio de 426 (357-511),
cubriendo la percentila 80%
447 mseg, 14.3% de pacientes
tienen un QTc superior a 450
mseg. No encontré correlación
entre edad y longitud del QTc.
Un 14% de pacientes de la
consulta cotidiana tienen un
QTc elevado y constituirían
pacientes con riesgo de arritmia
al prescribirles azitromicina, de
acuerdo con las recomendaciones publicadas. Conclusión:
considerando los macrólidos
medicamentos de primera línea
en el manejo de infecciones
respiratorias y la posible extensión de su uso, se justifica
tomar un trazo en todo paciente
candidato a tratamiento con
azitromicina o macrólidos. La
impresión de que normalmente
son recetados sin tal precaución
justificaría una observación más
intensa que la de este estudio
exploratorio. Recursos estadísticos al alcance del médico son
útiles para evaluar riesgos en la
práctica cotidiana.
Prevalencia y factores de riesgo
asociados con delirium intrahospitalario en el paciente
geriátrico
Rocío Morales Delgado,1 Dania
Lizet Quintanilla Flores,1 Sara G
Yeverino Castro,1 Karina A Rodríguez Quintanilla,2 Dionicio
Galarza Delgado1
1
Departamento de Medicina
Interna
2
Centro Regional para el Estudio del Adulto Mayor (CREAM)
Hospital Universitario José
Eleuterio González, Universidad Autónoma de Nuevo León,
Monterrey, Nuevo León
Objetivo: determinar la
prevalencia del delirium intrahospitalario en adultos
mayores de 60 años y los
factores de riesgo asociados.
Métodos: se realizó un estudio
observacional, longitudinal,
retrospectivo que incluyó 202
pacientes mayores de 60 años
de edad internados en la sala
de Medicina Interna de un hospital de tercer nivel. Se utilizó
el Método de Evaluación de
Confusión (CAM) para realizar el diagnóstico de delirium
intrahospitalario. Se analizaron variables demográficas
y comorbilidades (score de
Charlson), así como variables hospitalarias consideradas
factores de riesgo para el desarrollo de delirium. Se clasificó
a la población en dos grupos,
de acuerdo a la presencia o no
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de delirium intrahospitalario.
Se compararon diferencias
respecto a estancia hospitalaria y mortalidad entre ambos
grupos. Se obtuvieron medias
y desviación estándar. La comparación entre grupos se realizó
con la prueba t de Student y la
prueba de Mann-Whitney. Las
variables categóricas se analizaron mediante la prueba de
c2 y la prueba exacta de Fisher.
Se utilizó regresión logística
para el análisis univariado y
multivariado de los principales
factores de riesgo. Un valor de p
menor de 0.05 fue considerado
estadísticamente significativo.
Resultados: la prevalencia de
delirium intrahospitalario fue
de 9%, el 31.6% con delirium
hipoactivo, 57.9% con delirium hiperactivo y 10.5% con
delirium mixto. La media de
edad fue de 72.6±9.2 años, con
distribución por género 50%
mujeres y 50% hombres. Los
factores de riesgo como edad
mayor a 70 años, antecedente de demencia, y el uso de
medidas de sujeción así como
dispositivos invasivos como
sondas y catéteres durante el
internamiento fueron estadísticamente significativos para
el desarrollo de delirium (P <
0.05). No hubo diferencia en estancia hospitalaria y mortalidad
intrahospitalaria. Conclusiones:
identificamos una prevalencia
de delirium hospitalario en el
paciente geriátrico inferior a
la reportada en la literatura. Es
importante enfatizar los esfuerzos en realizar el diagnóstico
de delirium intrahospitalario
en adultos mayores, además de
detectar los factores de riesgo
asociados como edad mayor
a 70 años y diagnóstico de demencia previa. Adicionalmente
se deben evitar factores como
sujeción y uso prolongado de
dispositivos invasivos ya que
esto nos ayudará a disminuir
la morbimortalidad en dicha
población.
Asociación entre la deficiencia de síntesis de alfa uno
antitripsina y síndrome hepatopulmonar en pacientes con
insuficiencia hepática
Elizabeth Rodríguez Romero,
César Iván Elizalde Barrera,
Nayeli Gabriela Jiménez Saab
Servicio de Medicina Interna,
Hospital General Xoco, Secretaría de Salud del Distrito Federal,
México, DF
Introducción: la cirrosis hepática es uno de los principales
problemas de salud pública
en México. En la mayoría de
pacientes con enfermedad hepática avanzada hay alguna
alteración pulmonar, como lo
es el síndrome hepatopulmonar
y la hipertensión portopulmonar. Algunos textos sugieren la
diferenciación entre éstas dos
entidades, sin embargo existe
un factor que podría asociarse
a la etiología que sería una
baja producción de alfa uno
antitripsina (A1-AT) ya que es
un producto del metabolismo
hepático y se esperaría que en
pacientes con falla hepática
disminuya, condicionando
hipoxemia y atrapamiento aéreo. Es por eso que realizamos
este estudio cuyo objetivo
es determinar la asociación
entre los niveles de A1-AT, el
daño hepático y el síndrome
hepatopulmonar. Descripción
del caso: se trata de un estudio
transversal, analítico en 41
pacientes con insuficiencia
hepática Child Pugh B y C, que
tuvieran entre 18 y 70 años,
seleccionados en dos centros
de cuidados primarios en el
DF. La presencia o ausencia
de síndrome hepatopulmonar
se determinó con la prueba
de ortodeoxia y se midieron
las concentraciones séricas de
A1-AT, así mismo se realizó
espirometría para evaluar la
traducción espirométrica de
los resultados previos. Comentarios: de los 41 pacientes
estudiados el 85% presentaban
síndrome hepatopulmonar y niveles de A1-AT baja. Basados en
la razón de momios e intervalos
de confianza encontramos que
el déficit de A1-AT es un factor
que aumenta 3.25 veces el
riesgo de síndrome hepatopulmonar. La c² para comparar
proporción de pacientes con
insuficiencia hepática Child
Pugh B y C, así como el déficit de A1-AT encontramos un
resultado de c² 8.9 con una
P<0.01. La t de Student para
las medias aritméticas de la
concentración de A1-AT en
pacientes con síndrome hepatopulmonar y sin él encontramos
una p ≤ 0.00002. El ANOVA
S193
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
para el patrón espirométrico y
el valor medio de concentración de A1-AT es de 13.85 con
un IC 95% 19.3-26.6, con una
P<0.0009. Conclusiones: existe evidencia significativa con
respecto a la relación entre el
grado de insuficiencia hepática,
los niveles séricos de alfa uno
antitripsina y la presentación de
síndrome hepatopulmonar con
una traducción espirométrica
de obstrucción presentándose
como un factor asociado a
los componentes etiológicos
previamente conocidos del
síndrome hepatopulmonar.
Factores asociados con respuesta de leflunomida en pacientes
con artritis reumatoide
César Armando Sifuentes
Cantú,1 César Alejandro Arce
Salinas,1 Fabricio Espinosa Ortega2
1
Servicio de Medicina Interna
2
Servicio de Reumatología
Hospital Central Sur de Alta Especialidad, PEMEX, México, DF
Introducción: la artritis reumatoide es la artritis inflamatoria
mas común, afecta del 0.5 a
1% de la población mundial.
La elección del tratamiento
depende de varios factores,
incluyendo la severidad de la
actividad de la enfermedad
cuando se inicia la terapia
y la respuesta del paciente
a la terapia previa. En todos
los pacientes se debe iniciar
tratamiento con Fármacos Modificadores de la Enfermedad
(FARME) lo más pronto posible.
S194
La leflunomida es una prorroga
que inhibe de manera reversible
la dihidroorato deshidrogenasa,
interrumpiendo así la síntesis de
novo de pirimidinas; por lo que
este fármaco actúa previniendo
que los linfocitos acumulen
suficientes pirimidinas para la
síntesis de DNA y así disminuye el infiltrado inflamatorio a
nivel de la sinovia. Descripción
del caso: conocer los factores
asociados a buena respuesta al
uso de este fármaco, permitirá
elegir a los mejores candidatos
al tratamiento de manera oportuna. Por lo que se realizo este
estudio de casos y controles.
Comentarios: se analizaron
123 expedientes, del sistema
electrónico de servicios médicos de PEMEX, de los cuales
55 pacientes cumplieron con
los criterios de inclusión. El
29.1% de los pacientes (16
pacientes), no habían recibido
tratamiento previo con algún
otro FARME; el motivo de inicio en 65.5%, fue por falta de
respuesta al tratamiento previo,
1.8% fue por efecto adverso
hematológico a FARME previo
y 3.6% por efecto adverso GI
a FARME previo. El porcentaje
de pacientes en remisión según
escala de DAS 28, a los 6 meses
y 12 meses, se logro en 67.3 y
47.3%. En el análisis estadístico
había diferencia significativa a
los 6 meses en los pacientes con
VSG mayor, con una media de
25.9 para el grupo de remisión
y 33.8 para los pacientes que no
lograron este objetivo, p: 0.026.
Mientras que a los 12 meses, la
variables con diferencia significativa entre los grupos con o
sin remisión eran VSG con una
media 33.48 para grupo sin remisión y 25.12 en los pacientes
con remisión, p:0.017; Factor
reumatoide, con una media de
205.6 para el grupo en remisión
y 380.6 para el grupo sin remisión, p:0.028 y DAS 28 a los 6
meses con un valor de 2.66 en
el grupo de remisión y 3.2 en el
grupo de no remisión, p:0.013.
Conclusión: los factores que
predicen la respuesta a leflunomida a 6 meses, son el valor de
VSG, mientras que la respuesta
a 12 meses son: VSG, FR y el
valor de DAS 28 a los 6 meses.
Sobrevida prolongada en
mexicanos con glioblastoma
multiforme (GBM) recurrente,
serie de casos
Isis Ixchel Medrano Deleija, 1
Adolfo Isassi Chapa,2 Julio César
Dávila Valero3
1
Residente de segundo año de
Geriatría
2
Médico Oncólogo, Servicio de
Oncología Clínica
3
Médico Internista y Geriatra,
Servicio de Geriatría
Departamento de Oncología,
Tec Salud: Programa Multicéntrico, Hospital San José,
Monterrey, Nuevo León
Introducción: en nuestro país el
glioblastoma multiforme (GBM)
constituye cerca de 30 % de los
gliomas y 9 % de las neoplasias intracraneales. La historia
clínica de estos pacientes es
usualmente corta (<3 meses
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
en >50% de los pacientes); la
supervivencia media del mexicano es de 16 meses. Aunque
GBM puede ocurrir en todos los
grupos de edad, se observa con
mayor frecuencia en los adultos
de 50 a 70 años de edad. El
diagnóstico se identifica mediante resonancia magnética
(RMN) y se corrobora mediante
histopatología, su tratamiento
estándar se basa en resección
quirúrgica, quimioterapia local
(opcional) y radioterapia con
quimioterapia sistémica a base
de temozolamida (TMZ), para
posteriormente, pasar a 6 meses
de TMZ. En la recurrencia local
del GBM la respuesta al tratamiento se ha visto en menos del
10% de los paciente y la media
de supervivencia se estima de
9 a 10 semanas. Hoy en día el
anticuerpo monoclonal bevazisumab junto o no a Irinotecan
es el medicamento que ha demostrado tener un impacto en
la sobrevida de los pacientes
con GBM recurrente y/o progresivo. Descripción del caso: se
expone una serie de casos de 4
pacientes de edades 77, 48, 64
y 65 años con sobrevida superior a lo esperado en población
mexicana con un promedio de
54.5 meses, los cuatro casos
debutaron con focalización
neurológica y crisis convulsivas, se abordaron inicialmente
con el tratamiento estándar del
GBM, solo dos de ellos permanecen vivos y se trataron con
Bioterapia que abandonaron
por su propia decisión sin embargo la sobrevida esperada es
de al menos 7 meses. Comentarios: en esta serie de casos los
pacientes no reunían todas las
características para una sobrevida alargada como es: la edad
menor de 35 años, el comienzo
clínico sin defecto neurológico, la exéresis quirúrgica total
y el tratamiento estándar ya
comentado anteriormente que
ha demostrado prolongar la
sobrevida del GBM; a su favor
tenían el Karnofsky inicial de
100 y los actualmente vivos de
70 al momento de abandonar la
bioterapia. Conclusiones: en un
paciente con sospecha de GBM
la RMN nos permitirá definir la
lesión y planear su resección,
una vez que se realice se deberá
corroborar el diagnostico con
patología e iniciar tratamiento
estándar. Encontramos en esta
serie de casos una sobrevida
promedio mayor a lo esperado
en población mexicana.
Toxina botulínica tipo A para
tratamiento de manifestaciones
clínicas en manos en esclerodermia
MA Flores Méndez,1 MP Cruz
Domínguez, 2 LE Molina Carrión,3 G Tafoya Arellano3
1
Departamento de Medicina
Interna
2
División de Investigación
3
Departamento de Neurología
Hospital de Especialidades Dr.
Antonio Fraga Mouret, CMN
La Raza
Introducción: en la esclerodermia se produce una
vasculopatía estructural y fun-
cional por hiperplasia y fibrosis
de la capa íntima asociada a
vasoespasmo al frío o estrés, llevando a hipoxia e isquemia de
los tejidos. La toxina botulínica
tipo A produce denervación
química del músculo liso vascular local, y por transporte
retrógrado a sistema nervioso
central alteraciones funcionales
en nocicepción; también bloquea la liberación de vesículas
de norepinefrina previniendo
vasoconstricción por vía simpática. En estudios retrospectivos
se ha descrito beneficio en
la aplicación de toxina botulínica tipo A interdigital y a
nivel palmar en el manejo de
fenómeno de Raynaud primario y secundario, mostrando
disminución importante de la
severidad y frecuencia de los
episodios vasoespásticos, del
dolor y curación de úlceras
digitales. Objetivo: evaluar la
efectividad de la toxina botulínica tipo A inyectada en
manos, para el tratamiento del
fenómeno de Raynaud, úlceras
digitales, calcinosis subdérmica, esclerodactilia, flexión
dedos-palma, y funcionalidad
en esclerodermia. Material y
método: estudio piloto cuasiexperimental, realizado en
HECMNR, septiembre-2013 a
mayo-2014. Incluyó pacientes
con esclerodermia en falla a
tratamiento estándar y ≥ 1 de
lo siguiente en manos: calcinosis subdérmica, fenómeno de
Raynaud, úlceras digitales, esclerodactilia, limitación flexión
dedos-palma. Se inyectó toxina
S195
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
botulínica tipo A interdigital y
palmar. Evaluamos efectividad
a 0,2,4 y 8 semanas. Análisis
estadístico estadística descriptiva. Resultados: incluimos 8
pacientes, 12.38±4.24 años
con manifestaciones en manos,
hombre:mujer 7:1, variedad
difusa:limitada 1:1. De 5 con
esclerodactilia mejoró 1(20%);
de 13 manos con limitación
flexión dedos-palma 2 (15%)
incrementaron FTP y 3 (42.8%)
de 7 pacientes mejoraron FTP.
Las calcinosis no mejoraron.
Las 3 pacientes con fenómeno
de Raynaud activo sin úlceras
mejoraron en 2 semanas y de
36 úlceras, 22 (61%) mostraron
respuesta (13 se resolvieron y
9 disminuyeron) a las 8 semanas; el dolor intenso de 3 con
úlceras digitales disminuyó en
2(66.6%). La funcionalidad
mejoró desde las 2 semanas en
5 de 6 pacientes (83%). Conclusiones: la inyección local de
toxina botulínica tipo A en manos y dedos de pacientes con
esclerodermia muestra resultados promisorios en el manejo
de alteraciones vasoespásticas
y en funcionalidad.
Correlación entre tasa de filtrado glomerular y marcadores de
inflamación en AR
Mauricio Eduardo Rubio Sánchez, Fidel Cerda Téllez, Alberto
Francisco Rubio Guerra, Martín
de Jesús Reyna Ramírez, Jorge
Luis Garcia Sánchez
Medicina Interna, Hospital General Xoco, Secretaría de Salud
del Distrito Federal, México, DF
S196
Introducción: una gran variedad de alteraciones renales
pueden ocurrir en pacientes
con artritis reumatoide (AR), debido a la enfermedad de base,
a fármacos utilizados como
tratamiento y a enfermedad
renal concomitante no relacionada con AR, la cual es más
probable en pacientes adultos
mayores con comorbilidades
significantes. Se ha establecido
a la PCR como factor de riesgo
cardiovascular. En pacientes
factor reumatoide (FR) positivos
con AR pueden experimentar
enfermedad articular más agresiva, erosiva y manifestaciones
extraarticulares, estudios han
demostrado una relación directa entre el grado de proteinuria
y la velocidad de sedimentación globular (VSG). objetivo:
determinar si existe correlación
entre la disminución de tasa
de filtración glomerular y los
niveles de marcadores séricos
de inflamación (VSG, PCR, FR)
en pacientes con artritis reumatoide. Descripción del caso: se
determinó una muestra de 40
pacientes con diagnóstico de
Artritis Reumatoide, de los cuales se obtuvieron los siguientes
datos de su expediente: Ficha
de identificación, peso, talla,
edad, genero, tiempo de diagnóstico de la AR, medicamentos
que utiliza, estudios de laboratorio como BH, QS, PFH,
VSG, PCR, FR; con lo cual de
determinó la TFG por medio de
CKD-EPI, MDRD (6) y CokcroftGault y se obtuvieron datos
clínicos para calcular DAS 28
y CDAI. Análisis estadístico: se
utilizó estadística inferencial
para correlacionar la variable
TFG con las variables VSG, PCR
y FR por medio del coeficiente
de correlación de Pearson. También se calculó el coeficiente de
determinación. Para calcular la
p se utilizó la distribución t y
se consideró una significancia
estadística de 0,05. Resultados:
Se incluyeron 40 pacientes
femeninos con una media de
edad de 47.9 años, Se determinó la correlación entre la
tasa de filtrado glomerular por
CKD-EPI y la VSG encontrando
un valor de r = -0.45 y un valor
de p = 0.003 (95% del IC de
-0.677 a -0.169). Se determinó
la correlación entre la tasa de
filtrado glomerular por CKD-EPI
y el puntaje de actividad CDAI,
con un valor de r = -0.327 y un
valor de p = 0.039 (95% del
IC de -0.613 a -0.044). Conclusiones: existe correlación
negativa entre la TFG y la VSG
así como la TFG y el puntaje
de actividad CDAI. Comentario: implementar estrategias
diagnóstico terapéuticas que
consideren con mayor énfasis
en la TFG, VSG y CDAI en pacientes con AR.
Trombosis y reestenosis del
stent como causas de cardiopatía isquémica
Ernesto Alexis Barrera Oranday,
Héctor Antonio López Morán,
Víctor Manuel Sánchez Nava,
José Fernando Castilleja Leal,
Luis Alonso Morales Garza, Félix
Amador Barrera Oranday
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Medicina Interna-Cardiología,
Hospital San José Tec de Monterrey, Monterrey, Nuevo León
Medicina Interna-Cardiología,
Centro Médico Zambrano Hellion, Monterrey, Nuevo León
Antecedentes: las principales
complicaciones de los stents
coronarios son la trombosis y
la reestenosis, la incidencia es
de 2% y 10% respectivamente.
La necesidad de revascularización post-stent es frecuente
(17.4%- 34%).No existe estadística en población Mexicana.
El objetivo es determinar en
los pacientes que acuden por
un SICA o Angina Estable con
antecedente de intervención
coronaria percutánea con implantación de stent, siendo la
causa reestenosis o trombosis
del stent, detectar factores
de riesgo, comparar tipos de
stents entre sí y describir el
tratamiento empleado. Material y método: se revisaron
expedientes de pacientes ingresados por SICA o Angina
Estable quienes tuvieran mínimo una colocación de stent
del 2004 al 2012. Se hizo
análisis descriptivo de las características de los pacientes,
comparación entre factores
de riesgo, diagnósticos, características del/los evento/s
previos, arterias intervenidas
y stents utilizados. Se usó chicuadrada, prueba exacta de
Fisher y ANOVA. Resultados:
se incluyeron 65 pacientes,
51 masculinos (78.5%) y 14
femeninos (21.54%), la edad
promedio fue de 62.3 años. 30
pacientes (46%) presentaron
complicaciones del stent: 28%
reestenosis, 18% trombosis, y
54% presentaron una lesión en
un segmento arterial que no
fue tratado con stents previamente. El factor de riesgo con
diferencia estadísticamente
significativa entre los grupos fue insuficiencia cardiaca
para reestenosis (p=0.005). El
diagnóstico más frecuente del
grupo de trombosis del stent fue
infarto agudo al miocardio con
elevación del segmento ST, con
una diferencia estadísticamente significativa en comparación
con los diagnósticos de los
demás grupos (p=0.00007).
El número de stents previos,
muestra una tendencia para
riesgo de trombosis o reestenosis, sin ser significativa (p=0.3).
Los stents con mejor perfil para
prevenir complicaciones son
los cubiertos con everolimus
y zotarolimus. La incidencia
de complicaciones del stent
fue de 46%, no se encontró
relación entre trombosis y no
uso de DAPT. Se reportan tasas
de revascularización de 17.5%
a 2 años y de 19.7% a 3 años,
en nuestra cohorte presenta
una mediana de 9.9 meses del
último evento con colocación
de stents al evento índice por el
que acudieron al hospital. Conclusiones: hay una gran tasa de
reestenosis/trombosis del stent
en los pacientes que acuden a
nuestros hospitales con angina
estable o SICA. Faltan estudios
prospectivos con grupo control
para encontrar otros factores
predisponentes.
Prevalencia de hiperglicemia
en el paciente sin diagnóstico
de diabetes mellitus tipo 2 en
un hospital de segundo nivel de
Nuevo León
Luis F Pérez García, Sandra
Galindo Alvarado, Juan P
Carrizales, Dionicio Galarza
Delgado, Miguel A Villarreal
Alarcón, Luis A Morales Garza,
María T Sánchez, Claudia Lara
Medicina Interna, Hospital
General Virginia Ayala, Secretaría de Salud de Nuevo León,
Sabinas Hidalgo, Nuevo León
La diabetes mellitus es una
enfermedad metabólica cuya
principal característica es la
hiperglucemia, como consecuencia a alteraciones en
la secreción de insulina o de
su acción periférica. El impacto de esta enfermedad
ocurre principalmente en
sus manifestaciones tardías
o complicaciones, que traducen una morbimortalidad
importante a nivel mundial
y en México. El diagnóstico
de diabetes generalmente se
realiza en pacientes ambulatorios, con criterios diagnósticos
estandarizados. Sin embargo,
en pacientes internados la
hiperglucemia puede también
ser adjudicada al estrés metabólico, por lo que los valores
de corte cambian dificultando
un adecuado seguimiento. En
este estudio se pretende determinar, de manera retrospectiva,
S197
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
la prevalencia de hiperglucemia
en pacientes sin antecedentes
de diabetes y estimar la proporción de pacientes en quienes
se consideró el diagnóstico
de diabetes durante o al final
de su internamiento. Material
y métodos: se analizaron 356
expedientes que representan el
total de egresos en el periodo
de mayo-agosto 2014. Al ingreso 240 pacientes (67.4%) no
reportaron antecedente previo
de DM2, 112 (31.5%) tenían
diagnóstico previo de DM2 y
solo en 4 expedientes (1.1%)
no se registró un interrogatorio
de antecedentes patológicos
completo. La media de glucosa
al ingreso del grupo de pacientes no diabéticos fue de 111.59
mg/dL. 60.7% registraron cifras
menores a 140 mg/dL y 41%
cifras mayores a 140 mg/dL. 64
pacientes (26.7%) presentaron
mas de 3 cifras mayores a 140
mg/dL durante su estancia intrahospitalaria, de estos casos,
44 pacientes (18.3%) no tenían
antecedente de diagnóstico
previo de DM2. Comentario:
al analizar las indicaciones de
egreso de este grupo de pacientes sin antecedente previo
de DM2 y con hiperglicemia
intrahospitalaria, del total de
44 pacientes que requerían
seguimiento ambulatorio, solo
a 4 pacientes (10%)se les indico
algún tipo de seguimiento por
primer o segundo nivel. Un
total de 40 pacientes (90%)
se egresaron sin indicaciones
para continuar seguimiento a
nivel ambulatorio. Este estudio
S198
demuestra un área de oportunidad para hacer diagnóstico
temprano de DM2 y evitar así
sus complicaciones crónicas y
todo el impacto socio económico que implica un diagnostico
tardío de esta enfermedad.
Correlación: índice de presión tobillo-brazo con el
Framingham Risk Score en
diabéticos
Aldo Daniel Ibarra Torres, Martín Coronado Malagón, César
Alejandro Arce Salinas
Medicina Interna, Hospital Central Sur de Alta Especialidad,
Petróleos Mexicanos, México,
DF
Introducción: se estima que la
enfermedad arterial periférica
afecta hasta al 20% los pacientes diabéticos. La enfermedad
arterial periférica se considera
un marcador de aterosclerosis
y riesgo cardiovascular. Pacientes con enfermedad arterial
periférica tienen un riesgo alto
de muerte, IAM, EVC y hospitalizaciones con tasas de hasta
el 21% por año. El índice de
presión tobillo-brazo (IPTB)
es una herramienta sencilla,
practica para el escrutinio y
diagnóstico de enfermedad
arterial periférica, puede ser
utilizada con un mínimo costo
y entrenamiento por el personal
de salud. Objetivos: determinar
cuál es la correlación entre
IPTB y el Framingham Risk
Score (FRS) en pacientes con
DM2 de la consulta externa
de Medicina Interna. Materia-
les y métodos: es un estudio
observacional, de correlación,
abierto, transversal. Se incluyeron pacientes con DM2 de
entre 29 y 74 años de edad.
Se realizó la determinación
del IPTB utilizando un doppler
pulsado de 8 Hz, apegado a los
lineamientos establecidos por
la AHA. Se midieron variables
antropométricas y se calculó
el FRS. Se realizó estadística
descriptiva y se determinó la
correlación entre variables por
método de Pearson , así como
un sub análisis de acuerdo
al tiempo de evolución de la
DM2. Resultados: se incluyeron 39 pacientes, 26 pacientes
(66.7%) fueron mujeres, con
una edad promedio de 61(± 8)
años, rango de edad de 39 a 74
años. El tiempo de diagnóstico
en años de la DM2 entre los
participantes fue: 0 a 5 años
14 pacientes (35.89%), 6 a 10
años 9 pacientes (23.07%), 11
a 15 años 9 pacientes (23.07%),
más de 15 años 6 pacientes
(15.38%). La media de puntos
del FRS fue de 16.64 ± 5.7
(rango de 1 a 27 puntos), clasificados en base a la categoría
de riesgo coronario a 10 años:
riesgo bajo de 1 a 12 puntos
6/39 pacientes (15.4%), riesgo
intermedio de 13 a 15 puntos 10/39 pacientes (25.6%),
riesgo alto más de 16 puntos
23/39 pacientes (59.0%). Se
encontró una correlación del
IPTB con el puntaje de FRS de
0.103, por categoría de riesgo
una correlación de 0.143.
Conclusiones: en el presente
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
estudio no se demostró una
correlación significativa entre
el Índice de Presión TobilloBrazo y el Framingham Risk
Score, valores menores a 0.9
y mayores a 1.4 del IPTB se
consideran un factor de riesgo
cardiovascular independiente.
Queda abierta la posibilidad
de realizar un análisis posterior
con la inclusión de un mayor
número de pacientes e incluir
el nuevo modelo para predecir
el riesgo cardiovascular ASCVD
Risk Estimator.
Efecto de administración de
Gymnema sylvestre sobre el
síndrome metabólico, secreción y sensibilidad a la insulina
Esperanza Martínez Abundis,
Laura Yareni Zúñiga, Manuel
González Ortiz
Instituto de Terapéutica Experimental y Clínica, Centro
Universitario de Ciencias de
la Salud, Universidad de Guadalajara
Introducción: existe evidencia
de que Gymnema sylvestre
mejora el metabolismo de glucosa y lípidos, al igual de que
promueve la disminución de
presión arterial y peso corporal;
por lo que pudiera constituir
una opción para el tratamiento
del síndrome metabólico. Objetivo: evaluar el efecto de la
administración de Gymnema
sylvestre sobre el síndrome
metabólico, la secreción y la
sensibilidad a la insulina. Material y método: ensayo clínico,
doble ciego, con asignación al
azar y grupo placebo control,
en 24 voluntarios con síndrome metabólico, dos grupos
de 12. Un recibió 300 mg de
Gymnema sylvestre y el otro
placebo homologado, 2 veces
al día por 12 semanas. Antes
y después de la intervención
se midieron: circunferencia de
cintura, triglicéridos, colesterol
de las lipoproteínas de alta densidad, presión arterial y glucosa
de ayuno, así como índice de
masa corporal, colesterol total,
colesterol de las lipoproteínas
de baja densidad y de muy baja
densidad. Se calculo: índice de
Stumvoll, índice insulinogénico, índice de Matsuda y área
bajo la curva de glucosa e insulina. Estadística: prueba exacta
de Fisher, U de Mann-Whitney
y Wilcoxon. Con significancia una p ≤ 0.05. Resultados:
ambos grupos fueron similares
en sus características clínicas
y de laboratorio al inicio del
estudio. Posterior a la administración de placebo se observó
aumento en: peso (78.8±16.1
vs 80.3±18.2 kg, p=0.013),
í n d i c e d e m a s a c o r p o ra l
(30.3±3.2 vs 30.7±3.8 kg/m2,
p=0.03), circunferencia de cintura (98.3±13.6 vs 100.5±14.7
cm, p=0.008), colesterol de
baja densidad (82.4±23.0 vs
106.7±21.3 mg/dL, p=0.01),
secreción total de insulina
(0.62±0.33 vs 0.95±0.66 mg/
dL, p=0.003), área bajo la curva de insulina (10,719±5,819
vs 15,136±7,556 mg/min,
p=0.03) e índice de Stumvoll
(1,403±682 vs 1,805±1,132,
p=0.05); así como disminución
del índice de Matsuda (3.3±1.9
vs. 2.5±1.4, p=0.01). El grupo de Gymnema sylvestre se
observó una disminución en:
peso corporal (81.3±10.6 vs
77.9±8.4 kg, p=0.021), índice
de masa corporal (31.2±2.6
vs 30.4±2.2 kg/m2, p=0.024) y
colesterol de muy baja densidad (40.4±13.4 vs 30.6±13.3
mg/dL, p=0.056). Conclusión:
Gymnema sylvestre disminuyó
el peso corporal, el índice de
masa corporal y el colesterol
de muy baja densidad. En contraparte con el placebo, evitó la
disminución de la sensibilidad
a la insulina y la hiperinsulinemia.
Prevalencia de los tipos de
mononeuritis múltiple en pacientes con esclerodermia
difusa y limitada
María del Pilar Cruz Domínguez, Jesús Millán Padilla, Jesús
Roberto Gastélum Lara, Luis
Enrique Molina Carrión, Rosa
Angélica Carranza Muleiro,
Daniel H Montes Cortés, Olga
Lidia Vera Lastra
Hospital de Especialidades,
Centro Médico Nacional La
Raza, IMSS, México, DF
Introducción: el compromiso
del sistema nervioso periférico (SNP) resulta de isquemia
focal y multifocal causada por
vasculitis del vaso nervorum
en las ramas de los pequeños
vasos del epineuro. Objetivo: establecer la prevalencia
de Neuropatía periférica en
S199
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
pacientes con esclerodermia
limitada y difusa. Diseño del
estudio: descriptivo, abierto,
observacional, prospectivo,
transversal. Material y método:
en el servicio de Neurología
Clínica de la UMAE HE Dr.
Antonio Fraga Mouret, Centro
Médico Nacional La Raza de
marzo a junio del 2014 se
estudió a 42 pacientes con
esclerodermia (24 cutánea difusa y 18 cutánea limitada) del
servicio de Medicina Interna
de acuerdo a los criterios de la
ACR. Firmaron consentimiento
informado, se le realizan velocidades de neuroconducción de
miembros torácicos y miembros
pélvicos. Resultados: encontramos en 26(62%) pacientes
mononeurítis múltiple (MM), en
12 (28%) mononeuropatía (M) y
4 normal (10%). Las pacientes
con M tuvieron 49años (30-62)
y las de MM 51 años (26-78).
El tiempo de evolución en MM
fue 13±12 años y en M de 10±5
años. La más frecuente fue MM
sensitivo motora con degeneración axonal (27/42;64%). Los
nervios mayormente afectados
fueron el sural (16/42;38%) y el
tibial (13/42; 31%). Que ambos
subtipos de esclerosis cutánea
desarrollan compromiso de los
nervios periféricos. La afección
a tendón entre 2 a 3.9 cm se
asoció a mayor frecuencia de
MM y de 4 a 4.9 a M (p=0.017).
Conclusiones: el compromiso
del SNP afecta a ambos subtipos de esclerosis sistémica,
donde la MM fue la neuropatía
más frecuente, variedad sensi-
S200
tivo motora con daño axonal
es lo que predomina. El nervio
más afectado fue el sural.
Metabolitos séricos asociados
con la severidad de la encefalopatía hepática
Karla Gabriela Peniche Moguel,
Luis Fernando Castañares Morales, Judith Sánchez Hernández,
Verónica Montes Martínez
Medicina Interna, Hospital de
Alta Especialidad de Veracruz,
Secretaría de Salud, Veracruz,
Veracruz
Introducción: la encefalopatía
hepática (EH) es un síndrome
neuropsiquiátrico prevalente
en la insuficiencia hepática
crónica (IHC) existen factores
que aumentan el daño neurológico y la mortalidad. Objetivo:
determinar la asociación entre
los metabolitos séricos y la
severidad de la encefalopatía
hepática en pacientes con insuficiencia hepática crónica.
Material y método: estudio
observacional, descriptivo y
transversal. Se incluyeron pacientes mayores de 18 años que
ingresaron al HAEV de marzo a
junio del 2014, con el diagnóstico de IHC y EH (clasificación
de West Haven). Variables:
edad, género y metabolitos séricos (albumina, amonio, BT, FA,
Ca++, Ca++ corregido, TP, INR,
K+ y Na+). Estos últimos fueron
dicotomizados y categorizados
en cuartiles. Los datos se analizaron mediante estadística
descriptiva. Se utilizaron ANOVA de un factor, Kruskall-Wallis
y c2 para probar significación
estadística. Para evaluar asociación se utilizó V Cramer y para
correlación Rho de Spearman.
La significación estadística se
determinó con una p< 0.05.
Resultados: Se incluyeron 41
pacientes, 15 (36.6%) presentaron HE I, 12 (29.3%) HE II,
10 (24.4%) HE III y 4 (9.8%)
HE IV. 14 pacientes fallecieron
y 27 egresaron por mejoría.
No se observó diferencia en la
edad promedio entre los grupos de HE (ANOVA, p=0.389)
o la distribución de sexos (x2;
p= 0.497). Hubo diferencias
significativas en los niveles
de calcio corregido (ANOVA,
p= 0.024) e INR (ANOVA, p=
0.031) entre los grupos de EH.
No se encontró significación
al evaluar la asociación entre
el grado de EH y los metabolitos séricos categorizados a
los puntos de corte utilizados (c2, p>0.05). Se encontró
correlación positiva entre el
grado de EH y los niveles de BT
(Rho: 0.357, p=0.024), TP (Rho:
0.343, p=0.047) e INR (Rho:
0.507, p=0.002). Al evaluar
mortalidad de acuerdo al grado
de EH se encontró significación
(c2, p=0.010), con un grado de
asociación moderado (V de
cramer: 0.528). Conclusiones:
Existe una correlación positiva
moderada entre la severidad de
la EH y los niveles séricos de BT,
TP e INR. No así para el resto
de los metabolitos estudiados.
Estimación del riesgo de padecer enfermedad coronaria
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
en una cohorte de pacientes
diabéticos mexicanos a 2 años
Carlos Fernando Cabrera Leal,
Martín Coronado Malagón,
César Alejandro Arce Salinas
Servicio de Medicina Interna,
Hospital Central Sur de Alta
Especialidad, México, DF
Introducción: la enfermedad
coronaria es la principal causa
de mortalidad, así como una
de las enfermedades crónicas
más comunes a nivel mundial.
La diabetes mellitus ha sido
considerada como un equivalente de infarto agudo de
miocardio en mortalidad general, pero nunca se ha evaluado
su equivalencia en morbilidad
cardiovascular. El objetivo del
presente estudio es establecer
si existe la misma equivalencia
que para presentar un evento
cardiovascular en comparación
con pacientes con antecedente
de enfermedad cardiovascular
conocida. Material y métodos:
se trata de un estudio de cohorte, prospectivo, realizado
entre enero 2011 y julio 2014.
Se incluyeron pacientes con
diagnóstico de diabetes mellitus
tipo 2 obtenidos de la consulta
externa del Hospital Central
Sur de Alta Especialidad y que
no tuvieran historia de evento
cardiovascular. A todos los
pacientes se les realizó cálculo
del riesgo de presentar enfermedad coronaria a dos años
según el score de riesgo de
Framingham al incorporarse al
estudio. Se les dio seguimiento
por dos años a cada paciente
y se observó la incidencia de
desenlaces cardiovasculares. El
desenlace primario fue conocer
la incidencia de enfermedad
cardiovascular estratificados
por factores de riesgo cardiovascular según el score de
riesgo de Framingham a dos
años. Resultados: se obtuvieron
401 pacientes. Del desenlace primario, nueve pacientes
(9/319, 2.82%) presentaron el
desenlace primario. La media
de puntaje en el grupo de
hombres fue de 22.43 con una
incidencia de 2.27% (3/132) vs
6% de la cohorte histórica de
Framingham. Para el grupo de
mujeres del de 3.2% (6/187) vs
1% de la cohorte histórica de
Framingham. De los factores de
riesgo cardiovascular, independientes de la diabetes mellitus,
la tensión arterial sistémica
fue el único factor aislado que
mostró una asociación con la
aparición del desenlace primario. El estado de control, con
base en la HbA1c no contó
con diferencia estadísticamente significativa para presentar
o no el desenlace primario.
Conclusiones: en este estudio
encontramos que en nuestra
cohorte de pacientes diabéticos
mexicanos del HCSAE, el puntaje del score de Framingham
de desenlace cardiovascular
a dos años no predijo con
exactitud los desenlaces cardiovasculares, teniendo una menor
incidencia de la esperada en el
grupo de hombres y una mayor
incidencia de la esperada en el
grupo de mujeres.
Mitoxantrona como substituto
de adriamicina en el tratamiento de la leucemia linfoblástica
aguda
Perla Rocío Colunga Pedraza,1
José Carlos Jaime Pérez,2 César
Homero Gutiérrez Aguirre,2 David Gómez Almaguer,2 Dionicio
Galarza Delgado1
1
Departamento de Medicina
Interna
2
Servicio de Hematología
Hospital Universitario Dr. José
Eleuterio González, Monterrey,
Nuevo León
Introducción: la leucemia linfoblástica aguda (LLA) es una
proliferación de precursores
linfoides en médula ósea. No
existe un régimen de tratamiento considerado superior.
Esquemas actuales consiguen
remisión completa (RC) en
60-90% y 20-40% de cura.
Múltiples fármacos se han
empleado para incrementar la
respuesta. El uso de antraciclinas como mitroxantrona y
adriamicina es fundamental en
el tratamiento de inducción a la
remisión (IR), sin embargo, no
se ha demostrado superioridad
de alguna. Objetivo: determinar
la efectividad de mitoxantrona
como substituto de adriamicina para conseguir RC en un
esquema de tratamiento para
LLA. Evaluar toxicidad, recaída e internamiento. Material
y métodos: se realizó estudio
ambispectivo en pacientes con
LLA incluyendo un grupo histórico tratado con dexametasona,
vincristina y adriamicina y un
S201
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
grupo prospectivo empleando
mitoxantrona como substituto
de adriamicina. Se evaluó RC,
sobrevida, recaídas, toxicidades e internamientos. Análisis
estadístico: se obtuvieron medias con desviación estándar y
medianas con rangos. Se compararon proporciones mediante
exacta de Fisher. Para variables
cuantitativas, se utilizó t de
Student o U de Mann-Whitney
y el método de Kaplan-Meier
para evaluar supervivencia.
Resultados: se incluyeron 85
pacientes. 53 casos correspondieron a la cohorte histórica
y 32 al grupo prospectivo. La
mediana de seguimiento fue
20 meses (2-80) y la de edad
de 37 años (16-78). La tasa de
RC fue superior en el grupo de
mitoxantrona consiguiéndose
en 90.6% (n=29) comparado
con 69.8% (n=37) en el grupo
de adriamicina (P=0.032). No
existieron diferencias significativas en el número de muertes
o recaídas (P=0.0.095, 0.075)
El tiempo de recuperación
hematológica no fue significativamente distinto (P=0.0654).
La incidencia de eventos adversos fue similar en ambos
grupos (46.8% en el grupo de
mitoxantrona vs 26.6% con
adriamicina, P=0.6). Los días
de internamiento hospitalario
no fueron distintos (P=0.365).
Conclusiones: el empleo de
quimioterapia combinada a
nivel mundial, ha logrado mejorar la RC. Enfrentamos el reto
de mejorar la supervivencia a
largo plazo. Aunque la RC fue
S202
mayor en los pacientes tratados con mitoxantrona, no se
observó aumento en la supervivencia a largo término. El uso
de mitoxantrona, parece ser una
alternativa adecuada cuando
se emplea como substituto de
adriamicina en el tratamiento
de IR de la LLA.
Factores pronóstico de morbilidad y mortalidad en pacientes
geriátricos con terapia de reemplazo renal
Ricardo Emilio Varela Jiménez,¹
Eduardo Carrillo Maravilla,¹
Olynka Vega Vega²
1
Departamento de Medicina
Interna
2
Departamento de Nefrología
Instituto Nacional de Ciencias
Médicas y Nutrición Salvador
Zubirán, México, DF
Introducción: el incremento en
la sobrevida de la población
ha implicado un aumento en
la prevalencia de ERC. Debido
a la prevalencia de comorbilidades en pacientes geriátricos,
surgen interrogantes respecto
a qué factores pronostican deterioro en la calidad de vida y
mortalidad. Material y método:
estudio retrolectivo que analizó
variables clínicas de pacientes
> 60 años que iniciaron TRR
entre 2000 y 2012. Se establecieron 3 grupos: 1 (60-64
años), 2 (65-69 años) y 3 (>70
años), obteniendo información
respecto a internamientos posterior al inicio de la TRR. Se
utilizó estadística descriptiva
y t de Student y c2 para mos-
trar diferencias entre ellas. Se
utilizó análisis multivariado de
Cox y curvas de Kaplan Meier
para estimar la sobre vida considerando significativa una p
<0.05. Resultados: de los 535
pacientes > 60 años con requerimientos dialíticos, el 39%
inició TRR. La edad promedio
al inicio de la diálisis fue de
70 años. La principal causa de
IRCT fue DM2 y las principales
comorbilidades fueron hipertensión arterial y dislipidemia.
El 54% presentó un índice de
Charlson > 5. De los pacientes
referidos de forma temprana,
el 34% requirió iniciar TRR de
forma urgente, en comparación
con el 74% de los que no fueron
referidos oportunamente. La
mediana de seguimiento fue de
20 meses. El 51 y 49% tuvieron
como modalidad inicial DP
y HD respectivamente. No se
demostró aumento en la mortalidad u hospitalización entre
las modalidades. 62 pacientes
presentaron por lo menos 1
episodio de peritonitis y 123
requirieron hospitalización. La
mediana de sobrevida fue de 15
meses y la sobrevida a 5 años
fue del 29, 16 y 8% para el grupo 1, 2 y 3 respectivamente. Las
principales causas de muerte
fueron infecciosa y cardiovascular. En el análisis univariado
las variables asociadas a mortalidad fueron: diagnóstico de
DM2, IMC, índice de Charlson
> 5 y albúmina < 3 mg/dl. Estas
variables permanecieron como
predictores de mortalidad en el
análisis multivariado. Conclu-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
siones: la principal causa de
IRCT en pacientes > 60 años
es la DM2. Más del 95% de
los pacientes geriátricos que
inician TRR tienen 2 comorbilidades o más y aquellos que
son referidos de forma tardía
tienen mayor probabilidad de
iniciar TRR por requerimientos
de urgencia. No existe diferencia respecto a la modalidad
empleada y el riesgo de muerte
u hospitalización, pero sí por
el diagnóstico de DM2, IMC,
índice de Charlson > 5 y nivel
de albúmina < 3.
Aplicación del índice de Barthel
en adultos mayores hospitalizados en Medicina Interna
Rosalía García Peña, Jazmín
Ariadna Salas García
Servicio de Medicina Interna,
Hospital General Regional
núm. 220, IMSS, Toluca, Estado
de México
Introducción: el índice de Barthel es un instrumento utilizado
para evaluar la discapacidad
física del anciano y mide su
capacidad para la realización
de 10 actividades básicas de
la vida diaria. Consta de 10 parámetros: alimentación, baño,
vestido, aseo personal, deposiciones, micción, uso de retrete,
traslado en silla de ruedas a la
cama, deambulación y escalones. La puntuación máxima
de independencia es 100 y la
de máxima dependencia es 0.
Objetivo: conocer el grado de
dependencia de los adultos mayores que ingresan al Servicio
de Medicina Interna del HGR
220. Metodología: estudio
transversal y observacional, se
incluyeron pacientes adultos
mayores de 65 años , en el servicio de Medicina Interna, que
ingresaron en el periodo del
mayo a julio de 2011 , El trabajo fue aprobado por el Comité
de Investigación Local del Hospital y previo consentimiento
informado por el paciente o el
cuidados primario se aplicó la
cédula de recolección de datos
generales y el índice de Barthel.
Se realizó el análisis de datos
y se utilizó estadística descriptiva. Resultados: se incluyeron
un total de 150 pacientes:82
mujeres (55%) y 68 hombres
(45%), con un promedio de
edad de 72 años y un rango
de edad de 65 a 99 años. El
grado de dependencia de los
pacientes de acuerdo al índice
de Barther fue: dependencia
total (<20 puntos): 36 pacientes (24%), dependencia grave
(20-35 puntos); 18 pacientes
(12%), dependencia moderada
(40-55-puntos): 37 pacientes
(24.6%), dependencia leve
(>60 puntos): 49 pacientes
(32%), Paciente independiente: (100 puntos): 10 pacientes
(6.6%). Conclusiones: en este
estudio la dependencia total
y grave fue en 54 pacientes
(36%), 57% de los pacientes
tienen dependencia moderada
a leve. Se debe considerar la
aplicación de ésta escala en
todo paciente geriátrico que
ayudará a planear más integralmente el tratamiento.
Fibrinógeno como indicador
de enfermedad arterial coronaria obstructiva significativa
en SICA
G Domínguez Trejo, A Salas
Delgado, FJ Valadez Molina
Departamento de Medicina Interna, Hospital Regional ISSSTE
Monterrey, Monterrey, Nuevo
León
Introducción y objetivo: la
enfermedad coronaria es la
causa más frecuente de muerte
en todo el mundo. Más de 7
millones de personas mueren
cada año a consecuencia de
la cardiopatía isquémica. Distintos biomarcadores han sido
evaluados como potenciales
herramientas para mejorar
la predicción y el pronóstico
del riesgo cardiovascular. Se
ha descrito que el fibrinógeno favorece el desarrollo de
aterosclerosis. El objetivo de
este estudio es determinar la
asociación del fibrinógeno
como indicador de enfermedad
coronaria obstructiva significativa. Material y método: se
realizó un estudio observacional, transversal y comparativo,
previa aprobación del comité
de Ética del hospital de 109
expedientes de pacientes consecutivos admitidos al servicio
de Hemodinamia y Terapia
Endovascular en el periodo del
01 de enero de 2013 al 31 de
diciembre de 2013 con diagnostico de SICA (incluyendo
angina inestable, IAM sin elevación del segmento ST e IAM con
elevación del segmento ST). Se
S203
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
analizó el nivel de fibrinógeno
al ingreso hospitalario teniendo
como límite superior 515 mg/
dL. Se realizaron dos grupos,
en el primero se incluyeron
los pacientes con enfermedad
arterial coronaria significativa
de acuerdo a los hallazgos en la
coronariografía y en el segundo
los pacientes con enfermedad
no significativa. Posteriormente
se correlacionaron los niveles
del fibrinógeno por diagnóstico
individual para establecer la
asociación. Resultados: los valores promedio de fibrinógeno
con enfermedad significativa
fueron (563.03 mg/dL) y no
significativa (530.11 mg/dL)
sin diferencia estadísticamente
significativa p=0.402 con IC
del 95% inferior de -44.63 y
superior de 110.46. Se analizaron los niveles séricos del
fibrinógeno individualizando
los diagnósticos, se expresan
con la media y su desviación
estándar, se utilizó la prueba
de U de Mann-Whitney, se
analizaron en el grupo con
lesión significativa y sin lesión
significativa, se encontró en
IAM CESST (565.97 (245.41))
y (447.10 (78.78)) con una p=
0.452, en IAM SESST (595.86
(214.62)) y (673.06 (53.46))
con una p= 0.194 y en angina
inestable (551.56 (154.81))
y (529.49 (144.40)) con una
p=0.526. Conclusiones: los valores de fibrinógeno no tienen
asociación con la presencia de
enfermedad arterial coronaria
significativa, en pacientes con
diagnóstico de SICA, indepen-
S204
dientemente de si se presentan
con IAM CESST, IAM SESST o
angina inestable.
Prevalencia de pre-diabetes en
población adulta asintomática
que acude a la consulta externa general del Hospital Civil
Fray Antonio Alcalde durante
el periodo comprendido entre
2006-2012
Claudia Elizabeth Gómez López, María de la Luz Alcántar
Vallín, Isabel Montserrat Alvarado Padilla, Ramón Medina
González, Sol Ramírez Ochoa
Servicio Medicina Interna, Hospital Civil Fray Antonio Alcalde,
Guadalajara, Jalisco
Introducción: la DM en las
últimas décadas ha ido incrementando su prevalencia y
por lo tanto, la presencia de
complicaciones micro y macrovasculares asociadas a falta de
diagnóstico y tratamiento oportunos, representando una de las
primeras causas de morbilidad
y mortalidad, absorbiendo
un porcentaje significativo de
los recursos invertidos en el
sector salud. La prediabetes,
considerada estado previo es
una alteración reversible, el
tamizaje en población general
permite realizar intervenciones
en el estilo de vida que eviten
la progresión a DM. Objetivo: determinar el número de
pacientes asintomáticos con
glucosa alterada en ayuno
valorados en consulta externa.
Material y métodos: estudio
observacional descriptivo re-
trospectivo incluyéndose 174
pacientes entre los 18 y 50 años
que acudieron a consulta de
cirugía general 119 (68.39%),
ORL 45 (25.8), cirugía plástica
4 (2.29), Obstetricia y Ginecología 3 (1.72) y otros con 3
pacientes, los pacientes no se
conocían con DM, ni prediabetes y contaban con valoración
anestésica dentro del protocolo
de cirugía electiva. Resultados:
163pacientes(93.1%)previamente sanos, 12 pacientes
(6.8%) con comorbilidades:
HAS en 6 pacientes, ERC e
HAS en un paciente, asma en
un paciente, hepatopatía probable alcohólica en 2 pacientes,
VIH en 2 pacientes y obesidad
mórbida en 1 paciente, 5 pacientes estaban embarazadas
y una acudió dentro del puerperio fisiológico. De los 174
pacientes, 51 tuvieron cifras
de glucosa alterada en ayuno,
cumpliendo diagnóstico de
prediabetes ADA. 51 pacientes
que presentaron glucosa alterada en ayuno,7 tenían glucosa
mayor o igual a 126,cifra que
es sugestiva de DM, ninguno
tuvo seguimiento con una segunda toma que confirmara
el diagnóstico. Pacientes con
prediabetes presentaban una
edad media de 38.8 años en
comparación con una media
de 32.7 años en pacientes con
cifras de glucosa normal, lo
que si demostró una diferencia
estadísticamente significativa
con una p=0.002). Discusión:
en nuestro estudio pudimos
observar que el 29.3%de la
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
población presentó cifras de
glucosa alteradas, con el 15.6%
cumpliendo criterios para prediabetes y el 13.7%presentaron
hiperglucemia >126mg/dL
compatible con DM, similar
a la prevalencia reportada en
un estudio realizado en hispanos que radican en México
donde se reportó el 13.8%de
pacientes con prediabetes y el
16.6%con DM. Conclusión: la
DM representa uno de los principales problemas de salud para
nuestro país evitar esta historia
natural ofrece un beneficio económico y sobre todo en calidad
de vida a los pacientes.
Manifestaciones neurocognitivas asociadas con infección por
VIH en pacientes tratados en
el Hospital de Especialidades
Dr. Bernardo Sepúlveda del
CMN SXXI
GD Deras, 1 SL Pérez, 2 MB
Chong3
1
Residente de cuarto año de
Medicina Interna
2
Médico adscrito al Servicio de
Infectología
3
Médico adscrito al Servicio de
Medicina Interna
Centro Médico Nacional Siglo
XXI, IMSS, México, DF
Hospital de Especialidades Dr.
Bernardo Sepúlveda, Centró
Médico Nacional Siglo XXI,
IMSS, México, DF
Resumen: el uso de la terapia
antirretroviral en pacientes
con VIH ha conducido a una
disminución en la incidencia
de complicaciones asociadas.
Los trastornos neurocognitivos
asociados a VIH (HAND) se
sitúan entre las principales
afecciones clínicas. El complejo
demencia Sida es la forma más
severa de afectación neurológica y se caracterizó por su
rápida progresión y severidad
en los primeros momentos de
la epidemia, incluye el HAD
(deterioro cognitivo severo) con
una disfunción significativa en
las actividades de la vida diaria;
el MND (deterioro cognitivo
leve) que interfiere de alguna
manera con las actividades más
difíciles de la vida diaria; el ANI
(deterioro cognitivo subclínico)
con afección en al menos dos
dominios neurocognitivos sin
afectar las actividades de la vida
diaria. En México no existe evidencia acerca de la prevalencia
ni de los cambios asociados con
el inicio de la terapia antirretroviral. Material y métodos:
se trata de un estudio Transversal, descriptivo, observacional,
prolectivo, que incluye a la
población mayor a 16 años con
infección por VIH atendida en
el Hospital Dr. Bernardo Sepúlveda del CMN SXXI. Se tomó
una muestra por conveniencia
realizando análisis de todos los
pacientes que cumplieron con
los criterios de inclusión. El análisis de datos se realizó usando
c2 para determinar la asociación
que existe entre las variables
medidas y la presencia de deterioro cognitivo, se determinó
la frecuencia de cada alteración
en grupos específicos. Resultados: se obtuvo una muestra
de 60 pacientes con una media de edad de 39 ± 14 años,
escolaridad 12 (9-16), tiempo
de tratamiento 5 (2-6) años,
tiempo de evolución 2 (0-3.75)
años, encontrando asociación
estadísticamente significativa
entre velocidad motora y años
de tratamiento ARV p:0.049,
tratamiento ARV a SNC actual
p: 0.002 y antecedente de
tratamiento previo hacia SNC
p: 0.046, respecto a la atención sostenida hubo asociación
con los años de diagnóstico
p:0.073, años de tratamiento
ARV p:0.017 y tratamiento
actual a SNC p:0.017 y la alteración de memoria reciente con
los años de diagnóstico p:0,021,
la escolaridad no influyó en la
presencia de alteraciones. Es necesario ampliar la muestra para
homogeneizar la población y
establecer una asociación real
entre el deterioro cognitivo y las
variables evaluadas.
Uso de la escala de ansiedad
Beck como predictor del uso de
ansiólisis previa a la colocación
de CVC y su impacto en la tasa
de eventos adversos
Mónica Sánchez Cárdenas, Juan
O Galindo Galindo, Dania Lizet
Quintanilla Flores, Alexandro
Atilano Atilano Díaz, María
Teresa Ramírez Elizondo, Laura
Baena Trejo, Dionicio Ángel
Galarza Delgado, Miguel Ángel
Villarreal Alarcón
Departamento de Medicina
Interna, Hospital Universitario
Dr. José Eleuterio González,
UANL, Monterrey, Nuevo León
S205
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Introducción: dentro de las
complicaciones asociadas a
la colocación de un catéter
central, debemos considerar la
posibilidad de punciones arteriales inadvertidas, neumotórax
y hematomas. Entre otros, uno
de los factores que contribuyen al desarrollo de adversos
durante la colocación, es el
estado del paciente receptor
de la línea central. Estados de
movilidad extrema, ansiedad
y poca cooperación, podrían
vincularse al aumento en la tasa
de falla durante la colocación.
Durante este trabajo, pretendemos correlacionar el grado de
ansiedad (mediante la aplicación de la escala de Beck) con
la medicación recibida y la tasa
de eventos adversos en relación
a los registrados previo a la aplicación de esta escala. Métodos:
se trata de un estudio retrospectivo, de encuesta. Fue analizada
la información recabada a partir
de la aplicación de la escala de
Beck en los pacientes que fueron sometidos a la colocación
de un CVC. En caso de puntuación menor a los 30 puntos, se
consideró estado de ansiedad
leve a moderada, con aplicación únicamente de anestésicos
locales y con puntaje mayor a
30 puntos, se consideró estado
de ansiedad severa, con necesidad de aplicación de ansiólisis.
Fue registrada la tasa de eventos
adversos mayores por cada 100
CVC colocados (punción arterial, hematomas, neuomotórax,
hemotórax), contrastando la
información obtenida previo
S206
(enero-octubre 2013) y posterior a la aplicación de la escala
de Beck (abril-agosto 2014).
Resultados: fue analizada la
información de 229 catéteres
correspondientes al año 2013
vs 181 catéteres colocados
bajo la aplicación de la escala
de Beck. La media de puntaje
obtenido fue de 3.47 puntos (049). El 98.9% de los pacientes
presentó menos de 30 puntos
en la evaluación (ansiedad
leve-moderada). El 49.7% de
los pacientes, registró un puntaje de cero. Durante el 2013,
se registró la presencia de 3
hematomas y 1 punción arterial
inadvertida (tasa 1.74 por 100
CVC colocados). Posterior a la
valoración de ansiólisis, se registró la presencia de 4 punciones
arteriales y 3 hematomas (tasa
4.4 por 100 CVC colocados) p=
0.022. Conclusiones: según los
hallazgos de nuestro estudio, la
aplicación de la escala de Beck,
no conlleva una reducción significativa en la tasa de eventos
adversos (p=0.022). La mayor
parte de los pacientes evaluados, se encuentran tranquilos
al momento de la colocación
del acceso vascular. Resulta
necesario el ampliar el número
de pacientes evaluados en afán
de detectar diferencias menores
entre los grupos.
Descenso de la hemoglobina
asociado con hemodiálisis
Paola Santana Hernández, Arnoldo Salas Delgado, Gabriela
Domínguez Ramírez, Mónica
Bustillos Muñoz
Servicio de Medicina interna,
Hospital Regional Monterrey,
ISSSTE, Monterrey, Nuevo León
Introducción: la anemia es
una de las complicaciones
más frecuentes en el paciente
con falla renal crónica, debida
principalmente al déficit de
eritropoyetina, por lo que su
tratamiento cambia de forma
radical al iniciarse el manejo
con EPO exógena, sin embargo,
se observó posteriormente una
variabilidad en la hemoglobina
(cambios > 1.5 g/dL en un periodo > 8 semanas), fenómeno
presentado hasta en un 90%
de los pacientes y asociado un
aumento en la morbimortalidad. Dicha variabilidad se verá
influenciada por la pérdida
proteica, inflamación crónica,
hepcidina, tratamiento con
EPO y suplementos de hierro
y finalmente a la hemodiálisis,
en donde se presenta aumento
de hasta 3 g/dL por la hemoconcentración secundaria a
la ultrafiltración, sin embargo,
durante el procedimiento se
pueden presentar pérdidas hemáticas, por sangrado del área
de punción o por la producción
de coágulos en las líneas o dializador, por lo que el objetivo
de este estudio es determinar si
existe un descenso de las cifras
de hemoglobina secundario
a la sesión de hemodiálisis.
Material y métodos: se realizó
estudio observacional comparativo (antes-después), prolectivo,
con una muestra no probabilística a conveniencia de acuerdo
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
al total de pacientes con falla
renal crónica en hemodiálisis
a quienes no se les realiza ultrafiltración (n=9) del Hospital
Regional Monterrey ISSSTE. El
56% fueron masculinos, mediana de edad de 65 años y DS
de 14.5. Previa autorización del
comité de ética y consentimiento informado se tomó biometría
hemática, por punción, al inicio
de la sesión de hemodiálisis y
al término de la misma. Se utilizaron medidas de tendencia
central y de dispersión, el análisis de las variables categóricas
se realizó con la prueba de c2
y para las cuantitativas con
Wilcoxon con intervalos de
confianza al 95% y con una
significancia de 0.05. Resultados: se obtuvo una media de
hemoglobina prehemodiálisis
de 9.3 g/dL y posthemodiálisis
de 8.7 g/dL, DS 1.8 y 1.3 respectivamente, con p = 0.086,
la media de hematocrito de
27.9%, DS 5.5 contra 26.1% y
DS 4.3 posthemodiálisis, con p
= 0.097. Conclusiones: a pesar
de que se observa un descenso
aparente en la hemoglobina
posterior a la hemodiálisis una
vez realizada la comparación
no se encuentran diferencias
estadísticamente significativas,
por lo que no se pude establecer que existe una relación
entre la sesión de hemodiálisis
y el descenso agudo de la hemoglobina.
Seguridad y tolerabilidad de liraglutida 3.0 mg en adultos con
sobrepeso y obesidad: estudio
aleatorizado SCALE Obesidad
y Prediabetes
Rosario Arechavaleta, Carel W
le Roux, David CW Lau, Arne
Astrup, Ken Fujioka, Frank
Greenway, Alfredo Halpern,
Michel Krempf, Rafael Violante
Ortiz, John Wilding, Claus Bo
Svendsen, Ricardo Arturo Reynoso Mendoza
Área de Investigación, Unidad
de Patología Clínica, Guadalajara, Jalisco, México
University College Dublin, Dublin, Irlanda
University of Calgary, AB, Canadá
University of Copenhagen, Copenhagen, Dinamarca
Scripps Clinic, La Jolla, CA,
Estados Unidos
Objetivo: investigar la eficacia
de liraglutida 3.0 mg, en adición a dieta y ejercicio, para el
manejo del peso. Se presentan
los datos clave de seguridad y
tolerabilidad. Metodología: los
participantes (IMC ≥ 27 kg/m2
con ≥ 1 comorbilidad o ≥ 30 kg/
m2) recibieron un programa de
dieta (déficit de 500 kcal/día) y
ejercicio, y fueron aleatorizados
2:1 a recibir liraglutida 3.0 mg
SC una vez al día (n=2487) o
placebo (n=1244). Los eventos
adversos (EA) (muerte, alteraciones CV, pancreatitis, neoplasias,
enfermedad tiroidea) fueron
evaluados de manera cegada
e independiente. Resultados:
características basales: edad
45.1 años, 78.5% mujeres, peso
106.2 kg, IMC 38.3 kg/m2. Liraglutida indujo mayor pérdida de
peso (8.0%) vs placebo (2.6%)
a las 56 semanas (diferencia
estimada de tratamientos [ETD]
-5.4%; p<0.0001). Los EA más
comunes con liraglutida fueron
náusea y diarrea leve/moderada,
fueron transitorias e iniciaron
en las semanas 1-4. Se retiraron
del estudio por EA 9.9% de
los individuos con liraglutida,
principalmente debido a EA
gastrointestinales vs 3.8% con
placebo. Reportaron EA serios
6.3 vs 5.0% respectivamente.
Ocurrieron 3 muertes: liraglutida (n=1) vs placebo (n=2). La
colelitiasis y colecistitis fueron
más comunes con liraglutida
vs placebo (2.5% vs 1.0%).
La frecuencia de pancreatitis
fue más alta con liraglutida
(0.3%) vs placebo (0.1%). Un
sujeto por grupo coreportó
EA biliares y pancreatitis, se
observó un incremento en la
actividad de lipasa sérica media con liraglutida, pero pocos
individuos (2.5% vs 1.1% con
placebo) tuvieron niveles ≥ 3
veces el LSN, no predictivas de
pancreatitis. Liraglutida redujo
la TAS y la TAD vs placebo en
la semana 56 (ETD -2.8 y -0.9
mmHg, p<0.001), e incrementó
la frecuencia cardiaca media
(ETD 2.4 lpm, p<0.0001). Los
eventos CV fueron similares
entre grupos (8.7% vs 9.9%).
No hubo casos de carcinoma
medular de tiroides o hiperplasia de células C, ni incremento
de la calcitonina. Las reacciones en sitio de inyección fueron
22.4 y 14.9 eventos/100 años
paciente de exposición (PYE)
S207
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
con liraglutida y placebo, respectivamente, y las reacciones
alérgicas 2.6 y 3.2 eventos/100
PYE. Conclusión: el perfil de
seguridad de liraglutida 3.0 mg
fue en general consistente con
los efectos conocidos de un AR
GLP-1. El significado clínico del
desbalance en eventos biliares
y pancreatitis no se conoce
actualmente.
Asociación entre el índice de
Karnofsky y linfocitos en el
paciente con cáncer del tracto
digestivo
Elizabeth Pérez Cruz, Christian
P Camacho Limas
Hospital Juárez de México,
México, DF
Centro Médico ABC, México,
DF
Introducción: el índice de
Karnosfky (IK) es una escala
funcional utilizada para predecir la evolución en el paciente
oncológico. Un adecuado estado nutricional es indispensable
para mantener el sistema inmune y un marcador bioquímico
es la medición de los linfocitos.
Los linfocitos pueden ser un
marcador de predicción nutricional y de la evolución del
paciente oncológico. Objetivo:
determinar la asociación entre
el IK y los niveles de linfocitos
en pacientes con cáncer del
tracto digestivo. Material y
métodos: estudio observacional
realizado durante 2011-2012
en pacientes con cáncer del
tracto digestivo que ingresaron al servicio de oncología
S208
durante un año. Resultados:
se estudiaron 57 pacientes, 31
(54%) del sexo masculino y 26
(46%) del femenino. La edad
promedio fue de 58 + 14 años.
El cáncer de mayor prevalencia
fue de colon, seguido por el
de cavidad oral y estómago. El
96% de los pacientes refirieron
perdieron peso, de los cuales el
56% refirió una pérdida de peso
mayor al 10%. Por Evaluación
Global Subjetiva (EGS) el 82%
fueron clasificados con algún
grado de desnutrición. La media
del IK se estableció en 76 con
un rango entre 40 mínima y
100 máxima. Al subdividir la
población estudiada, 14 pacientes (24%) se encontraban
realizando sus actividades de
manera normal, 20 pacientes
(35%) con alguna limitación en
la actividad, 20 pacientes (35%)
con actividad limitada, y solo 3
pacientes (6%) con incapacidad
de auto cuidado. En cuanto
a los niveles de linfocitos, el
promedio fue de 1269 células +
790. El 35% presentaron niveles
normales de linfocitos (>1500/
mm3), el 14% desnutrición leve
(1200-1500/mm3), el 21% desnutrición moderada (800-1200/
mm3) y el 30% desnutrición
severa (<800/mm3). Se observó
una relación significativa entre
los valores del IK y los niveles
de linfocitos con una significancia estadística (r=0.381,
p<0.03). Conclusión: la medición de los niveles séricos de
linfocitos es de utilidad para
evaluar el estado nutricional de
manera sencilla y de bajo costo,
asociado al estado funcional y
por lo tanto evolución de los
pacientes oncológicos.
Conocimiento del riesgo cardiovascular en una población
del noreste de México
José Luis Ramos Martínez,1 Iván
Roel Bautista Cavazos,2 Mario
Alberto Benavides González,1
René Alexander Esparza Rodríguez,1 Raúl Reyes Araiza1
1
Hospital Universitario, UANL,
Monterrey, Nuevo León
2
Hospital Regional Monterrey,
ISSSTE, Monterrey, Nuevo León
Introducción: la enfermedad
cardiovascular es la principal
causa de muerte en México,
representa una gran parte de
los gastos en salud pública. Algunos estudios han demostrado
que las medidas de prevención
orientadas apropiadamente
pueden disminuir la progresión
de la aterosclerosis, diabetes
mellitus (DM), e hipertensión arterial sistémica (HAS), y reducir
la cantidad de eventos clínicos
cardiovasculares; a pesar de
los resultados, la aplicación
de estos programas no ha sido
óptima. Objetivo: comparar el
conocimiento sobre factores
de riesgo cardiovascular(FRCV)
entre personas aparentemente
sanas y quienes tienen algún
factor. Material y método: estudio descriptivo, de campo,
comparativo, transversal. Se
aplicó una encuesta de 39 preguntas correspondientes a la
versión castellana modificada
del formulario Heart Disease
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
Fact Questionnaire (HDFQ), en
una población constituida por
98 personas entre 17-77 años
de ambos sexos, en una clínica
de cardiología, en Mty, Mx.,
que cumplían los criterios de
inclusión y exclusión, firmando
consentimiento informado. Se
calculó tamaño de la muestra
en 96 personas, nivel de confianza de 95% y margen de
error ± 10. Se dividió a la población en dos grupos de personas,
de acuerdo a si se conocen
con algún factor de riesgo o se
reportan sanos. Previamente se
realizó el cálculo de legibilidad
del cuestionario, obteniendo en
el Índice Flesch-Szigriszt (IFS)
de 66.96 y la escala INFLESZ lo
estimo en “bastante fácil”, correspondiente a nivel primaria.
Se usó el programa estadístico
SPSS para Windows (versión
18). Resultados: el 60% fueron
sexo femenino y el 40% masculino, con una media de 38
años. El 34% conocía las cifras
de HAS y el 16% era fumador
activo. 19% con diagnóstico
de HAS, 19% con DM. El 49%
se declaró sedentario. El mayor conocimiento de las cifras
de HAS se dio en pacientes
con FRCV. Usando la prueba
Chi-cuadrada se encontró una
diferencia significativa entre
ambos grupos, en el conocimiento de los valores de su
presión arterial (p=.03). No
hubo diferencia significativa
en la mayoría de los rubros
estudiados. Conclusiones: los
pacientes con enfermedades
crónicas tienen un mayor nivel
de conocimientos que las personas aparentemente sanas, aun
así no siempre siguen estos conocimientos. Aún queda lugar
para la prevención primaria en
las personas sanas, y continuar
con la promoción de estilos
de vida saludable en personas
con FRCV.
Etiología de la linfadenopatía y
la biopsia escisional
O Paredes Ceballos, LF Pineda
Galindo, E Velázquez Jácome
Servicio de Medicina Interna,
UMAE-Especialidades Dr. Antonio Fraga Mouret, CMN La
Raza, IMSS, México, DF
Introducción: las adenopatías
son crecimientos anormales de
los ganglios linfáticos por múltiples causas expresando un signo
de enfermedad. Es por ello que
cuando se detecta, requiere investigación para un diagnóstico
más preciso. Objetivo: determinar la frecuencia y etiología
de linfoadenopatías mediante
biopsia escisional. Métodos:
estudio retrospectivo transversal
descriptivo observacional en
el servicio de Medicina Interna UMAE-Especialidades Dr.
Antonio Fraga Mouret, CMN
La Raza, IMSS en el periodo
del 2005-2009 por patología
ganglionar, de la muestra total
se incluyeron expedientes de
pacientes a los que les hicieron
la biopsia de ganglio periférico. Resultados: se incluyeron
88 pacientes: 49% de sexo
masculino, edad media de 49
años, (59% cervicales, 18%
inguinales, 13% supraclaviculares, 10% axilares). Se asocio
el 45% a fiebre y 60% a pérdida
de peso no intencionada. El
49% fue de origen neoplásico
(48% linfoma no Hodgkin, 21%
linfoma Hodgkin, 14% carcinomas, 12% adenomas y 5%
otros). Conclusiones: las adenomegalias son mas frecuentes en
mayores de 50 años y existe alta
frecuencia de neoplasias en todas las regiones seleccionadas
y de estas, el más frecuente fue
de origen hematológico (linfoma no Hodgkin). La fiebre no
fue siempre factor pronostico
de enfermedad, sin embargo
la perdida de peso puede tener
mayor relevancia en el diagnostico final. En nuestra población
la región axial se relacionó a
neoplasia en el 90%.
Hemorragia alveolar difusa:
frecuencia, etiología y desenlace en el Centro Médico,
ISSEMYM, Toluca
José Manuel Rodríguez Chagolla, Emilio Estrada Castro,
Miguel Ángel Rivero Navarro,
Heidegger Mateos Toledo, María Carmen, Alejandro Acuña
Arellano
Centro Médico, ISSEMYM, Toluca, Estado de México
La hemorragia alveolar difusa (HAD) es una emergencia
médica, amplia sospecha clínica, diagnostico temprano y
tratamiento. Pocos estudios
epidemiológicos sobre HAD.
Puede alcanzar una incidencia
de 8-36%, edad media de 57
S209
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
años en vasculitis asociada con
anticuerpos anticitoplasma de
neutrófilos (VAA) y mortalidad
de 23-92% en lupus eritematoso sistémico (LES). Objetivo:
describir frecuencia, etiología
y desenlace de HAD (centro
médico) 2008-2013. Métodos: análisis retrospectivo. Se
identificaron los pacientes con
diagnóstico de HAD. Criterios
de inclusión: 1) Clínicos: Tos,
disnea, esputo (hemoptoico),
dificultad respiratoria, fiebre,
dolor torácico. 2) Bioquímicos:
anemia (hombre: <13 g/dL, mujer < 11 mg/dL). 3) Radiológicos:
infiltrados alveolares difusos
bilaterales. 4) LBA sugestivo
y/o demostración de macrófagos-hemosiderina. Criterios de
exclusión: Diagnósticos que
expliquen el cuadro de HAD.
Variables: edad, sexo, HgB,
plaquetas, leucocitos, creatinina, cilindros eritrocitarios, Acs
anticitoplasma de neutrófilos
(MPO, PR3), ANA, anti-DNA.
Análisis de estudios radiológicos, lavado bronquioalveolar
(resultado histopatológico) y
biopsia pulmonar. LES se clasificó en base a criterios ACR4.
Al presentar serología positiva
ANCA (MPO o PR3), el diagnóstico de vasculitis fue tomado en
cuanta y fue clasificado según el
consenso de Chapel Hill 2012.
Resultados: 20 expedientes
analizados, 15 reunieron los
criterios de HAD, 5 fueron excluidos. Edad: 78.85 (18-86),
hombres: 7 (46.6%), mujeres 8
(53.3%). Diagnósticos: LES: 6
(40%), VAA 6 (40%) variantes
S210
de VAA: poliangeítis microscópica 3 (20%), granulomatosis
con poliangeítis 3 (20%), sin
diagnóstico 3 (20%). Unidad
de cuidados intensivos (UCI) 6
(40%), días UCI 13.5 (10-30),
VMI 7 (46.6%). Defunciones: 3
(20%), 2 LES, sin diagnóstico 1)
Variables: Tos, disnea y expectoración 100%, hemoptisis 80%,
dolor torácico 41.6%, fatiga
58.3%, fiebre 41.6%. Hemoglobina: 10.05 (15-6.6), leucocitos:
10,000 (17,900-6,000), plaquetas 267,000 (388,000-155,000),
creatinina 1.5 (6.2-0.5), proteinuria 41.6%, eritrocituria
66.6%. Conclusión: la causa
principal de HAD es la autoinmunidad (80%), esto concuerda
con otras series revisadas. El LES
como causa principal de HAD
difiere al resto de la bibliografía
(GPA). Se obtuvo diagnóstico
en 80% pacientes (sin histopatología). 80% siguen con vida,
20% falleció durante su estancia
hospitalaria.
Prevalencia de hipertensión arterial en el área metropolitana
de Monterrey
José Luis Ramos Martínez,
Mario Alberto Benavides González, Elena Alejandra Medina
Sánchez, Martha Mariela Sifuentes Loera, Blanca Elena
Vallejo Domínguez
Grupo CARDIOS, Facultad de
Medicina y Hospital Universitario, UANL, Monterrey, Nuevo
León
Introducción: la hipertensión
arterial es un padecimiento
multifactorial con incidencia
y prevalencia crecientes, con
más de la mitad de las personas
mayores de 60 años afectadas. Los pacientes hipertensos
tienen mayor riesgo de tener
insuficiencia cardiaca, eventos
coronarios, o desarrollar DM2,
enfermedad cerebral vascular
e insuficiencia renal crónica,
colocando a la enfermedad cardiovascular como la principal
causa de muerte en México.
Conociendo el impacto de estas
enfermedades, es necesario que
la población conozca cuales
son los principales factores
que los predisponen. Objetivo:
estimar la prevalencia de hipertensión arterial en la ciudad
de Mty, NL, México, así como
antecedentes personales de las
personas. Material y métodos:
el presente es un estudio descriptivo, de campo, transversal;
y la obtención de datos se realizó a partir de las mediciones
de la tensión arterial (TA) en 232
personas. La población estuvo
constituida por personas entre
16-80 años de ambos sexos, en
una clínica de cardiología, en
Monterrey, NL, México. Los datos de las variables estudiadas
se introdujeron en una base de
datos y se analizaron mediante
el programa estadístico SPSS
para Windows (versión 18),
comparándose los resultados
de las respuestas entre los 2
grupos. Resultados: en total, se
obtuvieron 232 personas para la
muestra, el 61.6 % femenino y
el 38.4% masculino, entre los
16 y los 80 años con una media
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
de 44±14.4 años. Se determinó
la HTA de acuerdo a la clasificación del JNC7. Acerca del
conocimiento de HTA, el 27%
refirió que era la primera vez
que le realizaban una toma de
presión arterial. El 44% reporto
ser hipertenso, pero solo el 34
% tenía cifras en niveles altos
al momento de la medición.
El 8% reporto tener alguna
enfermedad cardiovascular, el
13% acepto ser fumador, 18%
alcoholismo. En antecedentes
familiares: el 51% menciono
el antecedente de HTA, el 15%
reporto enfermedad cardiovascular y el 25% reporto alguna
defunción familiar por enfermedad cardiovascular. De todas
las personas que reportaron
que era la primera vez que les
median la presión arterial, 16
personas (26%). Conclusiones:
la detección de hipertensión fue
de 34%, mayor en comparación
a la ENSANUT 2012, aunque
habría que considerar diversos
factores, como que la medición
de la presión era voluntaria.
Aun así en los resultados por
estado, en Nuevo León la detección en total fue de 38%.
Factores clínicos y bioquímicos
relacionados con larga estancia
hospitalaria en el Servicio de
Medicina Interna del Hospital General Dr. Manuel Gea
González
Rosa Elena González Pimienta,
Alfredo Torres Viloria, Ivan Hernández Erazo, Itzel Lazcano
Romano, Guillermo Mendoza
García, Diego Mireles
Hospital General Dr. Manuel
Gea González, México, DF
Introducción: la larga estancia
hospitalaria ha sido definida
de forma arbitraria en diversos
estudios, los cuales tienen amplios rangos de referencia que
van desde una semana hasta
treinta días o más. Cada centro
hospitalario de acuerdo a la
administración bajo la que se
encuentre, intenta que la permanencia de un paciente posterior
al ingreso por cualquier causa,
sea del menor tiempo posible.
Objetivo: identificar los factores
asociados clínica y bioquímicamente con estancia prolongada
en el servicio de medicina interna. Métodos: se analizaron
expedientes de pacientes con
larga estancia hospitalaria y
con corta estancia, se excluyeron aquellos expedientes en
los cuales el motivo de egreso
fuera alta voluntaria o que su
larga estancia fuera predecible.
Resultados: se incluyeron 388
pacientes hospitalizados, de
los cuales 194 eran pacientes
de larga estancia hospitalaria
(LEH) y 194 de corta estancia
(CEH), la media de estancia
hospitalaria fue de 6.32 ± 2.39
y 19.06 ± 8.36 días respectivamente con una diferencia
estadísticamente significativa
(p≤0.001). Los niveles de colesterol LDL al ingreso fueron
mayores en aquellos pacientes
que presentaron LEH (p=0.02),
la creatinina sérica fue mayor
en estos pacientes (p=0.037).
Los niveles de albumina séri-
ca fueron significativamente
menores en aquellos pacientes
con LEH (p≤0.001). De acuerdo
al motivo de ingreso, aquellos
pacientes con neumonía adquirida en la comunidad y con
diagnóstico de infección VIH
presentaron en promedio mayor
estancia hospitalaria (p≤0.05).
Se demostró una diferencia
estadísticamente significativa
en cuanto a las infecciones
nosocomiales en los pacientes
con CEH en comparación con
los de LEH p≤0.001. También
se observó una diferencia significativa en pacientes a los
cuales se les realizaba intubación orotraqueal (p≤0.001) y
aquellos que se les realizaba
algún procedimiento quirúrgico
(p≤0.001). Conclusión: dentro
de los factores bioquímicos se
encontró que existe diferencia
significativa entre ambos grupos
en niveles de LDL, creatinina
sérica, hemoglobina, hematocrito y leucocitos, la albumina
sérica fue menor en pacientes
que presentaron larga estancia
hospitalaria en comparación
con estancia corta, se observa
mayor porcentaje de infecciones nosocomiales y altas por
defunción en aquellos que
presentaban LEH.
Escala de riesgo Framingham
en pacientes con enfermedad
panvascular en HAE
Juan Graham Casasús, J Ruiz
Macossay, MA Baños González,
A Tavares N, D Borraz N, Y Rodríguez S, B García V, JC Chable
DLC, JC Gómez M, E Ruiz G
S211
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
Hospital de Alta Especialidad
Tabasco, Tabasco
Introducción: enfermedad cardiovascular (ECV) es primera
causa de morbilidad y mortalidad en varios países. Factores
de riesgo (FR) se asocian a ECV:
edad, genero, dislipidemia, cHDL baja, HTA, tabaquismo,
DM, historia de EVC u obesidad y sedentarismo. Objetivo:
evaluar FR para ECV y escala
Framingham en ECV. Método:
estudio transversal analítico en
pacientes de 1 de marzo a 15 de
agosto 2014: Enfermedad vascular Aguda. Se registro datos
clínicos y antropométricos, FR
para ECV en mas de 18 años.
Los grupos: enfermedad coronaria (SICA), enfermedad cerebral
isquémica (EVCI), EVC hemorrágica (EVCH), enfermedad
arterial periférica (EAP). Se utilizó SPSS versión 18. Resultados:
89 ptes. Sin género predominante. G1EVCI, 37; G2: EVCH
15; G3 SICA 18; G4 EAP 19. FR
demográficos, clínicos y antecedentes familiares y personales. F
demográficos: Genero femenino
(50.8%) (45), grupo 1 ECI; 60%
EVCH, 50.2 % SICA; 47.4%
EAP. E civil casado 54 (80.7%).
N. escolar bajo 75 de 89 analfabetas. Ocupación prevalece
en el hogar y campo, 44 de 89
pobreza. Edad 62±12.3 años ,
IMC 32.66±37 Hb11.9 (±2.41),
Cr1.77 ± 2.03, urea 52 ± 39),
BUN 24 ±17, colesterol 194 ±
88), c-HDL 39 ± 10.2, albúmina
3.09 ± 0.87, proteinuria 110.5
± 329, glucemia 149.03±59.9,
S212
TFG Crotcoft 65 ± 44, CKD-EPI
63 ± 36, MDRD 62.68 ±4 0.6),
PAM 100 ± 14.6 ). Framingham
37.29% ± 25.9. Diferencia
entre grupos: Hb (p= 0.001),
hto (p= 0.002), Na sérico (p=
0.003), c-HDL (p=0.025), TAS
(p= 0.003) TAD (p= 0.045), PAM
(p= 0.007). El 60.7 % DX de
DM, análisis por grupos 89.6%
en grupo EAP, 72.2% en SICA,
61.4% EVC isquémico, 33.3 %
EVCH, diferencia estadística
(p= 0.003), 33.7% lleva control
médico. HAS 88.8% (79); 34
(91.9%) EVCI, 15 EVCH (100%),
16 SICA (88.9 %), 14(73.7%)
EAP. Sin diferencia entre grupos.
Dislipidemia (33.3%); SICA
(86.1 %); EAP 15.8 %; mayor en
grupo SICA diferencia significativa (p= 0.015). 27 ECV previo
(30.3 %); 18 (48.6%) EVCI; 2
EVC (13.3%); 5 SICA (27.8 %);
2(10.5%) con EAP MsIs, diferencia estadística (p= 0.009).
Relevantes: acantosis nigricans
28% en EVCH. Obesidad, 48%.
El RCV por Framingham en
pacientes fue77% riesgo alto.
SICA el grupo con mayor riesgo(94%). Conclusión: FR mas
prevalentes en enfermedad
panvascular HTAS y DM. 77%
tiene escala de riesgo alto a su
ingreso.
Incidencia de tuberculosis resistente a rifampicina y factores
asociados
Alejandro Garza Alpirez, Ana
Fernanda Alvarado Villalobos,
Luis Alonso Morales Garza,
María Teresa Sánchez Ávila,
Ricardo Garza Alpirez, Julio
Molina Gamboa, María Eugenia
Galindo Mimendi
Departamento de Infectología, Unidad Médica de Alta
Especialidad núm. 34, IMSS,
Monterrey, Nuevo León
Departamento de Medicina Interna, Hospital San José Tec de
Monterrey, Monterrey, Nuevo
León
Introducción: la tuberculosis
resistente ha crecido como
problema epidemiológico en
el mundo y ha incrementado
los costos de atención a más de
100 veces en comparación con
el tratamiento convencional.
En México existen pocos datos
que nos hablen de TB resistente y los factores que pudieran
llevar a que esta enfermedad
sea resistente al tratamiento
convencional. Existe además
un retraso en el diagnóstico temprano de resistencias
debido a que los cultivos generalmente tardan más de un mes
para verificar esto y debido a
ello se incrementa el número
de personas que se pudieran
contagiar. En cambio, con
GeneXpert podríamos agilizar
tanto el diagnóstico como el tratamiento adecuado para cada
paciente. Objetivos: conocer la
incidencia de TBrRIF mediante
GeneXpert (PCR en tiempo real)
y factores de riesgo asociados
a la resistencia. Material y
método: se realizó un estudio
retrospectivo, observacional,
transversal y de casos y controles en el cual se incluyeron
pacientes a los que se les reali-
1er Congreso Panamericano y XXXVII Congreso Nacional de Medicina Interna
zó GeneXpert MTBrif debido a
la sospecha de TB. Resultados:
se incluyeron 363 pacientes de
los cuales 87 (23.9%) fueron
positivos para GeneXpert y de
ellos 14 (16%) fueron resistentes y 73 (84%) no resistentes
a rifampicina. Las muestras
fueron de expectoración 7
(8%), lavado bronquioalveolar
56 (64.3%), líquido pleural 14
(16%) y otros 10 (11.4%). La
incidencia de tuberculosis es
de 24/100 pacientes y la resistencia a rifampicina es de 6.3
casos/100. Los pacientes con
Combe+ tienen OR 1.78 (IC
95% 0.40-1.25), tratamiento
previo OR 1.77 (C 95% 0.466.7), VIH OR 16.3 (C 95%
0.63-42.2), sexo femenino OR
2.04 (C 95% 0.64-6.48). Conclusiones: existe en México una
incidencia alta de tuberculosis
resistente a rifampicina, lo cual
si creáramos programas para
la detección oportuna y utilizáramos los nuevos métodos
diagnósticos para detección
de la enfermedad y resistencias, pudiéramos disminuir la
incidencia de esta enfermedad
y con ello los costos de salud
pública.
La epidemiología de las epilepsias en el Hospital General de
Pachuca, Hidalgo
Juan Andrés Huebe Rafool, Gerardo Alfonso Borbolla Serrano,
Marco García Méndez, Hipólito
Román Nava Chapa, Adrián
Valdez Espinoza, Alejandro Lechuga Martín Del Campo, Jorge
Alejandro Lemus Arias
Departamentos de Neurología
Clínica y Medicina Interna,
Hospital General de Pachuca,
Secretaría de Salud, Pachuca,
Hidalgo
La epilepsia es una de las
enfermedades más antiguas
de la Medicina que se caracteriza porque los pacientes
presentan una predisposición
permanente para sufrir crisis
convulsivas y sus consecuencias
neurobiológicas, cognoscitivas,
psicológicas y sociales. Se
calcula que a nivel mundial
existen 65 millones de enfermos
con epilepsia y que 8 de cada
1,000 personas sufren esta enfermedad. Los países en vías de
desarrollo cuentan con índices
de prevalencia más altos y con
un peor pronóstico que los países desarrollados. En México se
calcula que existen 11 a 20 casos de epilepsia por cada 1,000
habitantes. Las infecciones,
específicamente la cisticercosis
y la encefalopatía hipóxicoisquémica neonatal ocupan un
papel importante dentro de la
etiología de la epilepsia. Se describen las razones por las cuales
existe fracaso en el apego al
tratamiento farmacológico, señalando que en México existe
una escasez del abastecimiento
de los medicamentos antiepilépticos, carencia de recursos
económicos y desconocimiento
de la magnitud de la enfermedad e importancia de la ingesta
de los medicamentos por parte
de los pacientes. Además existe
una alta recurrencia de crisis
convulsivas en poblaciones de
alto riesgo, lo cual representa
un problema de salud pública.
Mencionamos algunos de los
efectos adversos más comunes. El objetivo del estudio
fue analizar el impacto de la
epilepsia en la calidad de vida
de los pacientes del Hospital
General de Pachuca, Hidalgo.
Se necesitan nuevos modelos
de atención médica centrada en
el paciente con epilepsia y sus
comorbilidades, respaldados
por recursos comunitarios para
mejorar el apego al tratamiento
farmacológico de los pacientes.
Factores de riesgo relacionados
con desarrollo de úlceras por
presión en el Hospital Universitario Dr. José Eleuterio
González
Sandra G Galindo Alvarado,
Rocío Morales Delgado, Dionicio A Galarza Delgado, María L
Galindo Alvarado
Hospital Universitario Dr. José
Eleuterio González, Monterrey,
Nuevo León
Introducción: las úlceras por
presión (UP) son definidas
como “lesión de origen isquémico, localizada en la piel y
tejidos subyacentes con pérdida
de sustancia cutánea, producida por presión prolongada o
fricción entre dos planos duros,
uno perteneciente al paciente
y otro externo a él”. Las úlceras por presión constituyen en
México un importante desafío
terapéutico para todo el personal de salud involucrado en su
S213
Volumen 30, Suplemento 1, 2014
Medicina Interna de México
manejo y tratamiento. Provocan
una prolongación de la estancia
hospitalaria y un aumento de
los costos, teniendo en cuenta
que “un 95% son evitables”
con los cuidados adecuados,
mejorando notablemente la
calidad de vida de las personas
y familiares que las cuidan. Material y método: se analizaron
los datos relacionados con los
pacientes que ingres